Team:Potsdam Bioware/Lab/Labjournal/September

Contents 1 AID 1.1 2012-09-03 1.2 2012-09-04 1.3 2012-09-05 1.4 2012-09-06 1.5 2012-09-07 1.6 2012-09-08 1.7 2012-09-09 1.8 2012-09-10 1.9 2012-09-11 1.10 2012-09-12 1.11 2012-09-13 1.12 2012-09-14 1.13 2012-09-15 1.14 2012-09-16 1.15 2012-09-17 1.16 2012-09-18 1.17 2012-09-19 1.18 2012-09-20 1.19 2012-09-21 1.20 2012-09-22 2 Antibody 2.1 2012-09-01 2.2 2012-09-03 2.3 2012-09-04 2.4 2012-09-05 2.5 2012-09-06 2.6 2012-09-07 2.7 2012-09-08 2.8 2012-09-09 2.9 2012-09-10 2.10 2012-09-11 2.11 2012-09-12 2.12 2012-09-13 2.13 2012-09-14 2.14 2012-09-15 2.15 2012-09-16 2.16 2012-09-22 2.17 2012-09-23 3 Virus 3.1 2012-09-02 3.2 2012-09-03 3.3 2012-09-04 3.4 2012-09-05 3.5 2012-09-06 3.6 2012-09-09 3.7 2012-09-10 3.8 2012-09-11 3.9 2012-09-12 3.10 2012-09-13 3.11 2012-09-14 3.12 2012-09-15 3.13 2012-09-16 3.14 2012-09-17 3.15 2012-09-18 3.16 2012-09-19 3.17 2012-09-20 3.18 2012-09-21 3.19 2012-09-22 3.20 2012-09-25

AID

2012-09-03

Miniprep of mVENUS construct and wildtype AID from transfected CHO cells

Investigators:

Rico

Aim:

• Miniprep of YFP-construct and wildtype AID from transfected CHO cells to proof whether it is possible to transform E.coli with the purified construct for sequencing

Method:

• Miniprep of cells

• Elution with 50 µL

Results:

CHO transfected with YFP WT-AID = 2.8 ng/µL

Transformation of mVenus and wildtype AID isolated samples and pCEP4

Investigators: Tom

Time: 2012-09-03

Materials:

• Bunsen burner, Agar plates with chloramphenicol

• icebox

• competent E. coli cells (XL 1 Blue)

• Venus plasmid - sample 1

Method:

Transformation via manual, 10 µl of miniprep sample and 1 µL of pCEP4 were used

Plate incubation start: 1:30 pm

Results:

ready for growing mutants to pick clones

Further tasks:

picking clones

Test digestion (Pst1) & gel electrophoresis of pAK100+scFV

Investigators:
Chris, Rico
Aim:
*testing the miniprep samples of pAK100+scFV

Results:
a 600 bp instead of 480bp

repetition of test digestion (Pst1) & gel electrophoresis of pAK100+scFV

Investigators:

Chris
Aim:
*testing the miniprep samples of pAK100+scFV

Results:
a 600 bp instead of 480bp

2012-09-04

preparation of competent E.coli XL1 blue cells

Investigators:

Basia, Chris

Method:

via standard manual

Results:

50 Eppendorf tubes with 100 µL competent XL1 blue

further tasks:

testing competence

Transfection of CHO cells with wt AID, AID without NES, with NLS+Kozak sequence, AID without NES, with NLS+Kozak sequence+eGFP

Investigators:

Rico

Aim:

• Transfection of CHO-cells with wt AID + small antibody construct, AID without NES, with NLS+Kozak sequence + small antibody construct, AID without NES, with NLS+Kozak sequence+eGFP + small antibody construct, small antibody construct

Method:

• 7 µg total DNA was used for transfection in 700 µL total volume:
  

• 3.5 µg wt AID + 3.5 µg small antibody construct
  

• 3.5 µg AID without NES, with NLS+Kozak sequence + 3.5 µg small antibody construct
  

• 3.5 µg AID without NES, with NLS+Kozak sequence+eGFP + 3.5 µg small antibody construct
  

• 7 µg small antibody construct
  

• 17.5 µL PEI in 700 µL Optimum/PEI-Mix

• vortex for 10 s 3 x

• 2 min incubation

• mix DNA solution with PEI solution (1:1)

• 15 min incubation

• add 400 µL PEI/DNA-solution to the CHO cells

send the DNA to sequencing

Investigators:

Tom S., Chris

sample	GATC number	Seq. Primer
CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA 2-1-2	II3637	pSB1C3 Forward
CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA 2-1-2	II3638	pSB1C3 Reverse
CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA 2-1-2	II3639	AID-C-Term Forward
CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH-polyA 2-1-2	II3640	eGFP-N-Term Reverse
Pak100+ScFv L1	II3688	GATC_std_RPC
Pak100+ScFv L1	II3689	GATC_std_sr_Hind3-672953
Pak100+ScFv RH1	II3690	GATC_std_RPC
Pak100+ScFv RH1	II3691	GATC_std_sr_Hind3-672953

inoculation of pCEP4

Investigators: Tom S.

Time: 2012-09-04 6 pm

Materials:

• LB medium
  

• Amp 25 mg/ml stock solution
  

• plate with cultures: pCEP4 (from 2012-09-03)

Method:

Inoculation of:

1 culture of pCEP4 plate in 5 ml LB medium + 5 µL amp.

(--> 1 culture)

Further tasks:

• Miniprep
  

repetition of digestion of pAK100& scFV pKMEF425bla (SfiI&AscI)

Investigators: Chris

Time: 2012-09-04 9 pm

Method:

sample preparation:

5µL (2000 ng) pAK100, 20 µL H2O, 3 µL Neb3, 2µL AscI

25 µL ScFV, 3 µL Neb3, 2µL AscI

incubation over night at 37°C

Further tasks:

• addition of BSA, SfiI and incubation at 50 °C
  

Overnight culture of ER2738 cells

Investigators: Basia

Time: 2012-09-04 7 pm

Materials:

LB medium, tetracycline stock solution, glycerol stock of ER2738 cells

Method: inoculation in 20 ml LB medium + 20µl tetracycline stock, shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

preparation of competent cells and helper phage culturing

2012-09-05

Preparation of helper phage

Investigators: Basia/Chris

Time: 2012-09-05 10am

Materials:

LB medium, tetracycline stock solution, overnight culture of ER2738 cells, helper phage stock solution, Kanamycin, PEG-NaCl solution, TBS buffer

Method:

amplification and clean up of helper phage according to the manual

Further tasks:

continuation on the next day

Preparation of competent cells ER2738

Investigators: Basia/Chris

Time: 2012-09-05 10am

Materials:

LB medium, tetracycline stock solution, overnight culture of ER2738 cells, CaCl2, Glycerol

Method:

preparation of competent cells according to the manual

Results:

competent cells ready to use

Further tasks:

Transformation

Transformation of pBad with wtAID

Investigators: Basia

Time: 2012-09-05 6pm

Materials:

• Bunsen burner, Agar plates with ampicillin

• icebox

• competent ER2738 cells

• pBad plasmid with wtAID

Method:

Transformation via manual, 5 µl of plasmid was used

Plate incubation start: 7:30 pm

Results:

ready mutants to pick clones

Further tasks:

picking clones

Documentation of growing CHO cells under the microscope (24h incubation)

Investigators: Rico, Tom S.

Time: 2012-09-05

Materials:

• six well plates with growing CHO cells (24h), which were transfected with EGFR-construct alone or in combination with WT AID or AID without NES, with NLS+Kozak sequence or AID without NES, with NLS+Kozak sequence+eGFP

• Fluorescence microscope

Method:

take a photo of each well with a filter for GFP, YFP and brightfield

Isolation of mutation rate samples (EGFR-construct (EGFR-C) alone, with AID without NES, with NLS+Kozak sequence, with AID without NES, with NLS+Kozak sequence+eGFP and with wildtype AID from transfected CHO-Cells (24h incubation))

Investigators:

Rico, Tom S.

Aim:

• Isolation of mutation rate samples (EGFR-construct alone, with AID without NES, with NLS+Kozak sequence, with AID without NES, with NLS+Kozak sequence+eGFP and with wild type AID from transfected CHO cells) to separate the plasmids for sequencing

Method:

• Miniprep of cells

• Elution with 20 µL

Results:

CHO-transfected with EGFR-C = 20,7 ng/µL

CHO-transfected with EGFR-C and WT AID = 18,1 ng/µL

CHO-transfected with EGFR-C and AID without NES, with NLS+Kozak sequence = 55,7 ng/µL

CHO-transfected with EGFR-C and AID without NES, with NLS+Kozak sequence+eGFP = 40,0 ng/µL

Further tasks:

transformation of the plasmids

Transformation of plasmids from cells which grew for 24h (Mutation rate)

Investigators: Tom

Time: 2012-09-05

Materials:

• Bunsen burner, Agar plates with chloramphenicol

• icebox

• competent E. coli cells (XL 1 Blue)

• samples of 24h incubation

Method:

Transformation via manual, 1:2 dilutions of prepped samples were used

Results:

ready for growing mutants

Further tasks:

picking clones

2012-09-06

Preparation of helper phage - continuation

Investigators: Basia

Time: 2012-09-06

Materials:

LB medium, PEG-NaCl solution, TBS buffer

Method:

continuation of clean up of helper phage according to the manual

Overnight culture of ER2738 cells with AID in pBAD

Investigators: Basia

Time: 2012-09-06 5:30 pm

Materials:

LB medium, ampicillin stock solution, plate with transformed colonies from 5.9.2012

Method: inoculation in 20 ml LB medium + 20µl ampicillin stock, shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

preparation of competent ER2738 cells with AID in pBAD

Documentation of growing CHO-Cells under the microscope (48h incubation)

Investigators: Rico, Tom S.

Time: 2012-09-06

Materials:

• six well plates with growing CHO cells (24h) which were transfected with EGFR-construct alone or in combination with WT AID or AID without NES, with NLS+Kozak sequence or AID without NES, with NLS+Kozak sequence+eGFP

• Fluorescence microscope

Method:

take a photo of each well with a filter for GFP, YFP and brightfield

Isolation of mutation rate samples (EGFR-construct (EGFR-C) alone, with AID without NES, with NLS+Kozak sequence, with AID without NES, with NLS+Kozak sequence+eGFP and with wild type AID from transfected CHO cells (48h incubation))

Investigators:

Rico, Tom S.

Aim:

• Isolation of mutation rate samples (EGFR-construct alone, with AID without NES, with NLS+Kozak sequence, with AID without NES, with NLS+Kozak sequence+eGFP and with wild type AID from transfected CHO cells) to separate the plasmids for sequencing

Method:

• Miniprep of cells

• Elution with 20 µL

Results:

CHO-transfected with EGFR-C = 45,9 ng/µL

CHO-transfected with EGFR-C and WT AID = 41,7 ng/µL

CHO-transfected with EGFR-C and AID without NES, with NLS+Kozak sequence = 24,8 ng/µL

CHO-transfected with EGFR-C and AID without NES, with NLS+Kozak sequence+eGFP = 18,6 ng/µL

Further tasks:

transform plasmids

Inoculation of plasmid samples of the 24h retransformation plates

Investigators: Tom S.

Time: 2012-09-06 4pm

Materials:

• LB medium
  

• Amp 25 mg/ ml stock solution
  

• plate with cultures: EGFR-C
  

EGFR-C-WT AID

EGFR-C-AID without NES, with NLS+Kozak sequence

EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP

(all from 2012.09.06)

Method:

Inoculation of:

5 cultures per plate in 5 ml LB medium + 5µL amp.

(--> 20 cultures)

Further tasks:

• Miniprep
  

Checking the sequencing data

Investigators: Tom S.

Aim: choose the right constructs

Results:

CMV+AID without NES, with NLS+Kozak sequence+eGFP+hGH in pSB1C3 2-1-2 -> is good

2012-09-07

Preparation of competent cells ER2738+AID in pBAD

Investigators: Basia

Time: 2012-09-07 10am

Materials:

LB medium, ampicillin stock solution, overnight culture of ER2738 cells with AID in pBAD, CaCl2, Glycerol

Method:

preparation of competent cells according to the manual

Results:

competent cells ready to use

Further tasks:

Transformation

Transformation of pAK100 with scFV into ER2738 with AID in pBAD

Investigators: Basia

Time: 2012-09-07 7pm

Materials:

• Bunsen burner, Agar plates with ampicillin

• icebox

• competent ER2738 cells

• pAK100 plasmid with scFV L1

Method:

Transformation via manual, 4 µl of plasmid was used

Plate incubation start: 7:00 pm

Results:

ready mutants to pick clones

Further tasks:

picking clones

Miniprep of overnight cultures of 24h cultures for mutation rates

Investigators:

Rico, Tom S.

