Parts for a reliable and field ready biosensing platform

Implementation of biosensors in real world situations has been made difficult by the unpredictable and non-quantified outputs of existing solutions, as well as a lack of appropriate storage, distribution and utilization systems. This leaves a large gap between a simple, functional sensing mechanism and a fully realised product that can be used in the field. We aim to bridge this gap at all points by developing a standardised ratiometric luciferase output in a Bacillus chassis. This output can be linked up with prototyped instrumentation and software for obtaining reliable quantified results. Additionally, we have reduced the specialized requirements for the storage and distribution of our bacteria by using Bacillus' sporulation system. To improve the performance of our biosensing platform we have genetically modified Bacillus’ germination speed. Lastly, we demonstrated the robustness of our system by testing it with a new fluoride riboswitch, providing the opportunity to tackle real life problems.

One minute tour! :)

Ribosense Labbook

Week 4

Tuesday (17/07/12)

PCR of MGRS vector

---

• Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.

• Primers:

• Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg

• Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT

• PCR settings:

• 95 °C - 6mins

• 98 °C - 10secs

• 58 °C - 45secs

• 72 °C - 180secs

• Repeat above 35x

• 72 °C - 5mins

• 25 °C - 1min

PCR of riboswitch DNA from bacillus genome

---

• Colony of strain 168 used as template for this experiment.

• Primers used:

• Forward: cggagggagacgattttgTGTTCCGTAATTGTGATGTAAG

• Reverse: acaccggcatactctgcgacGTCATAGGTCATGTTTTGAACC

• PCR settings - as above (run in parallel).

Wednesday (18/07/12)

Gel electrophoresis of PCR products

---

• PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.

• Lane 1: Ladder

• Lane 2 + 3: Riboswitch DNA from genome (replicates) - 550bp fragment expected.

• Lane 4 + 5: Vector DNA from pJS130 (replicates)- Chloramphenicol resistance marker - 9.0kbp fragment expected

• Lane 6: Postitive control - 1.9kbp fragment expected

• Riboswitch DNA was successfully amplified. However, vector DNA was not. Given that the postive control was also successful, it seems likely that something went wrong with some stage before the PCR amplification. We will try to rectify the problem tomorrow.

Purification of riboswitch DNA from gel

---

• Successful riboswitch DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.

Thursday (19/07/12)

PCR of vector

---

• Plasmid PJS 130 used as our backbone for isolating the magnesium riboswitch.

• Primers:

• Forward: TTCAAAACATGACCTATGACgtcgcagagtatgccg

• Reverse: cctccctctgctaaaacACAAGGCATTAACACTACAT

• PCR settings:

• 95 °C - 6mins

• 98 °C - 10secs

• 55 °C - 45secs

• 72 °C - 240secs

• Repeat above 35x

• 72 °C - 5mins

• 25 °C - 1min

• Settings changed - Annealing temperature and elongation time - attempting to debug PCR.

Gel electrophoresis of PCR products

---

• PCR fragments for Mg2+ riboswitch from yesterday separated on gel. 90mins at 100V.

• Lane 1: Ladder

• Lane 2, 3 + 4: Vector DNA from pJS130 (replicates) - 9.0kbp fragment expected

• Lane 5: Postitive control - 1.9kbp fragment expected

• Lane 6: Negative control - no fragments expected

• Once more, the PCR appears to have failed. We will try to redesign the primers tomorrow to make them functional.

Week 5

Thursday (26/07/12)

PCR of riboswitch DNA from bacillus genome and Lux genes from e.coli genome

---

• Colony of strain pJS130 used as template for riboswitch, colony of previously transformed e.coli used as template for lux operon.

• M2+ RS

• Forward: cggagggagacgattttg|TGTTCCGTAATTGTGATGTAAG

• Reverse: tataacgttactggtttcat|CGGGACTCGTACCTCC

• Lux operon

• Forward: gctgtacaag|GGAGGAGGAGGAAGTGGAGGAGGAGGAAGT|atgaagtttggaaatatttgtttttc

• Reverse: cctcgcccttgctcaccat|ACTCTATTCCTTTTTGGTGATTC

• PCR settings - as above (run in parallel).

