Team:ULB-Brussels/Material&Methods

From 2012.igem.org

Revision as of 22:36, 26 September 2012 by Guigui (Talk | contribs)

Home Team Project

Introduction /  Material & Methods /  Results

Parts Modeling Conclusion & Perspectives Safety Older wiki's




Team ULB-Brussels, project page!




Material & Methods

Summary

1. E. coli strains

  MC1061 : F− araD139, Δ(ara-leu)7696,galE15, galK16, Δ(lac)X74, rpsL (Strr), hsdR2 (rK−mK+), mcrA mcrB1

  TOP10 (Invitrogen) : F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 λ-



2.Plasmids

pP70 : plasmid which contains the microcin C7 operon and a resistance to chloramphenicol

pCID909 : plasmid which contains the microcin B17 operon and a resistance to ampicilin

pBAD18: arabinose-inducible vector containing kanamicyn resistance

pBAD33: arabinose-inducible vector containing chloramphenicol resistance

pSB1K3 : standard iGEM plasmid which has a resistance to Kanamycin

pSB1C3 : standard iGEM plasmid which has a resistance to Chloramphenicol

pSB1A3 : standard iGEM plasmid which has a resistance to Ampicilin



3. Primers

The following primers were produced by Sigma-Aldrich and the sequences are shown in a 5’-3’ orientation.

3.1. Primers for first amplification of each gene

  MccBA-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGGAATTAAAAGCGAGTG-3'

  MccBA-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTCAGATATGTGAACCACT-3'

   MccBB-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGGTGCTCCCTGATATTAA-3'

   MccBB-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTTATCTCTCCAGACAGCT-3'

   MccBC-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGTCAAAACACGAAC-3'

  MccBC-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTTACTGTAGACATTTATCAT-3'

  MccBE-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGGTTACATTAAAAATGGC-3'

  MccBE-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTCATTGAGAACTCCAG-3'

  MccBF-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGACCATACCTCT-3'

  MccBF-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTCAGTCTCCTGTT-3'

  MccCC-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGTTAATTGGTGTCTAC-3'

  MccCC-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTCATACCATCTCCTTTTTAA-3'

  MccCF-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGATGATACAATC-3'

  MccCF-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTTATTTCTCGGTAG-3'

3.2. Primers for second amplification

  Common-FOR

5'-GCAGAATTCGCGGCCGCTTCTAGAGCCTCAGCTACACGTGCACTG-3'

  Common-REV

5'-AGCCTGCAGCGGCCGCTACTAGTAGGTTATAACGCTTGAATTAAGCCGCGCCGCGAAGCGGCGTCGGCTTGAAT TTATGGGAATGGTAC-3'

3.3. Primers for insertion in immunity pBAD plasmid

  ImMccBG-FOR

5'-CATTCTAGAATTAAAGAGGAGAAAATGGATATAATAGAAAAAAG-3'

  ImMccBG-REV

5'-GCACATGCATCATCCCCCTAC-3'

  ImMccCF-FOR

5'-AGCCAAGCTTGCATGTTATTTCTCGGTAG-3'

  ImMccCF-REV

5'-AGCCAAGCTTGCATG TTATGGGAATGGTAC-3'

  ImMccCEFOR

5'-ATTCGAGCTCGGTACATGGTGCAGATTATC-3'

  ImMccCEREV

5'-TTTCTCCTCTTTAATTTAACCAATTACTTTTGAAT-3'

3.4. Primers for fixing BE

  MccCB Endo For

5'-TTGCTTTAGGTTCCTTAAGG-3'

  MccCB Endo Rev

5'-TCAGCTTCTGGTACCTTATG-3'

  MccCB synthgene For1

5'-AAGGATGATTTCTGGAATTCGCGGCCG-3'

  MccCB synthgene Rev1

5'-CCTTAAGGAACCTAAAGCAA-3'

  MccCB synthgene For2

5'-CATAAGGTACCAGAAGCTGA-3'

  MccCB synthgene Rev2

5'-AGCGGCCGCTACTAGTAGGTTATAACGCTT-3'

4. Media for bacteria

    Luria-Bertani (LB):

• 10g/l tryptone;

• 5g/l yeast extract;

• 5g/l NaCl

• (+12g/l of Agar for solid medium)

5. Solutions

• Mg(SO4)2 (10-2M)

• DMSO

6. Antibiotics

• Ampicilin 100mg/ml

• Kanamycin 50 mg/ml

• Chloramphenicol 20 mg/ml

Associated with LB, these antibiotics were diluated a thousand times.