Aim:

Miniprep of overnight cultures of 24h cultures for mutation rates

Method:

Miniprep Thermo Scientific according to the manual

Results:

Concentrations

Sample	Concentration [ng/µL]
EGFR-C 1	378,3
EGFR-C 2	318,0
EGFR-C 3	385,6
EGFR-C 4	303,9
EGFR-C 5	368,6
EGFR-C-WT AID 1	274,9
EGFR-C-WT AID 3	393,8
EGFR-C-WT AID 4	313,5
EGFR-C-WT AID 5	299,6
EGFR-C-AID without NES, with NLS+Kozak sequence 1	232,7
EGFR-C-AID without NES, with NLS+Kozak sequence 2	376,5
EGFR-C-AID without NES, with NLS+Kozak sequence 3	399,2
EGFR-C-AID without NES, with NLS+Kozak sequence 4	394,2
EGFR-C-AID without NES, with NLS+Kozak sequence 5	243,0
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 1	408,4
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 2	391,5
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 3	440,2
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 4	364,5
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 5	468,3

Further Tasks:

send to sequencing

send the DNA to sequencing for mutation rate (24h)

Investigators:

Tom S.

sample	GATC number	Seq. Primer
EGFR-C 1	II3641	pcDNA 3.1-FP
EGFR-C 2	II3642	pcDNA 3.1-FP
EGFR-C 3	II3643	pcDNA 3.1-FP
EGFR-C 4	II3644	pcDNA 3.1-FP
EGFR-C 5	II3645	pcDNA 3.1-FP
EGFR-C-WT AID 1	II3646	pcDNA 3.1-FP
EGFR-C-WT AID 3	II3647	pcDNA 3.1-FP
EGFR-C-WT AID 4	II3648	pcDNA 3.1-FP
EGFR-C-WT AID 5	II3649	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence 1	II3650	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence 2	II3651	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence 3	II3652	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence 4	II3653	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence 5	II3654	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 1	II3655	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 2	II3656	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 3	II3657	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 4	II3658	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 5	II3659	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP pool	II3660	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence pool	II3661	pcDNA 3.1-FP

Documentation of growing CHO cells under the microscope (72h incubation)

Investigators: Rico, Tom S.

Time: 2012-09-07

Materials:

• six well plates with growing CHO cells (72h) which were transfected with EGFR-construct alone or in combination with WT AID or AID without NES, with NLS+Kozak sequence or AID without NES, with NLS+Kozak sequence+eGFP

• Fluorescence microscope

Method:

take a photo of each well with a filter for GFP, YFP and brightfield

Isolation of mutation rate samples (EGFR-construct (EGFR-C) alone, with AID without NES, with NLS+Kozak sequence, with AID without NES, with NLS+Kozak sequence+eGFP and with wild type AID from transfected CHO cells (72h incubation))

Investigators:

Rico

Aim:

• Isolation of mutation rate samples (EGFR-construct alone, with AID without NES, with NLS+Kozak sequence, with AID without NES, with NLS+Kozak sequence+eGFP and with wild type AID from transfected CHO cells) to separate the plasmids for sequencing

Method:

• Miniprep of cells

• Elution with 50 µL

Results:

CHO-transfected with EGFR-C = 16,3 ng/µL

CHO-transfected with EGFR-C and WT AID = 15,3 ng/µL

CHO-transfected with EGFR-C and AID without NES, with NLS+Kozak sequence = 23,9 ng/µL

CHO-transfected with EGFR-C and AID without NES, with NLS+Kozak sequence+eGFP = 21,5 ng/µL

Further tasks:

transform plasmids

Transformation of samples from cells which grew for 48h and 72h (Mutation rate)

Investigators:Rico, Tom S.

Time: 2012-09-07

Materials:

• Bunsen burner, Agar plates with chloramphenicol

• icebox

• competent E. coli cells (XL 1 Blue)

• samples of 48h and 72h incubation

Method:

Transformation via manual, 1:5 dilutions of miniprep samples were used

Results:

ready for growing mutants

Further tasks:

picking clones

2012-09-08

Inoculation of plasmid samples of the 48h retransformation plates

Investigators: Basia

Time: 2012-09-08 6pm

Materials:

• LB medium
  

• Amp 25 mg/ ml stock solution
  

• plate with cultures: EGFR-C
  

EGFR-C-WT AID

EGFR-C-AID without NES, with NLS+Kozak sequence

EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP

(all from 2012.09.07)

Method:

Inoculation of:

5 cultures per plate in 5 ml LB medium + 5µL amp.

(--> 20 cultures)

Further tasks:

• Miniprep
  

Inoculation of cells ER2738 with AID in pBAD and scFV in pAK100

Investigators: Basia

Time: 2012-09-08 11am

Materials:

LB medium, ampicillin stock solution, chloramphenicol stock solution, arabinose 10% stock solution, plates with ER2738 cells with AID in pBAD and scFV in pAK100,

Method:

picking clones from a plate with ER2738 cells with AID in pBAD and scFV in pAK100 into 200ml of LB medium with antibiotics (ampicillin and chloramphenicol) and 0,1% arabinose or 0,01% arabinose (2 flasks, 200ml LB in each)

Results:

Slow growth of the cells

Further tasks:

Inoculation of overnight culture without arabinose

Inoculation of cells ER2738 with AID in pBAD and scFV in pAK100

Investigators: Basia

Time: 2012-09-08 5pm

Materials:

LB medium, ampicillin stock solution, chloramphenicol stock solution, plates with ER2738 cells with AID in pBAD and scFV in pAK100,

Method:

picking clones from a plate with ER2738 cells with AID in pBAD and scFV in pAK100 into 5ml of LB medium with antibiotics (ampicillin and chloramphenicol)

Results:

culture grew

Further tasks:

preparation of phages

PCR of AID with Thiophosphate primers

Investigators: Rico

Materials:

Mastermix

reagent	volume [µL]
HF Phusion buffer 5x	10
dNTPs	1
Primer (Forward)	1,25
Primer (Reverse)	1,25
DNA (BBa_K103001 AID in pSB1A2 10 ng/µl)	1,0
Phusion Polymerase	0,5
water	35,0

Program

step	Temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	5	17
annealing	66	20	17
elongation	72	18	17
denaturation	98	5	17
annealing+elongation	72	18	17
final elongation	72	600	1
cooling	4	∞	1

Further Tasks:

PLICing variants

Digestion of wt AID

Investigators: Rico

Aim: get the backbone for the Potsdam standard cloning vector

Materials:

• digestion with 1 µL XbaI and 1 µL PstI
  

Further Tasks:

• electrophoretic separation

• ligation of the new standard cloning vector

2012-09-09

Preparation of the phages for phage display

Investigators: Basia

Time: 2012-09-09 10am-11pm

Materials:

LB medium, tetracycline stock solution, chloramphenicol stock solution, overnight culture of ER2738 cells, helper phage, Kanamycin, PEG-NaCl solution, TBS buffer

Method:

1. 2 Erlenmeyer flasks 100ml LB in each + 100µl of ampicillin stock solution + 100µl of chloramphenicol stock solution

2. one with no arabinose, the other one with 0,01% arabinose (when OD600 0,3-0,5)

3. addition of 30µl of helper phages (cleaned up on 6.9.2012) - when OD600 0,3-0,5

4. further amplification and clean up of phage according to the manual

Further tasks:

continuation on the next day

Miniprep of overnight cultures of 48h cultures for mutation rates

Investigators:

Basia

Aim:

Miniprep of overnight cultures of 48h cultures for mutation rates

Method:

Miniprep Thermo Scientific according to the manual

Results:

Concentrations

Sample	Concentration [ng/µL]
EGFR-C 1	201.6
EGFR-C 2	110.1
EGFR-C 3	106.1
EGFR-C 4	180.0
EGFR-C 5	128.1
EGFR-C-WT AID 1	121,1
EGFR-C-WT AID 2	118,4
EGFR-C-WT AID 3	136,1
EGFR-C-WT AID 4	110.8
EGFR-C-WT AID 5	122,1
EGFR-C-AID without NES, with NLS+Kozak sequence 1	157,1
EGFR-C-AID without NES, with NLS+Kozak sequence 2	125,3
EGFR-C-AID without NES, with NLS+Kozak sequence 3	133,9
EGFR-C-AID without NES, with NLS+Kozak sequence 4	176,5
EGFR-C-AID without NES, with NLS+Kozak sequence 5	142,3
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 1	112,2
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 2	125,1
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 3	107,8
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 4	123,6
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 5	114,2

Further Tasks:

send to sequencing

Inoculation of plasmid samples of the 72h retransformation plates

Investigators: Basia

Time: 2012-09-09 6pm

Materials:

• LB medium
  

• Amp 25 mg/ ml stock solution
  

• plate with cultures: EGFR-C
  

EGFR-C-WT AID

EGFR-C-AID without NES, with NLS+Kozak sequence

EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP

(all from 2012.09.07)

Method:

Inoculation of:

5 cultures per plate in 5 ml LB medium + 5µL amp.

(--> 20 cultures)

Further tasks:

• Miniprep
  

Inoculation of cells ER2738 with AID in pBAD and cells ER2738 without AID in pBAD

Investigators: Basia

Time: 2012-09-08 8:30pm

Materials:

LB medium, ampicillin stock solution, tetracyclin stock solution, competent ER2738 cells with AID in pBAD and competent ER2738 cells without AID in pBAD

Method:

100µl of competent ER2738 cells with or without AID in pBAD and scFV in pAK100 into 5ml of LB medium with antibiotics (ampicillin or tetracyclin)

Results:

cultures grew

Further tasks:

infection with phages and selection for mutated clones

2012-09-10

Preparation of phage - continuation

Investigators: Basia/Chris

Time: 2012-09-10

Materials:

LB medium, PEG-NaCl solution, TBS buffer

Method:

continuation of clean up of phages for phage display

Infection with phages of the cells ER2738 with AID in pBAD and without AID in pBAD

Investigators: Basia /Chris

Time: 2012-09-10 2pm

Materials:

LB medium, tetracycline stock solution, chloramphenicol stock solution, ampicillin stock solution, overnight culture of ER2738 cells (once with once without AID in pBAD), phages cleaned up on 10.09.2012

Method:

1. 4 Erlenmeyer flasks 100ml LB in each + 100µl of ampicillin stock solution (into the flasks with AID in pBAD) - x2 or + 100µl of tetracycline stock solution (into flasks without AID) - x2

2. two with no arabinose (into the flasks without AID in pBAD), the other two with 0,01% arabinose (when OD600 0,3-0,5, into flasks with AID)

3. addition of 280µl of phages (cleaned up on 10.9.2012) - when OD600 0,3-0,5

4. addition of chloramphenicol stock solution - 1h after infection with phages

5. further amplification of infected cells in 32°C

Further tasks:

Plating of the colonies onto the LB plates with appropriate antibiotics

Plating of the colonies onto the LB plates with appropriate antibiotics

Investigators: Chris

Time: 2012-09-10 9pm

Materials:

Plates with LB medium with tetracycline and chloramphenicol and plates with LB medium with ampicillin and chloramphenicol, cultures infected with phages

Method:

850µl of the cultures infected with phages (see 10.09.2012 - phage infection) were centrifuged and the supernatant was discarded. 20µl of the resuspended pellet was used for plating

each culture was plated on the plates with appropriate antibiotics (E. coli without AID -infected with Phages 1&2 on Tet and and Chloramphenicol, E. coli with AID -infected with Phages 1&2 on Chloramphenicol and amp)

Further tasks:

preparation of mutated vectors for sequences

Purification of transformed plasmids from the transfected CHO cells

Aim: purification of the transformed single chain construct with YFP from the CHO cells 3 days after transfection

Investigators: Maria, Rico

Method: purification kit from Thermo Scientific

Results:

Concentrations

Sample	Concentration [ng/µL]
EGFR-C 1	367.3
EGFR-C 2	342.6
EGFR-C 3	276.0
EGFR-C 4	285.1
EGFR-C 5	263.3
EGFR-C-WT AID 1	288.3
EGFR-C-WT AID 2	301.4
EGFR-C-WT AID 3	292.7
EGFR-C-WT AID 4	317.9
EGFR-C-WT AID 5	293.4
EGFR-C-AID without NES, with NLS+Kozak sequence 1	373.1
EGFR-C-AID without NES, with NLS+Kozak sequence 2	356.8
EGFR-C-AID without NES, with NLS+Kozak sequence 3	399.4
EGFR-C-AID without NES, with NLS+Kozak sequence 4	357.1
EGFR-C-AID without NES, with NLS+Kozak sequence 5	325.4
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 1	315.4
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 2	305.6
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 3	359.5
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 4	330.2
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 5	374.2

2012-09-11

picking clones and overnight culture of the colonies grown on the plates from 10.9.2012 and XL1 BLue with CFP and YFP

Investigators: Basia/Chris

Time: 2012-09-03 7 pm

Materials:

LB medium, ampicillin stock solution, chloramphenicol stock solution, tetracycline stock solution, plates with colonies from 10.9.2012

Method: inoculation in 5 ml LB medium + 5µl ampicillin chloramphenicol & tetracycline:

the only colony of ER2738 with AID infected with Phage 1 inoculated

inoculation in 5 ml LB medium + 5µl chloramphenicol & tetracycline:

ER2738 without AID infected with Phage 1 and 2-> 5 single colonies, 1 mixed culture (500 µl LB were spread on the plate and 10 µL used for inoculation)of each

inoculation in 50 ml LB medium + 50 µl ampicillin

XL1-Blue with CFP and Xl1-Blue with YFP

shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

Miniprep, inoculation of overnight cultures (CFP, YFP, Mixed cultures - P1-AID, P1+AID, P2-AID)

Transfection of CHO cells in 6 well plate and ibidi dishes

Investigator: Rico

Aim: transfection of CHO cells with EGFR-C/modified AID, EGFR-C/ wt AID and EGFR-C alone in 6 well dishes and modified AID alone in ibidi dishes

Further Tasks: documentation of fluorescence with fluorescence microscope

PCR of RFP with restriction sites for RFC 10

Investigator: Sascha, Rico

Aim: amplification of RFP to add the restriction sites for RFC 10

Materials:

Mastermix

reagent	volume [µL]
HF Phusion buffer 5x	10
dNTPs	1
Primer (Forward)	1,25
Primer (Reverse)	1,25
DNA (BBa_K103001 AID in pSB1A2 10 ng/µl)	1,0
Phusion Polymerase	0,5
water	35,0

Program

step	Temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	5	17
annealing	70	20	17
elongation	72	18	17
denaturation	98	5	17
annealing+elongation	72	18	17
final elongation	72	600	1
cooling	4	∞	1

Furhter Tasks: ligation of RFP and digested pSB1C3

2012-09-12

Miniprep of overnight cultures

Investigators:

Chris/Basia

Aim:

Miniprep of overnight cultures

Method:

Miniprep Thermo Scientific according to the manual

Results:

Concentrations

Sample	Concentration [ng/µL]
CFP (AmpR)	184
Phage 1 C1	740
Phage 1 C2	843
Phage 1 C3	740
Phage 1 C4	620
Phage 1 C5	685
Phage 2 C1	842
Phage 2 C2	689
Phage 2 C3	622
Phage 2 C4	683
Phage 2 C5	777.6

Phage 1 was produced under expression of AID (mutated, but there was no AID while reinfection of E.coli)

Phage 2 is the control(Phage production and Infection without AID)

C1-C5 where picked colonies

send DNA from colonies after first round of phage display to sequencing

Investigators:

Basia/Chris

sample	GATC number	Seq. Primer
Phage1(mut) C1	II3662	GATC_Std_RPC
Phage1(mut) C2	II3663	GATC_Std_RPC
Phage1(mut) C3	II3664	GATC_Std_RPC
Phage1(mut) C4	II3665	GATC_Std_RPC
Phage1(mut) C5	II3666	GATC_Std_RPC
Phage2(not mut) C1	II3667	GATC_Std_RPC
Phage2(not mut) C2	II3668	GATC_Std_RPC
Phage2(not mut) C3	II3669	GATC_Std_RPC
Phage2(not mut) C4	II3670	GATC_Std_RPC
Phage2(not mut) C5	II3671	GATC_Std_RPC

Inoculation of main cultures: CFP (ampR), mixed colonies of mutated and non mutated infected colonies (in E.coli without AID ->Tet, CM-resistance)

Investigators:Basia/Chris

Aim:

Purfication of CFP protein, determination of mutation rates via phage display

Materials:
LB medium, tetracycline stock solution, chloramphenicol stock solution, ampicillin stock solution, overnight culture of CFP producing cells, overnight culture of E. coli infected with phages

Method:

Preparation of CFP main culture:

2x2ml of overnight culture was added to 2x 500ml LB medium with 500µl of ampicillin each

Preparation of main cultures for phage display:

1x 1ml of overnight culture of non-mutated cells were added to 100ml of LB medium with 100µl of tetracycline

1x 1ml of overnight culture of 1 x mutated cells were added to 100ml of LB medium with 100µl of tetracycline and 100µl of ampicillin

Further tasks:

Induction of CFP; new cycle of phage production

Induction of CFP

Investigators:Basia/Chris

Aim:

Purfication of CFP protein

Materials:
Main culture XL1 Blue with CFP, IPTG stock solution

Method:

250µl of 1M IPTG stock solution was added to each of 500ml of main cultures when OD600 reached 0,3-0,5

Further tasks:

protein purification

Preparation of the phages for phage display

Investigators: Basia/Chris

Time: 2012-09-12

Materials:

main culture of ER2738 with pBAD, pAK100 , helper phage, Kanamycin, PEG-NaCl solution, TBS buffer

Method:

1. addition of arabinose to the culture with pBAD with AID: 0,01% arabinose (when OD600 0,3-0,5)

3. addition of 30µl of helper phages (cleaned up on 6.9.2012) - when OD600 0,3-0,5

4. further amplification and clean up of phage according to the manual

Further tasks:

continuation on the next day

Inoculation of cells ER2738 with AID in pBAD and cells ER2738 without AID in pBAD

Investigators: Basia/Chris

Time: 2012-09-12 8:30pm

Materials:

LB medium, ampicillin stock solution, tetracyclin stock solution, competent ER2738 cells with AID in pBAD and competent ER2738 cells without AID in pBAD

Method:

100µl of competent ER2738 cells with or without AID in pBAD into 5ml of LB medium with antibiotics (ampicillin or tetracyclin)

Results:

cultures grew

Further tasks:

infection with phages and selection for mutated clones

send the DNA to sequencing

Investigators:

Tom S.

sample	GATC number	Seq. Primer
mod. AID+eGFP 4	II3676	pSB1C3 Forward
mod. AID+eGFP 4	II3677	pSB1C3 Reverse

Ligation of RFP in pSB1C3 and transformation

Investigators: Rico

Aim: Ligation of RFP in pSB1C3

Method: 1 µL RFP, 1 µL digested pSB1C3, 1 µL T4-Ligase, 1 µL T4-Ligation buffer, 6 µL water, transformation in Xl 1 E.coli (E.coli were spread without IPTG)

Further Tasks:

O/N culture of clones

2012-09-13

Preparation of phage - continuation

Investigators: Basia/Chris

Time: 2012-09-13

Materials:

LB medium, PEG-NaCl solution, TBS buffer

Method:

continuation of clean up phages for phage display according to the manual

Isolation of CFP from XL1-Blue

Investigators: Basia/Chris

Materials:

Method:

-resuspend pellet (in 20 mL 10mM Hepes 500mM NaCl Buffer pH 7.4)

-lysis by sonication: 3x2min, 6mm tip, 50% amplitude

-centrifugation´for 30 min, 19000 rpm 4°C

-sonication of supernatant for 1 min

-filtering with 0.45 mm filter

-loading extract on IMAC-column(Ni-NTA) (equilibrated with 30 column volumes of 10 mM HEPES buffer-pH 7.4; 500mM NaCL)

-loading protein extract with flow rate of 0.5 mL/min

-wash column with 30mM imidazole

-elution of protein with 50 mM imidazole in 10 mM HEPES bufer pH 7.4 (this was a mistake-200mM imidazole is the correct elution buffer, but it worked anyways)

-storage of eluted protein on ice in the fridge

checking the SDS-Gel & spectrum of CFP

Investigators: Basia/Chris

Results:

-spectra look like CFP spectra (max. absorbtion at 436 nm) max emission 474 & nm

-in the strong diluted elution fraction the visible lane is as large as CFP (~28 kDA)

-this lane is also strong in the washed fraction

2012-09-14

send the DNA to sequencing for mutation rate (48h)

Investigators:

Tom S.

sample	GATC number	Seq. Primer
EGFR-C 1	AKM001W075	pcDNA 3.1-FP
EGFR-C 2	AKM001W076	pcDNA 3.1-FP
EGFR-C 3	AKM001W077	pcDNA 3.1-FP
EGFR-C 4	AKM001W078	pcDNA 3.1-FP
EGFR-C 5	AKM001W079	pcDNA 3.1-FP
EGFR-C-WT AID 1	AKM001W080	pcDNA 3.1-FP
EGFR-C-WT AID 2	AKM001W081	pcDNA 3.1-FP
EGFR-C-WT AID 3	AKM001W082	pcDNA 3.1-FP
EGFR-C-WT AID 4	AKM001W083	pcDNA 3.1-FP
EGFR-C-WT AID 5	AKM001W084	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence 1	AKM001W085	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence 2	AKM001W086	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence 3	AKM001W087	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence 4	AKM001W088	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence 5	AKM001W089	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 1	AKM001W090	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 2	AKM001W091	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 3	AKM001W092	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 4	AKM001W093	pcDNA 3.1-FP
EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP 5	AKM001W094	pcDNA 3.1-FP

checking sequences after first round (1x mut) of phage display

Investigator: Chris

results: not a single mutation in one of the 5 "mutated sequences" or one of the 5 controls (without AID)

labeling GFP with Biotin (as a matter of fact GFP is fused with a helix-> CREBzipGFP)

Investigator: Basia/ Chris

Material: EZ-Link® Sulfo-NHS-LC-Biotin

Method:

-add 10 fold molar exess of biotin reagent to CREBzipGFP

-CREBzipGFP was thought to have an concentration of 1.3 mg/mL (MW=36.172 kDa), therefore 36 µL of 10 mM EZ-Link® Sulfo-NHS-LC-Biotin where added

-after biotinylation the concetration of CREBzipGFP-Biotin was shown to be 4.075 mg/mL -maybe to less Biotin reagent was used

-the concentration of remaining CREBzipGFP without Biotin was 0.3 mg/mL

Further tasks: testing the success of biotinylation with "ELISA"

inoculation of mixed plates ER2738-pAK100(not mutated) & ER2738-pAK100 with AID(2x mutated)

Investigator: Basia/ Chris

-addition of 1 mL LB medium on plates, mixing colonies with Drigalski spatulas

-addition of 20 µL of mixed cultures to 5 mL LB with Tet,CM (for ER2738+pAK100-not mutated) and to 5 mL LB with Tet,CM, Amp for ER2738+pAK100 with AID(2x mutated)

O/N cultures of RFP in pSB1C3 clones

Investigator: Rico

Aim: O/N culture of RFP in pSB1C3 clones, clones have to grow approximately 24 h at 37 °C and incubate O/N at 6-7 °C (after that you can see the red fluorescence under LED light)

Method: picking clones, 1:1000 dilution of IPTG stock solution (1 M)

Further Tasks: purification of plasmids

2012-09-15

Preparation of the phages for phage display

Investigators: Chris

Time: 2012-09-15

Materials:

over night cultures of ER2738 with pBAD and pAK(double mut) & ER2738 with pAK(not mut) , helper phage, Kanamycin, PEG-NaCl solution, TBS buffer

Method:

1. starting main culture of ER2738 with pBAD and pAK(double mut) & ER2738 with pAK(not mut)-addition of 2 mL over night culture to 100 mL LB(Tet,Cm for ER2738 with pAK /Tet,Cm, Amp for ER2738 with pBAD and pAK)

2. addition of arabinose to the culture with pBAD with AID: 0,02% arabinose (when OD600 0,3-0,5)

3. addition of 30µl of helper phages (cleaned up on 6.9.2012) - when OD600 0,3-0,5

4. further amplification and clean up of phage according to the manual

Further tasks:

continuation on the next day

overnight cultures of ER2738 and ER2738 with AID for phage display and AID-expression test

Investigator:Chris

Materials:

LB medium, ampicillin stock solution, tetracyclin stock solution, competent ER2738 cells with AID in pBAD and competent ER2738 cells without AID in pBAD

Method:

100µl of competent ER2738 cells with or without AID in pBAD into 5ml of LB medium with antibiotics (ampicillin & tetracyclin/ tetracyclin)

Results:

cultures grew

Elisa of biotinylated eGFP

Investigators: Chris

Materials:

CREBzipGFP-biotin (c=4.075 mg/mL), CREBzipGFP for control (c=0.3 mg/mL; ɛ280=22,015 M-1 cm-1; MW= 36,172 Da), block buffer (1% BSA in PBS), SAV-HPR-solution(SAV-HPR 1:5000 & 1&% BSA in PBS), substrate solution (20:78:1:1 5x --substrate Buffer: H20: Substrate->OPD: 1% H2O2), stop solution (1 M H2SO4,50mM Na2SO3 in water), platereader

Method:

CREBzipGFP-biotin (20 µg/mL,10 µg/mL,5 µg/mL, 1 µg/mL) CREBzipGFP-control (20 µg/mL,10 µg/mL,5 µg/mL, 1 µg/mL), PBS as blank: 50 µL/well

wait 2:30 h

washed 2 times w/tap water

block: 100 µL/well 1% BSA/PBS

washed 5 times w/tap water

50 µL/well SAV-HRP-solution, 1h

washed 10 times w/tap water

50 µL/well substrate solution - 5,5 min

50 µL/well stop solution,

measure OD 492

Results:

Further tasks:
couple CREBzipGFP-biotin with magnetic beads

Purification of RFP in pSB1C3 from O/N cultures

Investigator:Rico

Materials: Purification kit from Thermo Scientific

sample	concentration in ng/µL
RFP 1	136.9
RFP 2	113.8
RFP 3	106.2
RFP 4	99.8
RFP 5	108.8

Digestion of purified new standard cloning vector with Apa I and Sph I

Investigator:Rico

Method:

7 µL RFP 1, 1 µL Apa I, 1 µL Sph I, 3 µL buffer, 18 µL water, incubation @ 37 °C for 2 h

Transformation of purified AID plasmids in E.coli for determining the mutation rate

Investigator:Rico

Materials: Transformation protocol for E.coli

2012-09-16

Induction calibration of AID in pBAD vector

Investigators: Basia

Time: 2012-09-16

Materials:

LB medium, protein gel equipment, ampicillin stock solution, tetracycline stock solution, arabinose stock solution

Method:

1. Inoculation of 200µl of overnight culture (ER2738+AID in pBAD) into 20ml of LB medium with tet and amp.

2. addition of arabinose 0,01%, when OD600 0,3-0,5

3. Samples taken at T0, T3 and T5 (at time zero, after 3h and after 5h)

4. The OD600 was measured before taking the samples in order to adjust the protein amount

5. Cell suspension was centrifuged for 3min 16100 xg and pellet was resuspended in 100µl of lyase sample buffer 4x.

Preparation of phage - continuation

Investigators: Basia

Time: 2012-09-16

Materials:

LB medium, PEG-NaCl solution, TBS buffer

Method:

continuation of clean up phages for phage display

Infection with phages of the cells ER2738 with AID in pBAD and without AID in pBAD

Investigators: Basia

Time: 2012-09-16 2pm

Materials:

LB medium, tetracycline stock solution, chloramphenicol stock solution, ampicillin stock solution, overnight culture of ER2738 cells (once with once without AID in pBAD), phages cleaned up on 16.09.2012, arabinose stock solution

Method:

1. 2 Erlenmeyer flasks 100ml LB in each + 100µl of ampicillin + 100µl tetracycline stock solution (into the flask with AID in pBAD) or + 100µl of tetracycline stock solution (into flask without AID) - x2

2. 1 with no arabinose (into the flask without AID in pBAD), the other one with 0,02% arabinose (when OD600 0,3-0,5, into flask with AID)

3. addition of 280µl of phages (cleaned up on 10.9.2012) - when OD600 0,3-0,5

4. addition of chloramphenicol stock solution - 1h after infection with phages

5. further amplification of infected cells in 32°C

Further tasks:

Plating of the colonies onto the LB plates with appropriate antibiotics

Plating of the colonies onto the LB plates with appropriate antibiotics

Investigators: Basia

Time: 2012-09-10 7pm

Materials:

Plate with LB medium with tetracycline and chloramphenicol and plates with LB medium with ampicillin, tetracycline, 0,01% arabinose and chloramphenicol, cultures infected with phages

Method:

850µl of the cultures infected with phages (see 16.09.2012 - phage infection) were centrifuged and the supernatant was discarded. 20µl of the resuspended pellet were used for plating

each culture was plated on the plates with appropriate antibiotics (E. coli without AID -infected with non-mutated phages on Tet and Cm, E. coli with AID -infected with mutated phages on Cm, tet, ara and amp)

Further tasks:

preparation of mutated vectors for sequences

Inoculation of plasmid samples of the 48h retransformation plates

Investigators: Basia

Time: 2012-09-08 6pm

Materials:

• LB medium
  

• Cm 35 mg/ ml stock solution
  

• plate with cultures:
  

EGFR-C-WT AID

EGFR-C-AID without NES, with NLS+Kozak sequence

EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP

(all from 2012.09.15)

Method:

Inoculation of:

5 cultures per plate in 5 ml LB medium + 5µL Cm.

(--> 20 cultures)

Further tasks:

• Miniprep
  

2012-09-17

Miniprep of overnight cultures of 48h cultures for (AID) mutation rates

Investigators:

Tom, Rico

Aim:

Miniprep of overnight cultures of 48h cultures for (AID) mutation rates

Method:

Miniprep Thermo Scientific according to the manual

Results:

Concentrations

Sample	Concentration [ng/µL]
AID without NES, with NLS+Kozak sequence 1	371.2
AID without NES, with NLS+Kozak sequence 2	368.4
AID without NES, with NLS+Kozak sequence 3	340.8
AID without NES, with NLS+Kozak sequence 4	391.3
AID without NES, with NLS+Kozak sequence 5	373.9
AID without NES, with NLS+Kozak sequence+eGFP 1	393.0
AID without NES, with NLS+Kozak sequence+eGFP 2	413.1
AID without NES, with NLS+Kozak sequence+eGFP 3	379.7
AID without NES, with NLS+Kozak sequence+eGFP 4	376.5
AID without NES, with NLS+Kozak sequence+eGFP 5	389.3
WT (AID) 1	366.4
WT (AID) 2	389.9
WT (AID) 3	359.5
WT (AID) 4	367.3
WT (AID) 5	365.2

Further Tasks:

send to sequencing

send the DNA to sequencing

Investigators:

Tom S., Rico

sample	GATC number	Seq. Primer
AID without NES, with NLS+Kozak sequence 1	II3682	CMV Forward
AID without NES, with NLS+Kozak sequence 2	II3683	CMV Forward
AID without NES, with NLS+Kozak sequence 3	AI2677	CMV Forward
AID without NES, with NLS+Kozak sequence 4	AI2678	CMV Forward
AID without NES, with NLS+Kozak sequence 5	AI2679	CMV Forward
AID without NES, with NLS+Kozak sequence+eGFP 1	AI2680	CMV Forward
AID without NES, with NLS+Kozak sequence+eGFP 4	AI2681	CMV Forward
AID without NES, with NLS+Kozak sequence+eGFP 3	AI2682	CMV Forward
AID without NES, with NLS+Kozak sequence+eGFP 4	AI2683	CMV Forward
AID without NES, with NLS+Kozak sequence+eGFP 5	AI2684	CMV Forward
WT (AID) 1	AI2685	CMV Forward
WT (AID) 2	AI2686	CMV Forward
WT (AID) 3	AI2687	CMV Forward
WT (AID) 4	AI2688	CMV Forward
WT (AID) 5	AI2689	CMV Forward

Checking AID induction test with SDS-PAGE gel

Investigators: Basia, Chris

Results:

There is no overexpressed lane that differs in the induced samples. No AID expression or too less arabinose???

picking clones and overnight culture of the colonies grown on the plates from 16.9.2012

Investigators: Basia

Time: 2012-09-17 7 pm

Materials:

LB medium, ampicillin stock solution, chloramphenicol stock solution, tetracycline stock solution, plates with colonies from 16.9.2012

Method: inoculation of 5 clones from mutated clones in 5 ml LB medium + 5µl ampicillin, chloramphenicol & tetracycline:

inoculation of 5 clones from the non mutated plate in 5 ml LB medium + 5µl chloramphenicol & tetracycline:

inoculation of XL1-Blue with AID in pBAD in 5 ml LB medium + 5 µl ampicillin + 5µl tetracycline - for a new induction test

shaking over night at 37°C, 300 rpm, approx. 16 hours

Further tasks:

Miniprep, induction calibration

PLIcing of Thio-AID, Ligation with digested new RFC standard cloning vector 1

Investigators:

Rico

Aim:

Ligation of AID in new cloning vector 1

Method:

• 8 µL Thio-AID was treated with 1 µL Cleavage Buffer (0.5 Tris-HCl, pH 9.0), 0.4 µL Milli-Q water and 0.6 µL iodine stock solution (100 mM)

• incubate @ 70 °C for 5 min

• mixed with digested RFP standard cloning vector (purified, non purfied, with and without ligase) @ room temperature for 1 h

• transform into E.coli

2012-09-18

Induction calibration of AID in pBAD vector

Investigators: Basia/Chris

Time: 2012-09-18

Materials:

LB medium, protein gel equipment, ampicillin stock solution, tetracycline stock solution, arabinose stock solution

Method:

1. Inoculation of 200µl of overnight culture (ER2738+AID in pBAD) into 20ml of LB medium with tet and amp.

2. addition of arabinose 0,01%, when OD600 0,3-0,5

3. Samples taken at T0, T3 and T5 (at time zero, after 3h and after 5h)

4. The OD600 was measured before taking the samples in order to adjust the protein amount

5. Cell suspension was centrifuged for 3min 16100 xg and pellet was resuspended in 100µl of lyase sample buffer 4x.

Miniprep of overnight cultures

Investigators:

Chris/Basia

Aim:

Miniprep of overnight cultures

Method:

Miniprep Thermo Scientific according to the manual

Results:

Concentrations

Sample	Concentration [ng/µL]
mut 1	530
mut 2	595
mut 3	221,7
mut 4!	63.5
mut 5	360
mut 6	350
non mut 1	782,2
non mut 2	523,3
non mut 3	780
non mut 4	651
non mut 5	688

mut: cells that were always under arabinose and AID conditions

non mut: cells that are used as controls - never used arabinose and AID during cell culturing

send DNA from colonies after third round of phage display to sequencing

Investigators:

Basia/Chris

sample	GATC number	Seq. Primer
mut 1	AI2691	GATC_Std_RPC
mut 2	AI2692	GATC_Std_RPC
mut 3	AI2693	GATC_Std_RPC
mut 4!	AI2699	GATC_Std_RPC
mut 5	AI2700	GATC_Std_RPC
mut 6	AI2717	GATC_Std_RPC
non mut 1	AI2694	GATC_Std_RPC
non mut 2	AI2695	GATC_Std_RPC
non mut 3	AI2696	GATC_Std_RPC
non mut 4	AI2697	GATC_Std_RPC
non mut 5	AI2698	GATC_Std_RPC

O/N culture of transformed E.coli with AID in RFP new standard cloning vector

Investigators: Rico, Sascha

Time: 2012-09-18

Method:

picking of clones, which show no red fluorescence indicating that the ligation was successful

2012-09-19

Checking AID induction test with SDS-PAGE gel

Investigators: Basia, Chris

Results:

There is no overexpressed lane that differs in the induced samples. Maybe the AID is low expressed because of the way the construct is built - 11 bp between the start codon and RBS instead of 7? The arrow shows where more less should be a band of AID.

Miniprep of O/N cultures of RFP new standard cloning vector

Investigators: Rico, Sascha

Method: Miniprep kit from Thermo scientific

Results:

sample	concentration in ng/µL
unpurified, + Ligase	170.5
unpurified, - Ligase	174.8
purified, + Ligase	189.9
purified, - Ligase	179.1

Test digestion of purified AID in new standard cloning vector

Investigators: Rico, Sascha

Results:

• all variants show the expected sizes of the digested fragments
  
  

Sending AID variants in new cloning vector and RFP cloning vector for sequencing

Investigators: Rico

Transfection of CHO cells with scFv-YFP, Nanobody-mCHerry and modified AID-eGFP construct for FACS

Investigators: Rico

Method: 2 µg DNA was used for transfection in 6 well plates

2012-09-20

Fluorescence microscopy of transfected CHO cells for FACS

Investigators: Rico

Results:

Cells shows a much higher red fluorescence (transfected with Nanobody-mCherry construct) than exprected

2012-09-21

Control of the sequencing results after phage display

Investigators: Basia

Results:

not a single mutation was introduced into the sequence. We think it is due to lack of AID expression in the pBAD vector.

2012-09-22

Selection of the antibodies from the supernatant after the Cre recombinase treatment via magnetic beads binding

Investigators: Basia

Materials:

Dyna Magnetic Beads bound with Streptavidin, biotinylated eGFP, supernatant after the CHO cell culturing, PBS buffer

Method: According to the Dyna beads Trial Kit Manual: 800pmol of biotinylated eGFP was used, 1ml of supernatant was added to the eGFP coupled with magnetic beads through streptavidin and biotin and incubated for 1hour with delicate mixing at room temperature. The samples were then resuspended in 100µl of loading buffer and loaded on the SDS protein gel.

Results:

Checking sequencing results for new standard

Investigators: Rico

Results:

Antibody

2012-09-01

Glycerol stock and Mini Prep of Geneart construct, Venus, pAK100+scFv425 R H1, R H2, R L1, R L2, L1, L2

Investigator:Maria

Time: 2012-09-01 9:30 am

Materials: overnight cultures Geneart construct (4x), Venus (Tom), pAK100+scFv425 R H1, R H2, R L1, R L2, L1, L2 (Chris), Mini prep kit

Methods: according to manual

Results:

Venus: …. ng/µl

pAK100+scFv425 R H1: --- ng/µl

pAK100+scFv425 R H2: --- ng/µl<br<

pAK100+scFv425 R L1: --- ng/µl

pAK100+scFv425 R L2: --- ng/µl

pAK100+scFv425 L1: --- ng/µl

pAK100+scFv425 L2: --- ng/µl

Geneart construct 1: --- ng/µl

Geneart construct 2: --- ng/µl

Geneart construct 3: --- ng/µl

Geneart construct 4: --- ng/µl

+

Glycerole stocks of Geneart construct and pAK100+scFv425 R H1, R H2, R L1, R L2, L1, L2

Further tasks:

2012-09-03

cell culture;

Investigator:Kerstin/Stefan

Time: 2012-09-03 09:00 am

Topic: cell-culture

• seeding of zeocin selected CHO cells in 6-well + ibidi-dish for stable transfection and modified AID-GFP

• investigation of ordering phenolredfree medium

• searching fort he right version of imageJ

04.09.2012

2012-09-04

cell culture;

Investigator:Kerstin/Stefan

Time: 2012-09-04 09:00 am

Topic: cell-culture

• stable transfection of clon 4, according to stable transfection protocoll

• transfection of AID-GFP in 6-well plate

• virus infection of CHO cells in 6-well plates and ibidi dishes

• evaluation of cell culture images

dephosphorylating the vector pcDNA5FRT digested with NheI and ApaI

Investigator:Maria

Aim: dephosphorylating the digested pcDNA5-FRT to prevent re-ligation

Materials:

• Antarctic Phosphatase

• 10x Antarctic Phosphatase Reaction Buffer

• digested pcDNA5-FRT

Method:

• 3,3µl 10x Antarctic Phosphatase Reaction Buffer

• 1µl Antarctic Phosphatase

• incubation for 30min at 37°C to dephosphorylate 5´-ends of pcDNA5-FRT

• heat inactivation of Phosphatase for 5min at 65°C

• store at -20°C

Further Tasks:

• gelextraction

• ligation of pcDNA5-FRT dephosphorylated vector with geneart construct

PCR-Clean-Up of dephosphorylated vector

Investigator:Maria

Aim: cleaning of dephosphorylated vector

Materials:

• PCR-Clean-Up Kit

Method:

• according to manual

Results:

• concentration of cleaned dephosphorylated pcDNA5FRT = 60,4 ng/µl

colony-PCR of ligated pcDNA5-FRT_geneart-construct clones

Investigator: Maria

AIM: identifying correct ligated pcDNA5-FRT_geneart-constructs clones

Materials:

• Taq DNA-polymerase 1kb/1min

• 10x Taq DNA-polymerase buffer
  

• dNTPs (10mM)

• forward primer in C-terminus of CMV of pcDNA5-FRT-backbone: fp_qRT-CMV_rev

• reverse primer in C-terminus in mcherry: ps_mcherry_rev_BamHI * Thermocycler

Methods:

• 20µl colony-PCR mix for 20 clones:

Mastermix

reagent	volume [µL]
10x Standard Taq-DNA-Polymerase Buffer	40
dNTPs	8
Primer (Forward)	8
Primer (Reverse)	8
DNA	clone from plate
Taq Polymerase	2
water	334

Primer forward: fp_qRT-CMV_rev(10µM)

Primer reverse: ps_mcherry_rev_BamHI (10µM)

Program

step	Temperature [°C]	duration [s]	cycles
initial denaturation	95	300	1
denaturation	95	25	30
annealing	51	25	30
elongation	68	130	30
final elongation	86	300	1
cooling	8	∞	1

• clone-colonies were transferred to 20 µl colony-PCR mix, and onto LB-Amp plate, respectively
  

• LB-AMP-plate were incubated o.n. at 37°C
  

• negative control: clon #20 from religation-control (ligation-ratio 1:0) from 2012-09-03

further Taks:

• gelelectrophoresis

• picking positive clones for o.n.-culture

2012-09-05

cell culture;

Investigator:Kerstin/Stefan

Time: 2012-09-05 10:00 am

Topic: cell-culture

• change of medium of transfected (stable transfection clon 4 and AID-GFP ) cells (04.09.2012)

• passaging of CHO’s

• seeding of 2x 6-wells with each 2*10^5 cells/well

• seeding of one ibidi dish with 5*10^4 cells/well

• talking with Daniel to check the FACS options at the junior group of potsdam university

• investigation about Geniticin and possible resistance genes

analytical gelelectrophoresis of colony PCR with 20 clones of ligated pcDNA5-FRT-geneart construct

Investigator: Maria

Aim: analytical gelelectrophoresis to check successful ligation (geneart construct and pcDNA5-FRT vector)

Materials:

• agarose

• 1xTAE-buffer

• 10xFD FDGreen

Method:

• 3µl 10x FD Green, 15µl of each PCR product

• 1% agarose gel, 100ml

• 70 min at 120V

Results:

• no precise bands
  

Further Tasks:

• re-doing colony PCR

2012-09-06

cell culture;

Investigator:Kerstin/Stefan

Time: 2012-09-06 10:00 am

Topic: cell-culture

• stable transfected CHO’s (clone 4) were diluted from 6-well in 75cm^2 flasks

• capturing images of virus infected cells

• talking with Daniel concerning use of FACS

• planing of AK verification at the Cellmembrane ==> anti flag tag

colony-PCR of ligated pcDNA5-FRT_geneart-construct clones from 05.09.12

Investigator: Maria

AIM: identifying correct ligated pcDNA5-FRT_geneart-constructs clones

Materials:

• 20µl colony-PCR mix for 32 clones:

• Taq DNA-polymerase 1kb/1min

• 10x Taq DNA-polymerase buffer
  

• dNTPs (10mM)

• forward primer in C-terminus of CMV of pcDNA5-FRT-backbone: fp_qRT-CMV_rev (Tm=55°C)

• reverse primer in C-terminus in mcherry: ps_mcherry_rev_BamHI (Tm= 59,31°C)

• Thermocycler

Methods:

Mastermix

reagent	volume [µL]
10x Standard Taq-DNA-Polymerase Buffer	64
dNTPs	12,8
Primer (Forward)	12,8
Primer (Reverse)	12,8
DNA	clone from plate
Taq Polymerase	3,2
water	534,4

Program

step	Temperature [°C]	duration [s]	cycles
initial denaturation	95	300	1
denaturation	95	25	30
annealing	51	25	30
elongation	68	130	30
final elongation	86	300	1
cooling	8	∞	1

• clone-colonies were transferred to 20µl colony-PCR mix, and onto LB-Amp plate, respectively
  

• LB-AMP-plate were incubated o.n. at 37°C
  

• negative control: clone #1 from religation-control (ligation-ratio 1:0) from 2012-09-05, clone 2 from transformation control of new competent E.coli Xl 1 blue with pcDNA5FRT

further Taks:

• gelelectrophoresis

• picking positive clones for o.n. culture

• o.n. culture of positive clones

• test digestion

• o.n. culture for endotoxin free preparation

analytical gelelectrophoresis of colony PCR with 32 clones of ligated pcDNA5-FRT-geneart construct, circular vector and religated vector

Investigator: Maria

Aim: analytical gelelectrophoresis to check successful ligation (geneart construct and pcDNA5-FRT vector)

Materials:

• agarose

• 1xTAE-buffer

• 10xFD FDGreen

Method:

• 3µl 10x FD Green, 15µl of each PCR product

• 1% agarose gel, 100ml

• 120V

Results:

• no precise bands
  

Further Tasks:

• picking promising clones

• o.n. culture of promising clones

Transformation of pcDNA5FRT into new XL1-blue competent E. coli cells

Investigators: Maria

Materials:

• Bunsen Burner, Agar Plate with Ampicillin, 37 °C thermo mixer, centrifuge,
  

• pcDNA5FRT

• icebox

• new competent E. coli cells (XL 1)

Method:

• according to manual

• 20µl of resuspended cell-suspension were plated on a LB-Amp-plate

• incubation o.n. at 37°C

Further Tasks:

• picking clones

2012-09-07

cell culture;

Investigator:Kerstin/Stefan

Time: 2012-09-07 10:00 am

Topic: cell-culture

• passaging of CHO cells w/ zeocin and w/o zeocin

• capturing images of AID-GFP

picking promising clones of ligated pcDNA5-FRT-geneart construct and of new competent cells with pcDNA5FRT, inoculation of o.n.-culture

Investigators: Maria

Materials:

• 11x 15 ml inoculation tubes

• LB-Medium

• Ampicilin

• bunsen burner

Method:

• 10x o.n.-culture of promising pcDNA5-FRT-geneart construct clones

• 1x o.n.-culture of control for new competent cells

• each o.n.-culture 5ml LB-Medium + 5µl Ampicillin

• incubation o.n. at 37°C

further Tasks:

• miniprep of o.n.-cultures

2012-09-08

Glycerol stock and Mini Prep of promising pcDNA5-FRT-geneart construct clones and new competent cells with pcDNA5FRT

Investigator: Maria

Materials: overnight cultures pcDNA5-FRT-geneart construct clones, control of new competent cells with pcDNA5FRT, Mini prep kit

Methods: according to manual

Results:

Clon 4: 589,7 ng/µl

Clon 5: 628 ng/µl<br<

Clon 7: 568,7 ng/µl

Clon 10: 613,4 ng/µl

Clon 11: 573,1 ng/µl

Clon 12: 682,7 ng/µl

Clon 14: 648,1 ng/µl

Clon 16: 615,8 ng/µl

Clon 22: 653,4 ng/µl

Clon 27: 602,5 ng/µl

Clon 29: 613,9 ng/µl

Controle pcDNA5FRT: 205,3 ng/µl

Glycerole stocks of pcDNA5-FRT-geneart construct clones

Further tasks: analytical digestion, analytical gelelectrophoresis, stable transfection of CHO cells

analytical digestion of ligated pcDNA5-FRT-geneart construct and pcDNA5FRT control

Investigator: Maria

Materials:

• all 10 prepared pcDNA5-FRT-geneart construct clones

• pcDNA5FRT vector control for new competent cells

• FastDigest ScaI and ApaI

• 10x FD Green Buffer

• sterile water

Method:

• 10µl mix: 1µl ScaI for ligated construct, 1µl ApaI for vector, 1µl 10x FD Green Buffer, 1µl of each clone (approximately 200ng DNA), sterile water add to 10µl

• incubation at 37°C for 30 min

Further tasks:

• analytical gelelectrophoresis

Topic: gelelectrophoresis of analytical digested pcDNA5-FRT-geneart construct and pcDNA5FRT control

Investigator: Maria

Aim: checking plasmid-size after ligation of pcDNA5-FRT-geneart construct and pcDNA5FRT control in 1% agarosegel

Materials:

• agarose

• 1xTAE-buffer

• 10xFD Green Buffer

Method:

• 1% agarosegel, 100ml

• 120 V

Results:

• ligation successfully
  

Further Tasks:

• o.n. (50 µl) of positive clones 5, 14, 16 and 29 for endotoxin free prep

2012-09-09

Endotoxin free preparation of clones 5, 14,16 and 29

Investigator:Maria

Materials: endotoxin free Mediprep kit, overnight culture CMV-Venus

Methods: according to manual

Results: <b/>

clone 5: 6909,5 ng/µl

clone 14: 6243,6 ng/µl

clone 16: 3837,3 ng/µl

clone 29: 2454,8 ng/µl

Further tasks: transient and stable transfection of CHO cells

picking clones of scFv only and scFv construct ligated into pSB1C3 for overnight culture (vector and construct digested with AgeI and NgoMVI)

Investigator: Maria

Materials:

• 15 ml inoculation tubes

• LB-Medium

• Chloramphenicol

• bunsen burner

Method:

• 8x o.n.-culture of scFv only

• 8x o.n.-culture of scFv construct

• each o.n.-culture 5ml LB-Medium + 5µl Cm

• incubation o.n. at 37°C

further Tasks:

• miniprep of o.n.-cultures

cell culture

Investigator:Kerstin

Topic: cell-culture

• seeding CHO cells in 6-well plate for stable transfection

2012-09-10

Mini Prep of pcDNA5-FRT-scFv only and -scFv construct clones

Investigator:Maria

Materials: overnight cultures pcDNA5-FRT-scFv only /-scFv construct clones, Mini prep kit

Methods: according to manual

Results:

scFv only

Clon I 1: 54,2 ng/µl

Clon I 2: 70,1 ng/µl<br<

Clon I 3: 60,6 ng/µl

Clon I 4: 168,3 ng/µl

Clon II 1: 138,6 ng/µl

Clon II 2: 160,2 ng/µl

Clon II 3: 149,8 ng/µl

Clon II 4: 138,8 ng/µl

Clon III 1: 160,5 ng/µl

Clon III 2: 170,5 ng/µl

Clon III 3: 127,9 ng/µl

Clon III 4: 170,9 ng/µl

Clon VI 1: 155,4 ng/µl

Clon VI 2: 116 ng/µl

Clon VI 3: 128,1 ng/µl

Clon VI 4: 96,4 ng/µl

Further tasks: analytical digestion, analytical gelelectrophoresis

analytical digestion of ligated pcDNA5-FRT-scFv only and scFv construct

Investigators:Maria

Materials:

• all 16 prepared pcDNA5-FRT-scFv only and –scFv construct clones

• FastDigest ScaI and AcuI

• 10x FD Green Buffer

• sterile water

Method:

• 10µl mix: 1µl AcuI, 1µl 10x FD Green Buffer, 2µl or 1µl of each clone respectively (approximately 150 ng DNA), sterile water add to 10µl

• incubation at 37°C for 30 min

further tasks:

• analytical gelelectrophoresis

Topic: gelelectrophoresis of analytical digested pcDNA5-FRT-scFv only and –scFv construct

Investigators:Maria

Aim: checking plasmid-size after ligation of pcDNA5-FRT-scFv only and -scFv construct in 1% agarosegel

Materials:

• agarose

• 1xTAE-buffer

• 10xFD Green Buffer

Method:

• 1% agarosegel, 100ml

• 120 V

Results:

• ligation not successful
  

Further Tasks:

• Redoing ligation

Topic: taking cre recombinase (pBS185 CMV-Cre) into culture

Investigators:Maria

Aim: taking cre recombinase into culture

Materials:

• cre recombinase (addgene: pBS185)

• Agar plate with ampecillin

Method:

• streaking cre recombinase onto agar ampicillin plate

Results:

• cre recombinase clones for o.n. culture
  

Further Tasks:

• o.n. culture of cre recombinase

cell culture

Investigator:Kerstin

Topic: cell-culture

• stable transfection of CHO cells with Nanobody construct (Clone 29) in CHO cells
• passaging of CHO cells w/ zeocin and w/o zeocin
• taking HT1080 cells into culture

2012-09-11

assembly PCR of mutated scFv without PstI -TEV-TMD-EYFP construct

Investigator: Maria

AIM: assembly of scFV-TEV-TMD-EGFP without PstI restriction sites

Materials:

• Template mutated scFv and TEV-TMD-EGFP

• Phusion-polymerase

• 10x Phusion buffer GC
  

• dNTPs (10mM)

• forward primer: small-1-fw-prefix25 (Tm=72°C)

• reverse primer: small-6-rw-suffix-25 (Tm= 72°C)

• DSMSO

• Thermocycler

Methods:

Mastermix for triplex batch

reagent	volume [µL]
10x Phusion GC buffer	30
dNTPs	3
Primer (Forward)	7,5
Primer (Reverse)	7,5
template 1	3
template 2	3
DMSO	4,5
Phusion Polymerase	1,5
water	87