Friday (27/07/12)

Gel electrophoresis of PCR products

---

Vector amplification gel. Lanes 2-4 Lux containing vector. Lanes 5-7 Fluorescent construct vector. No products from this gel were amplified.	Various. Lanes 3-5 mOrange amplification. Lanes 6-8 eCFP (E0020) amplification. mOrange amplification did not work.	Small products for fluorescent construct. Lanes 1-3 Terminator (B0015). Lanes 4-6 Promotor pVEG + SpoVG (K143053).
Various. Lanes 2-4 eYFP (E0030) amplification. Lanes 5-7 Mg2+ vector +8 codons. Lane 8 Mg2+ vector -8 codons. Lane 8 amplification did not work.	Mg2+ riboswitch gel. Lanes 6+7 positive and negative controls respectively for entire run. Lanes 3-5 genomic riboswitch amplification -8 codons. Lanes 2+3 vector -8 codons.

• PCR fragments for Mg2+ riboswitch, luxA/mOrange fusion and fluorescent construct from yesterday separated on gels. 90mins at 100V.

• Mostly successful, but will need to repeat four runs: Three vectors (fluorescent, fusion (lux) and Mg2+ riboswitch (-8 codons) and mOrange gene.

Purification of successfully amplified DNA from gel

---

• Successful CFP, YFP, B0015, Pveg + SpoVG (K143053), riboswitch and vector DNA extracted from gel and purified using a minelute column. DNA frozen for later Gibson assembly.

Week 6

Monday (30/07/12)

PCR of vectors and mOrange

---

• Not all products were obtained during Friday's PCR. Most of these missing products were large vector backbones. They are being run again, with a much longer extension time of 300s. If that fails, primers will be ordered to split the vectors into manageable chunks, and the PCR reattempted when they arrive.

• PCR cycle x35:

• 15s Denaturing at 95 C
• 45s Annealing at 60 C
• 300s Extension at 72 C

• Remaining stray product had a slightly tricky secondary structure at the 3' end. It will be run at a series of annealing temperatures in a PCR machine capable of a temperature gradient.

• mOrange PCR run at many different temperatures, from 62 °C to 76 °C. However this doesn't seem to solve our problem (refer to Gel photos). It seems likely that it is a primer design problem.

Construction of riboswitch plasmid with Gibson Assembly

---

• DNA from lanes 27+28, 27+29, 27+30 from gels run on Friday fused together with Gibson assembly to produce riboswitch construct. This does not have replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.

• DNA from lanes 22,23 and 24 fused with riboswitch DNA produced two weeks ago to produce riboswitch construct. This has replacement of the first 8 codons of lac I with the 8 codons native to the gene downstream of the riboswitch.

Transformation of Bacillus with riboswitch construct

---

• Plasmids made by Gibson transformed into bacillus cells made two weeks ago and transformants plated out on 5μg/ml chloramphenicol plates.

Tuesday (01/08/12)

Transformation of Bacillus with riboswitch construct

---

• Plasmids made by Gibson transformed into bacillus cells made two weeks ago and transformants plated out on 5μg/ml chloramphenicol plates.

Transformation of TOP10 E.coli with riboswitch construct

---

• Plasmids made by Gibson transformed into TOP10 e.coli cells and transformants plated out on 100μg/ml ampicillin plates.

Wednesday (01/08/12)

Mg2+ Riboswitch

---

• Successful colonies produced from transformations two days ago streaked out onto chloramphenicol (5 μg/ml) containing plates.

• Colonies also grown up in 10ml of medium A for use with plate reader later.

===Friday (03/08/12)

PCR of split Mg2+ vector

---

• PCR of magnesium riboswitch vector repeated with primers to split plasmid.

• Lanes 2 + 3: Fragment A (center - cut site (promotor side))

• Lanes 4 + 5: Fragment B (without 8 codon substitution) (cut site (lac I side) - center)

• Lanes 6 + 7: Fragment B (with 8 codon substitution) (cut stie (lac I side) - center)

• Gels run, found PCR was unsuccessful.

Sunday (05/08/12)

Ribosense: PCR of Mg Riboswitch vector fragments

---

• 2nd attempt since the PCR on Friday did not work, possibly due to mastermix problems

• PCR Programme:

• Results: Fragment A was successfully PCR-ed (lanes 3-4); Fragment B did not come out, with or without the 8 codons (lanes 5-6 (-8); lanes 7-8 (+8))

Week 7

Monday (06/08/12)

PCR of Magnesium riboswitch vector fragment B and Magnesium promoter

---

• Normal PCR settings used, annealing temperature 57 °C, elongation step 90s long.

• Lane 5 accidentally loaded with a DNA ladder instead of loading dye.

• Expected fragment sizes:

• Lane 2-5: 3kbp

• Lane 6-7: 300bp

• After electrophoresis, found vector products had, for the most part, worked. Promoter elements were not amplified - no band of the expected size was observed.