7. Enzymes

• EcoRI, XbaI, SphI, PstI, 10U/µl

• rAPID Alkaline Phosphatase 1U/µl

• Taq polymerase Gotaq 5U/µl

• T4 DNA ligase 1U/µl

All these enzymes are associated with their own buffer.

8. PCR protocol

    Pcr solution:

• 1µl of dNTPs (10mM each)

• 0.5µl of primer 1 (20µM)

• 0.5µl of primer 2 (20µM)

• 10µl of buffer10X (color or colorless)

• 3µl of MgCl2

• 0.5µl of primer 1 (20µM)

• 0.5µl of primer 2 (20µM)

• 1µl of DNA

• 0.25µl of Taq polymerase

• 1.5µl of DMSO (optional)

• 33.75 (or 32.25 if DMSO) µl of H20

    Program:

• 1:94°C - 5min

• 2:94°C - 30sec

• 3:X°C - 30sec (X depends on the TM of the primer)

• 4:72°C - Y min (Y=30sec/500pb), (30 times from step2)

• 5:72°C 10min

9. Kits

Gel purification kit: Sigma-Aldrich, GenEluteTm PCR Clean-up (ref:NA1020)

Mini prep kit: Zymo Research, ZyppyTM Plasmid Miniprep Kit (ref: D4036)

10. Restriction

• Run a PCR to amplify the genes of interest with floating restriction sites.

• Digest the PCR product and the vector by the appropriate restriction enzymes.

     Restriction mix for the PCR products (insert):

       *Xµl of PCR products (X depending on the concentration of insert of the PCR products).

       *1µl of each restriction enzyme.

       *2µl appropriate buffer 10X.

       *Add Yµl bi-distilled water to reach a final volume of 20µl.

     Restriction mix for the vector:

       *200ng of vector.

       *1µl of each restriction enzyme.

       *2µl appropriate buffer 10X.

       *Add Xµl bi-distilled water to reach a final volume of 20µl.

• Incubate for one hour at 37°C

11. Ligation

• The ligation reaction proceeds with 100ng of restricted vector. The quantity of the PCR products is calculated according to the following formula: (100ng vector x PCR product size x 3)/(vector size) = PCR product quantity in ng.

     Ligation mix:

       *1µl T4 DNA ligase.

       *2µl buffer (10x).

       *Add the two restrictions reactions in a final volume of 20µl.

       *Add bi-distilled water for a final volume of 20µl.

       *ADN

• Incubate the ligation reaction overnight at room temperature.

• Electroporate the ligation on bacteria.

12. Preparation of electrocompetent cells

• Dilute 100x an overnight culture in LB medium and incubate at 30°C with shaking until the OD600nm reaches 0.5.

• Centrifuge in a cold rotor at 4500 rpm 4°C for 30 minutes.

• Remove supernatant, resuspend in 20ml cold H20, then centrifuge as above. Repeat this step twice.

• Remove supernatant, resuspend in 10ml cold glycerol, then centrifuge as above.

• Remove final supernatant carefully, resuspend in 1ml cold glycerol.

• Store it at -80°C.

13. Electroporation

   DNA dialysis:

• Fill a petri dish with dH2O.

• Make float a round 0.025µm Millipore dialysis filter on dH2O.

• Place the DNA on the Filter for 20 min, then take it back.

   Electroporation:

• Add dialysed DNA in 50µl of electrocompetent cells.

• Put mixture in an electroporation cuvette.

• Electroporate it at 2,500 volt, 200Ω and 25µFD.

• Add quickly 1ml of LB.

• Put the bacteria for 1 hours at 37°C.

• Plate the volume you need on dish (with appropriate antibiotics).

14. Sensitivity test

     This experiment requires overnight cultures of differents strains containing the pp70 plasmid encoding Microcin C7, the pCID909 plasmid encoding Microcin B17 and a sensitive strain containing no plasmid.

      1. Plate each of the previously cited strains of bacteria on different petri dishes with appropriate antibiotics.

      2. Centrifuge 15µl of each overnight culture. Put separately, 2µl of supernatant of each liquid culture on previously made bacterial lawn from step 1. Incubate it at         37°C overnight.

     For our experiment, we actually used two different clones (3 and 4) of bacteria containing the pCID909 plasmid encoding for microcin B17. We put 4 different drops on each bacterial lawn (2 drops of microcin B17 supernatant, 1 of microcin C7 supernatant and 1 of sensitive MC1061 supernatant).

     Supernatant of microcin C7 culture and microcin B17 culture are supposed to contain the corresponding microcin while supernatant of sensitive strain should not be toxic for any strain.