Promoter variants

We have created four new T7Lac hybrid promoters that are mutated based on both the T7 promoter and the lac operator. The hybrid promoters enable high gene expression levels by T7 RNA polymerase, while allowing control of the expression levels by IPTG. All four biobricks have been submitted to the Registry of Standard Biological Parts, together with detailed characterization of both RNA and protein expression levels of the promoters. See our method of analysis

T7 promoter

The T7 promoter comes from the phage T7 and is a strong promoter. T7 promoters can only be expressed in strains of bacteria that expresses T7 RNA polymerase (the unique polymerase that activates gene expression from the T7 promoter). T7 promoters can be classified into different classes, and each class corresponds to a different level of gene expression level. The commonly used T7 promoter is the class I variant because of its ability to produce a high amount of protein. The T7 promoter has three distinct regions: a recognition site, a melting box, and an initiation site. The recognition site is the specific region that the T7 promoter binds to. The melting box is highly conserved TATA box. The melting box allows the T7 RNAP to melt the two strands of DNA and start adding NTPs to build mRNA. The initiation site is where the first nucleotide of the mRNA is added. T7 RNAP favors the addition of guanine. As a result, most T7 promoters have a poly-G region of 3-5 nucleotides to increase the chance of initiation. BBa_K613007 is a classic example of a T7 lac promoter.

BBa_K613007:TAATACGACTCACTATAGGGAGAGGAATTGTGAGCGGATAACAA
T7 region:
TAATACGACTCAC - Recognize site
TATA - Melting box
GGGAGA - Initiation site

LacO operator and LacI repressor

The LacO operator is a DNA sequence that is recognized by the LacI repressor. The LacI repressor is found in the lac operon of E. coli. When the LacO is located in a promoter region, LacI repressor prevents transcription from the promoter by forming a "hairpin" like structure that prevents RNAPs from traveling along the DNA. The LacI repressor cannot bind to the LacO operator when lactose is bound to LacI. This property can be exploited to prevent the expression of a certain gene by modulating the level of lactose or a lactose analog. Since lactose is consumed by E. coli, researchers found an analog (called Isopropyl β-D-1-thiogalactopyranoside IPTG) that binds to the lacI repressor, but is not consumed by E. coli . The wild type lac operator is nearly-symmetrical and has its own binding properties. In our constructs, we characterized a symmetrical lac operator and measured its leaky expression levels (the amount of expression without the inducer present).