• Positive control also failed, although this has ceased to work for several days, potentially due to DNA degradation.

Tuesday (07/08/12)

Gibson assembly of magnesium riboswitch

---

• NAD+ added to isothermal buffer*5 mix

• Gel slices from yesterday (of vector fragment B) purified.

• DNA added as follows:

• Without 8 codon substitution:

• Reaction 1: Tube 2 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 28 (29/08/12) (riboswitch DNA).

• Reaction 2: Tube 3 (07/08/12) (fragment B), Tube 2 (05/08/12) (fragment A), Tube 29 (29/08/12) (riboswitch DNA).

• With 8 codon substitution:

• Reaction 3: Tube 4 (07/08/12) (fragment B), Tube 1 (05/08/12) (fragment A), Tube 2 (18/07/12) (riboswitch DNA).

Wednesday (08/08/12)

Electrical transformation of competent e.coli with Gibson products

---

• Gibson constructs from yesterday (fluorescent and magnesium riboswitch) transformed into e.coli produced yesterday.

• Cells plated out onto 50 μg/ml ampicillin plates. Put in incubator overnight.

Friday (10/08/12)

Characterization of fluoride riboswitch sensitivity with β-galactosidase

---

• X-Gal made up to a concentration of 400 μg/ml with water.

• Fluoride of concentrations 0.5 - 30 mM mixed with bacterial culture (Yale construct containing) grown up overnight.

Saturday (11/08/12)

Restriction digest of Yale plasmid

---

• Cells from electroporation of e.coli with plasmid from Yale (08/08/12) miniprepped to extract plasmid DNA.

• DNA digested with XhoI and SalI, expected fragment sizes 5580, 3139, 1437

• Gel run, results not shown as gel was very 'messy'. Gel had probably already begun to set when poured and so had many artefacts when imaged. As a result each lane required different brightness and contrast settings to visualise and so the full gel was not clearly visible on the printout. However, all of the bands could be identified on the screen and were exactly as expected and very clear and pure.

• Bands in correct places, indicating that expected plasmid was present in the cells. This indicates that, although they work at a very low efficiency, our electro-competent cells still work. It may be valuable to use these when trying to grow up plasmids that we already have at high concentration.

Transformation of e.coli with Magnesium riboswitch construct

---

• Gibson products from 07/08/12 transformed into chemically competent cells.

• Transformants plated out on 100 μg/ml ampicillin plates

Week 8

Wednesday (15/08/12)

Characterization of fluoride riboswitch construct

---

• Strain of bacillus lacking fluoride transporter system tested. Concentrations used:

• 0mM - 0.5mM - 1mM - 2.5mM - 5mM - 10mM - 20mM - 30mM

Thursday (16/08/12)

Characterization of fluoride riboswitch construct

---

• Eppindorfs containing the bacillus with the fluoride riboswitch removed from incubator and imaged.

• Now this definitely works, we will try quantifying this riboswitch with an ONPG assay and the plate reader.

Saturday (18/08/12)

Colonies picked in preparation for Miller assay

---

• 2 E. coli colonies transformed with the purified plasmid were picked and inoculated in LB with 50μg/ml Amp

• 2 colonies each from the 168 strain and crcB knockout B. subtilis containing the fluoride riboswitch were picked and inoculated in LB with 5μg/ml Chlor

PCR of Fluoride biobrick format

---

• Two sets of primers used: one to allow insertion into backbone by ligation, and one to allow insertion by Gibson assembly.

• Cycle settings:

• Melting - 98 °C - 10 seconds

• Annealing - 58 °C - 30 seconds

• Elongation - 72 °C - 100 seconds

• Products run on gel. Fragments produced of correct size, however they overlapped with the primer dimer band due to the small size of the fragments.

• DNA extracted and purified.

PCR of Mg2+ riboswitch construct vector

---

• Separate reactions for

• Cycle settings:

• Melting - 98 °C - 10 seconds

• Annealing - 58 °C - 30 seconds

• Elongation - 72 °C - 100 seconds

• Products run on gel. No fragments produced. Positive control worked however, so master mix clearly works.

• Given this PCR has worked in the past, will try to re-run with the same settings and hope for success in the future.