Program

step	Temperature [°C]	duration [s]	cycles
initial denaturation	98	30	1
denaturation	98	8	5
annealing	71	10	5
annealing + elongation	72	30	5
denaturation	98	8	25
annealing	72	35	25
final elongation	72	600	1
cooling	8	∞	1

Further Taks:

• analytical gelelectrophoresis

Topic: analytical gelelectrophoresis of PCR assembly product scFv-TEV-TMD-EGFP

Investigator: Maria

Aim: checking assembled scFv-TEV-TMD-EGFP PCR result in 1% agarose gel

Materials:

• agarose

• 1xTAE-buffer

• 10xFD Green Buffer

Method:

• 1% agarosegel, 100ml

• 120 V

Results:

• assembly PCR successfully
  

Further Tasks:

• preparative digestion with AgeI and XbaI

• preparative gelelectrophoresis

• gel extraction

assembly PCR of mutated scFv without PstI and TEV-TMD-EYFP construct

Investigator: Maria

AIM: assembly of scFV-TEV-TMD-EGFP without PstI restriction sites in 4 batches

Materials:

• Template mutated scFv and TEV-TMD-EGFP

• Phusion-polymerase

• 10x Phusion buffer GC and 10x Phusion HD buffer
  

• dNTPs (10mM)

• forward primer: small-1-fw-prefix25 (Tm=72°C)

• reverse primer: small-6-rw-suffix-25 (Tm= 72°C)

• DSMSO

• Thermocycler

Methods:

Mastermix 1, 2x

reagent	volume [µL]
10x Phusion GC buffer	20
dNTPs	2
Primer (Forward)	5
Primer (Reverse)	5
template 1	2
template 2	2
DMSO	-
Phusion Polymerase	1
water	63

Mastermix 2, 2x

reagent	volume [µL]
10x Phusion GC buffer	20
dNTPs	2
Primer (Forward)	5
Primer (Reverse)	5
template 1	2
template 2	2
DMSO	3
Phusion Polymerase	1
water	60

Mastermix 3, 2x

reagent	volume [µL]
10x Phusion HC buffer	20
dNTPs	2
Primer (Forward)	5
Primer (Reverse)	5
template 1	2
template 2	2
DMSO	-
Phusion Polymerase	1
water	63

Mastermix 4, 2x

reagent	volume [µL]
10x Phusion HC buffer	20
dNTPs	2
Primer (Forward)	5
Primer (Reverse)	5
template 1	2
template 2	2
DMSO	3
Phusion Polymerase	1
water	60

Program

step	Temperature [°C]	duration [s]	cycles
initial denaturation	98	30	1
denaturation	98	8	5
annealing	71	10	5
annealing + elongation	72	30	5
denaturation	98	8	25
annealing	72	35	25
final elongation	72	600	1
cooling	8	∞	1

Further Taks:

• analytical gelelectrophoresis

taking cre recombinase (pBS185 CMV-Cre) into culture for single clone picking

Investigators:Maria

Aim: taking cre recombinase into culture

Materials:

• cre recombinase (addgene: pBS185)

• Agar plate with ampicillin

Method:

• streaking cre recombinase onto agar ampicillin plate, single colonies wanted

Results:

• cre recombinase clones for o.n. culture
  

Further Tasks:

• o.n. culture of cre recombinase

Transformation of eGFP ( BBa_404316) into XL1-blue competent E. coli cells

Investigators: Maria

Materials:

• Bunsen Burner, Agar Plate with Ampicillin, 37 °C thermo mixer, centrifuge,
  

• BBa_404316

• icebox

• new competent E. coli cells (XL 1)

Method:

• according to manual

• 20µl of re-suspended cell-suspension were plated on a LB-Amp-plate

• incubation o.n. at 37°C

Further Tasks:

• picking clones

2012-09-12

preparative digestion of scFV construct with AgeI and XbaI

Investigator: Maria

Aim: digestion of scFv construct with AgeI and XbaI to generate sticky ends for ligation into pSB1C3

Materials:

• Fast Digest AgeI

• Fast Digest XbaI

• 10x FD Green Buffer

• scFv construct

• sterile water

Method:

2x

• 20µl scFv construct

• 2µl NheI

• 2µl ApaI

• 3µl 10x FD Green Buffer

• 5µl sterile water

• digestion for 2,5h at 37°C

Further Tasks:

• gelelectrophoresis

• gelextraction

preparative gelelectrophoresis of digested scFv-TEV-TMD-EYFP

Investigator: Maria

Aim: preparative gelelectrophoresis to separate digested scFv-TEV-TMD-EYFP construct from cutted overhangs in 1% agarosegel

Materials:

• agarose

• 1xTAE-buffer

• digested DNA

Method:

• 2x 30µl digested scFv construct

• 1% agarose gel, 100ml

• 100V

Results:

• digested scFv construct

Further Tasks:

• gelextraction

• ligation

gelextracton of digested scFv-TEV-TMD-EYFP construct out of 1% agarosegel

Investigators:Maria

Aim: gelextraction and preparation of cleaned scFv-TEV-TMD-EYFP construct

Materials:

• Gel-Clean-Up Kit

Method:

• according to manual

Results:

• 8,3 ng/µl

Further tasks:

• ligation into pSB1C3

analytical gelelectrophoresis of scFv-construct with modified PCR mix

Investigator: Maria

Aim: analytical gelelectrophoresis to check PCr result

Materials:

• agarose

• 1xTAE-buffer

• 10xFD FDGreen

Method:

• 3µl 10x FD Green, 15µl of each PCR product

• 1% agarose gel, 100ml

• 120V

Results:

• no precise bands
  

assembly PCR of mutated scFv without PstI out of part 1 (primer 1 and 2) and part 2 (primer 3 and 4) and mutated scF without PstI (primer 1 and 4)

Investigator: Maria

AIM: assembly of scFV without PstI restriction sites out of part 1 and 2 + multiplication of mutated scFv construct without PstI sites

Materials:

• Template mutated scFv part 1 and 2, mutated scFv construct

• Phusion-polymerase

• 10x Phusion buffer GC
  

• dNTPs (10mM)

• forward primer: small-I-fw-prefix25 (Tm=72°C)

• reverse primer: small-6-rw-suffix-25 (Tm= 72°C)

• DSMSO

• Thermocycler

Methods:

Mastermix for multiplication of mutated scFv

reagent	volume [µL]
10x Phusion GC buffer	10
dNTPs	1
Primer (Forward)	2,5
Primer (Reverse)	2,5
template 1	1
Phusion Polymerase	0,5
water	32,5

Mastermix for triplex batch assembly part 1 and 2

reagent	volume [µL]
10x Phusion GC buffer	30
dNTPs	3
Primer (Forward)	7,5
Primer (Reverse)	7,5
template 1	1,75 (5,7 ng/µl)
template 2	1,36 (3,4 ng/µl)
DMSO	4,5
Phusion Polymerase	1,5
water	86,67

Program

step	Temperature [°C]	duration [s]	cycles
initial denaturation	98	30	1
denaturation	98	8	5
annealing	71	10	5
annealing + elongation	72	30	5
denaturation	98	8	25
annealing	72	35	25
final elongation	72	600	1
cooling	8	∞	1

Further tasks:

• analytical gelelectrophoresis

picking clones of cre recombinase and BBa_404316, inoculation of o.n.-culture

Investigator: Maria

Materials:

• 15 ml inoculation tubes

• LB-Medium

• Ampicillin

• bunsen burner

Method:

• 1x o.n.-culture of cre recombinase

• 1x o.n.-culture of BBa-404316

• each o.n.-culture 5ml LB-Medium + 5µl Ampicillin

• incubation o.n. at 37°C

Further tasks:

• miniprep of o.n.-cultures

cell culture

Investigator:Kerstin

Topic: cell-culture

• passaging of CHO cells w/ zeocin and w/o zeocin
• seeding CHO cells in Ibidi Dish for transfection and Virus infection experiment
• dilution of stably transfected CHO Clone 29 into 75cm² flasks (+550µg/ml Hygromycin)(according to protocol)
• co-transfection of Nanobody construct clone 29 and modified AID with eGFP (according to protocol)

2012-09-13

Glycerol stock and Mini Prep of cre recombinase, BBa_404316 and YFP

Investigator: Maria

Materials: overnight cultures, Mini prep kit

Methods: according to manual

Results:

Cre recombinase : 192,8 ng/µl

BBa_404316: 242,5 ng/µl<br<

YFP: 130,6 ng/µl

Glycerol stocks of cre recombinase and BBa_404316

Further tasks: preparative digestion of BBa_404316 and 50ml culture of cre recombinase for endotoxin free preparation

analytical gelelectrophoresis of assembly PCR result scFv only (primer 7 and 8)

Investigator: Maria

Aim: analytical gelelectrophoresis to check PCR result

Materials:

• agarose

• 1xTAE-buffer

• 10xFD FDGreen

Method:

• 1µl 10x FD Green, 1µl of each PCR product, add sterile water to 10 µl

• 1% agarose gel, 100ml

• 120V

Results:

• precise bands
  

Further Tasks:

• preparative gelelectrophoresis

preparative gelelectrophoresis of PCR result for scFV only (primer 7 and 8)

Investigator: Maria

Aim: preparative gelelectrophoresis of assembled scFv only in 1% agarose gel

Materials:

• agarose

• 1xTAE-buffer

• digested DNA

Method:

• 2x 30µl of scFv only

• 1% agarose gel, 100ml

• 100V

Further Tasks:

• gelextraction

• ligation

gelextracton of PCR product scFv only out of 1% agarosegel

Investigator: Maria

Aim: gelextraction and preparation of cleaned scFv only construct

Materials:

• Gel-Clean-Up Kit

Method:

• according to manual

Results:

• 1: 86,1 ng/µl

• 2: 108,2 ng/µl

Further Tasks:

• digestion with AgeI and XbaI

• ligation into pSB1C3

preparative digestion of scFV only and BBa_404316 with AgeI and XbaI

Investigator: Maria

Aim: digestion of scFv only and BBa_404316 (pSB1C3 with RCF25 standard) with AgeI and XbaI

Materials:

• Fast Digest AgeI

• Fast Digest XbaI

• 10x FD Green Buffer

• scFv only

• BBa_404316

• steril water

Method:

2x

• 8,25µl BBa_404316

• 1µl AgeI

• 1µl XbaI

• 3µl 10x FD Green Buffer

• 16,75 µl sterile water

1x

• 13,8µl scFv only

• 1µl AgeI

• 1µl XbaI

• 3µl 10x FD Green Buffer

• 11,2µl sterile water

• digestion for 2,5h at 37°C

• heat inactivation at 65°C for 5 min

Further Tasks:

• PCR clean-up of digested scFV only

• dephosphorylation of pSB1C3

• gelelectrophoresis

• gelextraction

PCR-Clean-Up of digested scFv only construct

Investigator:Maria

Aim: purifying scFv only construct

Materials:

• PCR-Clean-Up Kit

Method:

• according to manual

Results:

• concentration of digested scFv only 66,8 ng/µl

dephosphorylating the digested pSB1C3 vector

Investigator:Maria

Aim:dephosphorylating the digested pSB1C3 vector to prevent re-ligation

Materials:

• Antarctic Phosphatase

• 10x Antarctic Phosphatase Reaction Buffer

• digested pSB1C3

Method:

• 3,3µl 10x Antarctic Phosphatase Reaction Buffer

• 1µl Antarctic Phosphatase

• incubation for 30min at 37°C to dephosphorylate 5´-ends of pSB1C3

• heat inactivation of Phosphatase for 5min at 65°C

• store at -20°C

Further Tasks:

• preparative gelelectrophoresis

• gelextraction

preparative gelelectrophoresis of digested and dephosphorylated pSB1C3

Investigators:Maria

Aim: preparative gelelectrophoresis of digested and dephosphorylated pSB1C3 in 1% agarosegel

Materials:

• agarose

• 1xTAE-buffer

• digested DNA

Method:

• 2x 30µl digested pSB1C3

• 1% agarose gel, 100ml

• 100V

Results:

• cleaned and digested pSB1C3 and scFv only construct

Further Tasks:

• gelextraction

• ligation

gelextracton of digested and dephosphorylated pSB1C3 out of 1% agarose gel

Investigator: Maria

Aim: gelextraction and preparation of digested and dephosphorylated pSB1C3

Materials:

• Gel-Clean-Up Kit

Method:

• according to manual

Results:

• I: 49,7 ng/µl, II: 53,3ng/µl

Further Tasks:

• ligation with scFv only and scFv construct

ligation of digested scFv-only and scFV construct and dephosporylated pSB1C3

Investigator: Maria

Aim: ligation of digested scFv-only and scFv construct with pSB1C3

Materials:

• ligation calculator: http://www.insilico.uni-duesseldorf.de/Lig_Input.html

• T4 DNA ligae

• ligase buffer

• digested scFv-only and scFv construct

• digested and dephosporylated pSB1C3

Method: ligation-ratio--> 1:3

I scFv only:

• 1µl T4 DNA ligase

• 2,5µl T4 DNA-ligase buffer

• 1,24µl digested scFv only (22,26ng/µl)

• 1µl digested pSB1C3 (26,65ng/µl)

• 14,26µl sterile water

II scFv construct:

• 1µl T4 DNA ligase

• 2,5µl T4 DNA-ligase buffer

• 4,81µl digested scFv construct (13,1ng/µl)

• 1µl digested pSB1C3 (26,65ng/µl)

