Team:LMU-Munich/Bacillus BioBricks

From 2012.igem.org

• Home
• Team
• Project
  • Why Beadzillus?
  • Bacillus Introduction
  • Bacillus BioBrickBox
  • GerminationSTOP
  • Sporobeads
  • Data
  • Applications
• Extras
  • Attributions
  • Collaborations
  • Registry
  • Bacillus Strains
  • Special: Inverter
  • Achievements
• Safety
  • Project Safety
  • Release for application
• Lab Notebook
  • Weekly Journal
  • Protocols
• Human Practice
  • SynBio Day
  • Students Practical Course
  • CAS SynBio Conference
  • Berlin Conference
• Sponsors

B⁴ - 22 core parts for Bacillus subtilis

A major goal of our iGEM project is to introduce B. subtilis as a new chassis for BioBrick-based Synthetic Biology. For that purpose, we created a toolbox of Bacillus BioBricks to contribute to the registry to make it accessible to many more future iGEM-Teams! This Bacillus BioBrick Box (B⁴) contains the following Bacillus specific parts:

Vectors	Promoters	Reporters	Affinity tags
pSBBs1C pSBBs4S pSBBs2E pSBBs1C-lacZ pSBBs3C-luxABCDE pSBBs4S-Pxyl pSBBs0K-Pspac Sporovector	Anderson PliaG Pveg PlepA PliaI xylR-Pxyl	gfp mkate2 lacZ luc+	Flag His cMyc Strep HA

Since Bacillus subtilis is not an organism commonly used in iGEM, please check out our Introduction.

Bacillus Vectors

We have generated a suit of BioBrick-compatible vectors: three empty insertional backbones with different antibiotic resistances and integration loci, two reporter and two expression vectors. Here is a list of all the vectors we cloned and used.

Bacillus Promoters

To provide a set of promoters of different strength we characterized several promoters in Bacillus subtilis. Both constitutive and inducible promoters are covered.

Bacillus Reporters

We designed and codon-optimized a set of reporters that are commonly used in B. subtilis.

Affinity Tags

All our tags have been synthesized by [http://de-de.invitrogen.com/site/de/de/home/Products-and-Services/Applications/Cloning/gene-synthesis.html GeneArt]. They are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags.

Find out more about the design of our prefix with ribosome binding site.

prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

• 3x Flag-tag [http://partsregistry.org/Part:BBa_K823034 (BioBrick:BBa_K823034)]

The Flag-tag was the first epitope tag to be published ([http://www.nature.com/nbt/journal/v6/n10/full/nbt1088-1204.html Hopp, Prickett et al. (1988)]). It consists of eight hydrophobic amino acids: DYKDDDDK. To enhence senstitivity in Western blots, it is routinely used as a 3x Flag tag in B. subtilis [http://www.ncbi.nlm.nih.gov/pubmed?term=wiegert%20flag (Kaltwasser et al., 2002)]. Its sequence is: DYKDHDGDYKDHDIDYKDDDDK. There are a variety of monoclonal antibodies against this tag, N-terminal as well as position insensitive.

• HA - tag [http://partsregistry.org/Part:BBa_K823035 (BioBrick:BBa_K823035)]

The HA-tag is an epitope derived from the HA-virus. There was first an antibody against it and then the epitope was characterized ([http://www.ncbi.nlm.nih.gov/pubmed/6204768 Wilson, I.A. et al. (1984)]). It was then furthermore used as a tag for protein purification and recognition ([http://www.ncbi.nlm.nih.gov/pubmed/2455217 Field et al. (1988)]). The amino acid sequence is: YPYDVPDYA.

• cMyc - tag [http://partsregistry.org/Part:BBa_K823036 (BioBrick:BBa_K823036)]

The cMyc-tag is derived from the cMyc gene product. Antibodies were generated from the immunization with synthetic peptides from the cMyc sequence ([http://mcb.asm.org/content/5/12/3610.short Evan, Bishop et al.(1985)]). The amino acid sequence is EQKLISEEDL.

• His - tag [http://partsregistry.org/Part:BBa_K823037 (BioBrick:BBa_K823037)]

The His-tag is a metal chelating peptide ([http://www.nature.com/nbt/journal/v6/n11/full/nbt1188-1321.html Hochul,Stüber et al. (1988)]) consisting of at least 6 histidin residues. It can be used for protein purification by metal²⁺ion-containing columns (nickel). There are also antibodies against this tag, or nickel/cobalt containing fluorescent probes can be used for detection. Moreover, an immobilization is possible in nickel/cobalt coated plastikware. The aminoacid sequence is:HHHHHHHHHH

• Strep - tag [http://partsregistry.org/Part:BBa_K823038 (BioBrick:BBa_K823038)]

The Strep-tag is a mimicry peptide of biotin which binds to Streptavidin ([http://www.sciencedirect.com/science/article/pii/S1050386299000339 Skerra, Schmidt (1999)]). Its sequence is WSHPQFEK. It can be used for protein purification, immobilization with streptavidin or strep-tactin ([http://www.ncbi.nlm.nih.gov/pubmed/9415448 Voss, Skerra (1997)]) or detection with Strep-tactin or antibodies.

Project Navigation

Bacillus Intro	Bacillus BioBrickBox	Sporobeads	Germination STOP