Sunday (19/08/12)

Miller Assay of Fluoride construct

---

• Colonies picked from overnight and Miller assay run as directed on protocols page

• Lack of filters meant that only A450 data recorderd

Week 9

Tuesday (21/08/12)

PCR for Mg Riboswitch

---

• PCRs were run for pJS130.1 split vector ('+8 codons')
• Colony PCR for endogenous Bacillus subtilis Mg Riboswitch ('+8 codons') was run
• Gels were run for above reactions, only one band for half of the pJS130 vector was visible.

Wednesday (22/08/12)

PCR for Mg Riboswitch

---

• PCRs were run for F Riboswitch from Yale's plasmid with overhangs for standard assembly.
• Colony PCR for endogenous Bacillus subtilis Mg Riboswitch (both '+8 codons' and '-8 codons' versions) were re-run.
• Gels were run for above reactions, only one band for positive control was visible.

Cells cultured for Miller assay

---

• B. subtilis strains carrying F riboswitch and 'KO' strains cultured separately in LB and 5µg/mL Chloramphenicol at 37°C
• E.Coli carrying F riboswitch cultured in LB and 50mg/ml Ampicillin at 37°C

Thursday (23/08/12)

• Miller assay set up and running with the wild type and crcB knock-out Bacillus strains and an E. coli strain which contains the construct on an episomal plasmid.

Friday (24/08/12)

• Miller assay data collected for analysis over the weekend

Week 10

Monday (27/08/12)

RiboSense:PCR of Mg RS from bacillus genomic DNA

---

• 3 part primers used, to amplify the 486bp from the genome, and the vector in two parts
• PCR failed, only positive control came out. Will re run when new primers arrive.

Thursday (30/08/12)

PCR of Mg2+ riboswitch from genomic DNA

---

• Cycle settings:

• Melting - 98 °C - 10 seconds

• Annealing - 58 °C - 30 seconds

• Elongation - 72 °C - 30 seconds

• Fragments of correct size produced for all except lane 5 produced. In this lane, DNA appears to have accumulated in the well, indicating it may be genomic. In future, will use lower numbers of template cells to avoid getting so much genomic DNA.

• Products extracted and purified.

PCR of PJS130 vector for Mg riboswitch construct

---

• Cycle settings:

• Melting - 98 °C - 10 seconds

• Annealing - 60 °C - 30 seconds

• Elongation - 72 °C - 110 seconds

• Fragment of correct size produced in lane 5, but too faint to be extracted successfully. None of the other lanes were successful. We will try this again tomorrow, at 58 °C and with 35 cycles (as is usual) instead of 30.

• Note that phusion enzyme was left with primers and template DNA for about half an hour before reaction began, possibly causing degradation of the primer DNA.

Friday (31/08/12)

PCR of PJS130 vector for MgRS construct

---

• Cycle settings:

• Melting - 98 °C - 10 seconds

• Annealing - 58 °C - 30 seconds

• Elongation - 72 °C - 120 seconds

• Products of correct sizes (5.5kbp and 3.5 kbp) produced for all reactions, although lanes 2 and 4 failed to produce any product, despite primer smear. Most likely, template was not added, or one of the primers was not added.

• Products excised and purified.

Gibson assembly of Mg2+ riboswitch construct

---

• Reaction 1: Without 8 codon substitution: Vec A, Vec B -8 (replicate 1), Genomic -8.

• Reaction 2: Without 8 codon substitution: Vec A, Vec B -8 (replicate 2), Genomic -8.

• Reaction 3: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 1).

• Reaction 4: With 8 codon substitution: Vec A, Vec B +8, Genomic +8 (replicate 2).

Transformation of e.coli with Gibson products

---

• 20 μl of Gibson reaction mix transformed into e.coli cells. Transformants plated out onto 100 μg/ml ampicillin plates.

Saturday (01/09/12)

Verification of Mg2+ gel extractions

---

• DNA used in Gibson from yesterday and several weeks ago. Run on gel to verify the presence of DNA fragments of the correct size after gel extraction.

• Old DNA appears to have degraded, or else products were produced in too small a quantity to show up on the gel. Fortunately, these are not/ have not been used.

• Bands of the correct size for fragment A (5.5kbp), fragment B (3.5kbp) and the genomic DNA (550bp) present. Though riboswitch DNA has not come out well in this image, it was present under visual examination.

• Approximate DNA concentrations in the range of 2 - 6 ng/μl.

Sunday (02/09/12)

Verification of Mg2+ riboswitch construct by colony PCR

---

• Gibson primers used to amplify out riboswitch section of plasmid produced and transformed into e.coli to verify if riboswitch had inserted into PJS130.
• Band at ~550bp in lanes 8 and 9 (replicates) indicate that the riboswich has only been successfuly transformed into the second of the two colonies picked on the +8 plate, and not at all for the -8 construct.

Miniprep of plasmid DNA

---

• E.coli from strains made yesterday miniprepped to get plasmid DNA at high concentration. After colony PCR results, all DNA other than that of the successful colony discarded.

Verification of Mg2+ riboswitch construct by restriction digest

---

• BamH1 and Sal1 used to digest plasmid DNA produced from miniprep.
• Resultant fragment run on gel.
• Bands produced inconclusive, possibly because of too short an incubation time with restriction enzymes. Expected bands at ~4900bp and ~4500bp. Will re-run experiment in future to check results of colony PCR.

Week 11

Wednesday (05/09/12)

PCR of biobrick fragments and MGRS construct fragments.

---

• Fluoride and magnesium riboswitch genomic DNA amplified with PCR, along with vector fragments for turning the MGRS into a biobrick and for producing the magnesium riboswitch construct.
• PCR settings: Annealing temperature - 58 °C, Elongation step - 60 seconds.
• Genomic fragments worked well, but longer backbone fragments mostly failed.
• Extractions of DNA from these gels failed almost completely. Will try purifying directly from PCR products next time - results may not produce such a high purity of the precise DNA we want, but the increase in yield should outweigh this problem.

Gibson assembly of -8 MGRS construct

---

• Fragments gel extracted earlier assembled with Gibson assembly.
• Fragments used:

• 9kbp fragment from tube 13 used as backbone.
• Genomic fragments from tubes 6 + 7.

Transformation of E.coli with Gibson products

---

• Gibson products from earlier today used to transform e.coli.
• Resultant transformants plated out on 100 μg/ml ampicillin plates.

Week 12

Monday (10/09/12)

PCR of biobrick vector DNA

---

• Attempted to run PCR of the backbone for the biobricks once more. Settings: Annealing temperature: 56°C, elongation time: 30secs.

• After running on gel, saw that while the -8 vector amplification appears to be producing some correctly sized (~2kb) bands, the other two only seem to be forming many primer dimers. Analysis of the sequence of the prefix and suffix revealed a CG palindrome that appears to be causing self annealing. Inserts are not affected, as they have the palindrome at the 5' end of the primer.

• Will retry at higher temperatures tomorrow.

Gibson assembly of biobricks

---

• Attempted Gibson assembly for the -8 magnesium riboswitch biobrick with the backbone fragments produced earlier today and the insert fragments produced yesterday.

Transformation of e.coli with Gibson products

---

• E.coli cells transformed with Gibson products produced earlier today.

• Transformants plated out on 25μ/ml chloramphenicol plates.

Restriction digest of magnesium riboswitch construct plasmids

---

• Colonies grown up from colonies produced from Gibson products made on Check!!! were miniprepped and plasmid DNA extracted.

• Restriction digest performed with Sal1 and BamH1. Expected fragment sizes: 4900bp and 4500bp. If plasmid lacks insert: 4900bp and 3950bp. These two possibilities should be distinguishable.

• Correct banding pattern seen for all colonies grown up, with both -8 and +8 construct. Shall verify identity further with colony PCR.

Thursday (13/09/12)

Magnesium Riboswitch Plate-Reader Assay

---

• Plate reader assay set up with magnesium riboswitch construct made over the last few days.

• Mg2+ concentrations used:

• 5μM, 10μM, 20μM, 50μM, 100μM, 200μM, 500μM, 1mM, 2mM, 5mM, 10mM, 20mM

• IPTG concentrations used:

• 0.05mM, 0.1mM, 0.2mM, 0.5mM, 1mM, 2mM, 5mM, 10mM

• Magnesium free medium B used as growth medium

• Results: fluorescence curves are constant, except for a distinct dip during the exponential phase of bacterial growth. After looking at various cultures under the fluorescence microscope and discussing the results with our advisors, we have decided that this is because the amino acids in the medium are fluorescing. Our bacteria are then degrading these, causing the dip observed. We will switch to M9 minimal medium for our assays in the future, as this does not autofluoresce.

Week 13

Week 14

Wednesday (26/09/12)

Miller Assay of Fluoride construct

---

• colonies picked from overnight and Miller assay run again as directed on protocols page

• 2 colonies each of E. coli, 168 strain, and crcB knockout strain Bacillus assayed

• Greater resolution at lower fluoride concentrations to test theory from previous assay

• Lack of filters meant that only A450 data recorderd