• 10,69µl sterile water

• incubation for 1h at RT

Further Tasks:

• transformation of ligation mix into XL1-blue competent E. coli cells

Transformation of ligated pSB1C3-scFv-only and pSB1C3-scFv-construct into new XL1-blue competent E. coli cells

Investigator: Maria

Materials:

• Bunsen Burner, Agar Plate with Ampicillin, 37 °C thermo mixer, centrifuge,
  

• 10 µl of pSB1C3-scFv-only and pSB1C3-scFv-construct

• icebox

• new competent E. coli cells (XL 1)

Method:

• according to manual

• 20µl of resuspended cell-suspension were plated on a LB-Cm-plate

• incubation o.n. at 37°C

Further Tasks:

• picking clones

2012-09-14

Transformation of ligated pSB1C3-scFv-only and pSB1C3-scFv-construct into new XL1-blue competent E. coli cells

Investigator: Maria

Materials:

• Bunsen Burner, Agar Plate with Ampicillin, 37 °C thermo mixer, centrifuge,
  

• 10 µl of pSB1C3-scFv-only and pSB1C3-scFv-construct

• icebox

• new competent E. coli cells (XL 1)

Method:

• according to manual

• 20µl of resuspended cell-suspension were plated on a LB-CM-plate

• incubation o.n. at 37°C

Further Tasks:

• picking clones

2012-09-15

picking clones of ligated scFv-only-pSB1C3 and scFv-construct-pSB13C

Investigator: Kathi

Materials:

• 11x 15 ml inoculation tubes

• LB-Medium

• Chloramphenicol

• bunsen burner

Method:

• 5x o.n.-culture of scFv-only-pSB1C3

• 5x o.n.-culture of scFv-construct-pSB1C3

• each o.n.-culture 5ml LB-Medium + 5µl Chloramphenicol

• incubation o.n. at 37°C

Further Tasks:

• miniprep of o.n.-cultures

2012-09-16

Glycerol stock and Mini Prep of scFv-only-pSB1C3 and scFv-construct-pSB1C3 clones

Investigator: Maria

Materials: overnight cultures scFv-only-pSB1C3 and scFv-construct-pSB1C3 clones, Mini prep kit

Methods: according to manual

Results:

• scFv-only-pSB1C3

Clon 1: 288,3ng/µl

Clon 2: 309,8ng/µl<br<

Clon 3: 408,2ng/µl

Clon 4: 100,7ng/µl

Clon 5: 363,8ng/µl

• scFv-construct-pSB1C3

Clon 1: 398,8ng/µl

Clon 2: 439,3ng/µl

Clon 3: 337,4ng/µl

Clon 4: 80ng/µl

Clon 5: 125,9ng/µl

Glycerole stocks of all clones

Further Tasks: analytical digestion, analytical gelelectrophoresis

analytical digestion of ligated scFv-only-pSB1C3 and scFv-construct-pSB1C3 with PstI and XbaI

Investigator: Maria

Materials:

• all 10 prepared scFv-only-pSB1C3 and scFv-construct-pSB1C3 clones

• pSB1C3 vector control

• FastDigest PstI and XbaI

• 10x FD Green Buffer

• sterile water

Method:

• 10µl mix: 1µl PstI, 1µl 10x FD Green Buffer, 1µl of each clone (1:2, approximately 200ng DNA), 7µl sterile water

• 11µl mix: 1µl XbaI, 1µl 10x FD Green Buffer, 1µl of each clone (1:2, approximately 200ng DNA), 7µl sterile water

• incubation at 37°C for 45 min

Further Tasks:

• analytical gelelectrophoresis

Topic: gelelectrophoresis of analytical digested scFv-only-pSB1C3 and scFv-construct-pSB1C3 clones

Investigator: Maria

Aim: checking plasmid-size after ligation in 1% agarose gel

Materials:

• agarose

• 1xTAE-buffer

• 10xFD Green Buffer

Method:

• 1% agarose gel, 100ml

• 120 V

Results:

• ligation partly successful
  

Further Tasks:

• preparation for sequencing

2012-09-22

Biobrick glycerol stock, inoculation of o.n.-culture

Investigators: Maria

Materials:

• 12x 15 ml inoculation tubes

• LB-Medium

• Chloramphenicol

• bunsen burner

Method:

• 12x glycerol stock of Biobrick gene1,4,5,6 scFv only, scFv construct

• each o.n.-culture 5ml LB-Medium + 5µl Chloramphenicol

• incubation o.n. at 37°C

further Tasks:

• miniprep of o.n.-cultures

Transformation of Biobrick gene 2 and 3 into new XL1-blue competent E. coli cells

Investigators: Maria

Materials:

• Bunsen Burner, Agar Plate with Chloramphenicol, 37 °C thermo mixer, centrifuge,
  

• Biobrick gene 2 and 3

• icebox

• new competent E. coli cells (XL 1)

Method:

• according to manual

• 20µl of resuspended cell-suspension were plated on a LB-CM-plate

• incubation o.n. at 37°C

Further Tasks:

• picking clones for inoculation of o.n culture

2012-09-23

Mini Prep of Biobrick gene 1, 4, 5, 6, scFv only, scFv construct

Investigator:Maria

Materials: overnight cultures Biobrick gene 1, 4, 5, 6, scFv only, scFv construct, Mini prep kit

Methods: according to manual

Results:

scFv only

Gene 1 a: 355,1 ng/µl

Gene 1 b: 351,9 ng/µl<br<

Gene 4 a: 313,9 ng/µl

Gene 4 b: 340,5 ng/µl<br<

Gene 5 a: 346,5 ng/µl

Gene 5 b: 354,8 ng/µl<br<

Gene 6 a: 426,1 ng/µl

Gene 6 b: 478,0 ng/µl<br<

Gene scFv only a: 360,5 ng/µl

Gene scFv only b: 303,4 ng/µl<br<

Gene scFv construct a: 435,3 ng/µl

Gene scFv construct b: 250,6 ng/µl<br<

Virus

2012-09-02

Topic: preparing viral stocks

Investigator: Kathi

Aim: preparation of the primary virus stock

Materials:

• cell-culture --> HEK AAV 293 transfected cells on 29.08.2012 (with following plasmids: p01, p06, phelper, psb1c3)

• 80 °C freezer

• 37 °C water bath
  

Method:

• transfer transfected cells (incl. DMEM) to a falcon tube

• 4 times: 10 min freeze the falcon tube (-80 °C) and 15 min unfreezing (37 °C water bath)

• centrifugation (10 min, 10000 g, RT)

• supernatant = virus stock

• sore at -80 °C
  

Results:

• virus stock → with YFP on the surface and GOI = CFP
  

Further tasks

• infection

2012-09-03

Topic: picking clones of p10_Psb1c3_CMV_kozak_sortase_myc and p10_Psb1c3_CMV_kozak_sortase

Investigator: Xenia

Materials:

• LB medium

• ampicillin-stock solution (100 mg/mL)

• plates with E. coli XL1 blue with plasmids: p10_psb1c3_cmv_kozak_sortase_myc and p10_psb1c3_cmv_kozak_sortase
  

Method:

• picking clones with p10_psb1c3_cmv_kozak_sortase_myc and p10_psb1c3_cmv_kozak_sortase

• over night cultur (50 mL LB medium; 37 °C; 300 rpm; 17 hours)
  

Further tasks:

• endotoxin free midiprep

Topic: transfection

Investigators: Kerstin and Stefan

Aim:

• The plasmids were transfected in HEK-cells with the following plasmids:

• • pSB1C: GOI = CFP (1875 ng)

• • phelper (1875 ng)

• • P01: YFP linked on VP1 (1875 ng)

• • p06: VP1 knock out (1875 ng)
    

Materials:

• Medium: opti Mem

• transfection reagent: PEI

• 15 µg DNA per each transfection

Methods:

• transfection preparation

• • 1875 ng per plasmid; add 200 µL opti MEM per each transfection

• • 4.8 * DNA --> 72 µL PEI add 200 µL per each transfection

• three times 10 s mixing

• 2 min incubation at RT

• centrifagation

• add the PEI approach to the DNA approach

• mixing

• 15 min incubation at RT

• add the transfection approach to the HEK AAV 293 cells

Further tasks

• change medium (DMEM) after 16 hours

• after three days virus maturation, preparation of the primary virus stocks

2012-09-04

Topic: exchange medium

Investigator: Kathi

Materials:

• DMEM

• PBS

Methods:

• asprirate the old medium

• wash with PBS

• add new DMEM on the cells

Further tasks:

• virus preparation on 06.09.2012 (three days virus maturation)

Topic: preparation of the plasmids

Investigators: Kathi

Aim: endotoxin free preparation of p10_psb1c3_cmv_kozak_sortase_myc and p10_psb1c3_cmv_kozak_sortase

Materials and Methods:

• endotoxinfree preparation using the Plasmid plus medi kit (QIAGEN)

• • the endotoxic free preparations was tested by disgestion and agarose gel electrophoresis

• • • digestion: 5 µL DNA + 2 µL FD green buffer + 1 µL of each enzym (XbaI and PstI) and 23 µL water (37 °C and 60 min)

• • • gel electrophoresis: 1% agarose gel, 100 V, 60 min

Results:

• concentration:

• • p10_PsB1c_CMV_kozak_sortase_myc: c= 314,6 ng/µL v=~100 µL

• • p10_PsB1c_CMV_kozak_sortase: c= 334,2 ng/µL v=~100 µL

• gel electrophoresis

• the plasmid is wrong – wrong sizes of the plasmids fragments

further tasks

• new preparation of the plasmids

Topic: Infection

Investigators: Kathi

Aim: infection with the virus with YFP on the surface and CFP = GOI; Infected CHO-cells

Materials:

• Virus-stock (prepared on 02.09.2012)

• CHO-cells

• opti HEM

Methods:

• the virus stock was diluted with opti MEM (1:2; 1:10)

• the CHO cells was infected with the same volume of virus solution with the following dilution: 1:1; 1;2; 1;10

• negative control: without virus stock

Further tasks

• microscopy of the infected CHO-cells after 24 and 48 hours

Topic: picking clones of p10_Psb1c3_CMV_kozak_sortase_myc and p10_Psb1c3_CMV_kozak_sortase

Investigator: Xenia

Materials:

• LB medium

• ampicillin 100 mg/mL stock solution
  

plates with E. coli XL1 blue with plasmids: p10_psb1c3_cmv_kozak_sortase_myc and p10_psb1c3_cmv_kozak_sortase<b

Method:

• picking clones with p10_psb1c3_cmv_kozak_sortase_myc and p10_psb1c3_cmv_kozak_sortase

• over night culture (50 mL LB medium; 37 °C; 300 rpm; 17 hours)
  

Further tasks:

• endotoxin free midiprep

2012-09-05

Topic: Planing vector plasmid with neomycin cassete

Investigators: Xenia

Aim: planing how to digest and ligate the vectors for the vector plasmid with neomycin cassette

Material and Methods: Geneious

Results:

• pSB1C3 with lITR: cut with SpeI and PstI

• pcDNA3(+) with neomycin cassette: cut with XbaI and PstI

• pSB1C3 with lITR_CMV_neomycin_hGH: cut with SpeI and PstI

• pSB1C3 with rITR: cut with XbaI and PstI

Further tasks:

• design and ordering primer

• practical part:

Topic: preparation of the plasmids

Investigator: Kathi

Aim: endotoxin free preparation of p10_psb1c3_cmv_kozak_sortase_myc and p10_psb1c3_cmv_kozak_sortase

materials and methods:

• endotoxinfree preparation using the medi plasmid kit (QIAGEN)

• • the endotoxinfree preparations was tested by digestion and agarose gel electrophoresis

• • • digestion: 10 µL DNA (1:10 diluted) + 2 µL Green buffer + 1 µL of each enzym (XbaI and PstI) and 17 µL water (37 °C and 60 min)

• • • gel electrophoresis: 1% agarose gel, 100 V, 60 min

Results:

• concentration:

• • p10_PsB1c_CMV_kozak_sortase_myc: c= 1462 ng/µL v=~200 µL

• • p10_PsB1c_CMV_kozak_sortase: c= 1350 ng/µL v=~200 µL

• gel electrophoresis

• • the plasmid is wrong – wrong sizes of the plasmids fragments

• • • the wrong antibiotic was used in the over night culture

Further tasks

• retransformation of the right p10_psb1c_CMV kozak_sortase_myc and

p10_psb1c_CMV kozak_sortase plasmids

Topic: transfection

Investigator: Kathi

Aim:

• The plasmids were transfected in HEK-cells with the following plasmids:

• • pSB1C: GOI is CFP (1875 ng)

• • phelper (1875 ng)

• • P10_PsB1c3_CMV_kozak_sortase_myc (1875 ng)

• • p06: VP2 knock out (1875 ng)
    

• The plasmids were transfected in HEK-cells with the following plasmids:

• • pSB1C: GOI is CFP (1875 ng)

• • phelper (1875 ng)

• • P10_PsB1c3_CMV_kozak_sortas (1875 ng)

• • p06: VP2 knockut 1875 ng)
    

Materials:

• PEI (transfection reagent)

• opti MEM (transfection medium)

• endotoxin free preparated plasmids

Further tasks

• change medium (DMEM) after 16 hours

• after three days virus maturation – preparation of the virus

2012-09-06

Topic: Primer design and ordering

Investigator: Xenia

Materials and Methods: Geneious

Results:

• Primer (forward) with XbaI recognition site:

• • GTCTAGACACGGAATGTGTGTCAGTTAGGGTGTGG

• Primer (reverse, complement) with SpeI and PstI recognition site:

• • TACTGCAGCCCCTACTAGTATCGGGCAGACATGATAAGATACATTGATGAGTTTGG

Annealing temp.: 71 °C

Topic: exchange medium

Investigator: Kathi

Materials:

• DMEM

• PBS

Methods:

• asprirate the old medium

• wash with PBS

• add new DMEM to the cells

Further tasks:

• virus preparation on 09.09.2012 (four days virus maturation)

Topic: preparing viral stocks

Investigator: Kathi

Aim: virus preparation; virus constuct: YFP on the surface and GOI=CFP

Materials:

• cell-culture --> HEK AAV 293 transfected cells on 03.09.2012 (with following plasmids: p01, p06, phelper, psb1c3)

• 80 °C freezer

• 37 °C water bath
  

Method:

• transfer transfected cells (incl. DMEM) to a falcon tube

• 4 times: 10 min freeze the falcon tube (-80 °C) and 10 min unfreezing (37 °C water bath)

• centrifugation (10 min, 10000 g, RT)

• supernatant = virus stock

• sore at -80 °C
  

Results:

• virus stock → with YFP on the surface and GOI = CFP
  

Further tasks

• infection of the CHO-cells

Topic: microscopy

Investigators: Stefan and Kerstin

<b> Aim: virus preparation

Materials and methods:

• microscopy of the infeced CHO cells (02.09.2012)
  

Results:

• there are yellow fluorescence particle visible

• after bleaching there arn´t yellow fluorescence particle vibible

Further tasks

• another infection with a positive control (infected HT1080 cells)

2012-09-09

Topic: preparing viral stocks

Investigator: Kathi

Aim: virus preparation

Materials:

• cell-culture --> HEK AAV 293 transfected cells on 05.09.2012 (with following plasmids: p10_PsB1c_CMV_kozak_sortase_myc, VP2 knock out, phelper, PsB1c3GOI=CFP and p10_PsB1c_CMV_kozak_sortase, VP2 knock out, phelper, PsB1c3GOI=CFP)

• 80 °C freezer

• 37 °C water bath
  

Method:

• transfer transfected cells (incl. DMEM) to a falcon tube

• 4 times: 10 min freeze the falcon tube (-80 °C) and 15 min unfreezing (37 °C water bath)

• centrifugation (10 min, 10000 g, RT)

• supernatant = virus stock

• sore at -80 °C
  

Results:

• virus stock → surface: sortase + myc-tag; GOI= CFP
  virus stock → surface: sortase; GOI= CFP
  

• virus stock → surface: sortase; GOI= CFP
  virus stock → surface: sortase; GOI= CFP
  

Further tasks

• infection

2012-09-10

Topic: re-transformation

Investigator: Kathi

Materials:

• LB medium

• competent cells (XL1-blue cells)
  

Method:

• transformation via manual, 1 µL of the sample (PsB1c3_CMV_kozak_sortase_myc and PsB1c3_CMV_kozak_sortase prepared on 17.08.2012) were used

Further tasks:

• picking clones

2012-09-11

Topic: preparation of the plasmids

Investigator: Kathi

Aim:endotoxinfree preparation of the following plasmids: GOI=CFP, CFP linked on VP2 and GOI=mVenus

Materials and Methods:

• endotoxinfree preparation using the plasmid plus medi kit (QIAGEN)

Results:

• concentration:

• • GOI=CFP – c= 1159 ng/µL; v= 200 µL

• • CFP linked on VP2 – c= 776 ng/µL; v= 200 µL

• • GOI=mVenus – c= 532 ng/µL; v= 200 µL

Further tasks

• transfection with GOI= mVenus and CFP linked on VP2

Topic: PCR

Investigator: Xenia

Aim: PCR-amplificate: Neomycin cassette with restriction sites XbaI as prefix and SpeI and PstI as suffix

Materials:

• PCR

• • Vektor with antibiotic resistance: pcDNA3(+)

• • Primer:

• • • r_primer2_ neomycin_cassette-spe_pst (reversed):GTCTAGACACGGAATGTGTGTCAGTTAGGGTGTGG

• • • f_primer_neomycin_cassette_xbaI_fertig:TACTGCAGCCCCTACTAGTATCGGGCAGACATGATAAGATACATTGATGAGTTTGG

• • Phusion Polymerase, dNTPs, HF buffer

• Gel elektrophorese

• Nucleo Spin Gel and PCR Cleanup (Macherey-nagel)

Method:

• polymerase chain reaction
  

Mastermix

reagent	volume [µL]
HF Phusion buffer 5x	10
dNTPs	1
Primer (Forward)	2
Primer (Reverse)	2
DNA (Plasmid)	1.0
Phusion Polymerase	0.5
water	33.5

Program

step	Temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	10	30
annealing	71	40	30
elongation	72	40	30
final elongation	72	300	1
cooling	8	∞	1

Results:

100px

The concentration of the template was too high (1 µg/µL). The digestion couldn't be done because the template contains the same restriction sites as the PCR-amplificate

Further tasks:

• PCR with lower template concentration

• Gel electophorese

• Digestion

Topic: PCR

Investigator: Xenia

Aim: PCR-amplificate: Neomycin cassette with restriction sites XbaI as prefix and SpeI and PstI as suffix

Materials:

• Vektor with antibiotic resistance: pcDNA3(+)

• Primer:

• • • r_primer2_ neomycin_cassette-spe_pst (reversed):GTCTAGACACGGAATGTGTGTCAGTTAGGGTGTGG

• • • f_primer_neomycin_cassette_xbaI_fertig:TACTGCAGCCCCTACTAGTATCGGGCAGACATGATAAGATACATTGATGAGTTTGG

• • Phusion Polymerase, dNTPs, HF buffer

• Gel elektrophorese

• NucleoSpin Gel ans PCR Clean-up Kit (macherey-nagel)

Method:

• polymerase chain reaction
  

Mastermix

reagent	volume [µL]
HF Phusion buffer 5x	10
dNTPs	1
Primer (Forward)	2
Primer (Reverse)	2
DNA (Plasmid)	1.0
Phusion Polymerase	0.5
water	33.5

Program

step	Temperature [°C]	duration [s]	cycles
denaturation	98	30	1
denaturation	98	10	30
annealing	71	40	30
elongation	72	40	30
final elongation	72	300	1
cooling	8	∞	1

Further tasks:

• Gel electophorese

• Digestion

2012-09-12

Topic: transfection

Investigator: Kerstin

Aim:

• The plasmids were transfected in HEK-cells with the following plasmids:

• • CFP linked on VP2 (1875 ng)

• • VP2 knock out (1875 ng)

• • phelper (1875 ng)

• • PsB1c3-GOI=CFP (1875 ng)
    

Materials:

• PEI (transfection reagent)

• opti MEM (transfection medium)

• endotoxin free preparated plasmids

Further tasks

• change medium (DMEM) after 16 hours

• after three days virus maturation – preparation of the virus (14.09.2012)

Topic: Gelelectrophoresis with PCR-amplificate

Investigator: Xenia

Aim: check whether the PCR worked

Materials:

• Geneious

• agarose

• 1x TAE-buffer

• 10x FD green Buffer

• PCR-sample

Method:

Gelelectrophoresis of PCR Neomycin cassette (1533bp) uncut

Results:

100px

No band indicating template is visible. The neomycin cassette will be cut.

further tasks:

• purification with PCR-clean up

• Digestion of neomycin cassette
  

Topic: Purification of PCR-amplificate with PCR clean-up Kit

Investigator: Xenia

Aim:
Purification of PCR-amplificate

Materials:

• NucleoSpin Gel and PCR Clean-up Kit (macherey-nagel)

Results:

• concentration of amplified neomycin cassette: 106.2 ng/µL
  

Further tasks:

• Digestion of amplified neomycin cassette
  

Topic: purification of p10-pSB1C3-CMV-Kozak-Sortase

Investigator: Xenia

Aim: purification of p10-pSB1C3-CMV-Kozak-Sortase

Materials:
Plasmid Plus Midi Kit (QIAGEN)

Results:

concentration of plasmid:

• p10-pSB1C3-CMV-Kozak-Sortase: 2045.8 ng/µL
  

Further tasks:

• transfection

Topic: purification of left and right ITR plasmids with miniprep

Investigator: Xenia

Aim: purification of left and right ITR plasmids

Materials:

• Geneious

• GeneJET Plasmid Miniprep Kit

• Gel electrophoresis
  

Results:

concentration of the plasmids:

• left ITR: 174.4 ng/µL

• left ITR: 224.2 ng/µL

• right ITR: 87.2 ng/µL

• right ITR: 75.5 ng/µL

Gel electrophoresis

The left_ITR plasmid consists of 2.217 kbp and right ITR consists of 2.216 kbp

Further tasks:

digestion

send the DNA to sequencing

Investigators: Xenia and Tobias

sample	GATC number	Seq. Primer
p10-pSB1C3-CMV-Kozak-Sortase	II3673	p140:Viral Brick 587KO-His rev
p10-pSB1C3-CMV-Kozak-Sortase	II3674	p37: Primer cap 2800 for
p10-pSB1C3-CMV-Kozak-Sortase	II3675	p39: Primer cap 3500 for
p10-pSB1C3-CMV-Kozak-Sortase	standard Primer GATC	CMV-Primer

Topic: EGFR - resuspend EGFR construct

Investigator: Tobi

Aim: resuspend of the EGFR construct

Materials and Methods:

• resuspend the EGFR in 50 µL water
  

Further tasks:

• transformation

Topic: EGFR - transformation

Investigator: Tobi

Aim: transformation of the EGFR construct

Materials and Methods:

• LB-medium

• competent cells (XL1-blue cells)

• transformation via manual, 10 µL of the ligation were used
  

Further tasks:

• picking clones

2012-09-13

Topic: Virus preparation - transfection

Investigator: Kathi

Aim: transfection of HEK-AAv 293 cells -> virus contruct with kozak_sortase_myc + GOI=CFP and kozak_sortase + GOI=CFP

Materials:

• plasmids:

• • p10_psb1c_CMV_kozak_sortase_myc (1875 ng)

• • p05 - VP2 knock out (1875 ng)

• • GOI = CFP (1875 ng)

• • phelper (1875 ng)

• PEI (transfection reagent)

• opti MEM (transfection medium)

Methods:

• transfection preparation1875 ng per plasmid

• add 200 µL opti MEM-medium per each transfection

• 4.8 * DNA --> 72 µL PEI add 200 µL per each transfection

• three times 10 s mixing

• 2 min incubation at RT

• centrifagation

• add the PEI preparation to the DNA preparation

• mixing

• 15 min incabation at RT

• add the transfection preparation to the HEK AAV 293 cells

Further tasks:

• change medium (DMEM) after 16 hours

• after three days virus maturation – preparation of the virus (16.09.2012)

Topic: Virus preparation - exchange medium

Investigator: kathi

Aim: change the medium of the transfected HEK cells (transfection date: 12.09.2012)

Materials:

• PBS

• DNEN

Methods:

• asprirate the old medium

• wash with PBS

• add new DMEM to the cells

Further tasks:

• virus preparation on 17.09.2012 (three days virus maturation)

Topic: p10_psb1c_CMV_kozak_sortase - +myc and - myc - Digestion

Investigator: Kathi

Aim: test digestion

Materials:

• plasmids:

• • p10_psb1c_CMC_kozak_sortase_myc

• • p10_psb1c_CMC_kozak_sortase

• enzymes: XbaI and PstI

• 10 x FD green buffer

Methods:

• Digestion approache:

• • 5 µL DNA (1:100 dilute) + 1 µL of each enzyme + 3 µL 10 x FD green buffer + 21 µL water

• 1 hour at 37 °C

Further tasks:

• gel electrophoresis

Topic: p10_psb1c_CMV_kozak_sortase - +myc and - myc - gel-electrophoresis

Investigator: Kathi

Aim: control of the test digest

Materials:

• 1% agarose gel

• 1 x TAE buffer

Methods:

• run: 60 min at 100 V

Further tasks:

• sequencing

Topic: EGFR - picking clones

Investigator: Tobias

Aim: picking two clones

Materials and Mtehods:

• picking two clones and incubate over night in LB medium (incl. Amp)

Further tasks:

• DNA preparation

2012-09-14

Topic: Sequencing

Investigator: Kathi

Aim: send the re-tranfected p10_psb1c3_CMV_kozak_sortase_myc and p10_psb1c3_CMV_kozak_sortase for sequncing

Materials:

• Primer

• concentration and volum of the DNA: c= 50 ng/µL; v= 100 µL

Methods: GATC

Further tasks:Geneious analysis

Topic: exchange medium

Investigator: Kathi

Aim: change the medium of the transfected HEK cells (transfection date: 13.09.2012)

Materials:

• PBS

• DMEM

Methods:

• asprirate the old medium

• wash with PBS

• give new DMEM on the cells

Further tasks:

virus preparation on 16.09.2012 (three days virus maturation)

Topic: infection

Investigator: Kerstin

Aim: infection of the HT1080, CHO-cells and CHO-cells with nanobody

Materials and Methods:

• the virus was added to the cells

Further tasks:

• aspriration of the medium (inkl. virus) and add of new virus-medium mix

Topic: transfection

Investigator: Kathi

Aim: transfection of HEK-AAv 293 cells -> virus contruct with CFP on the surface and GOI= mVenus

Materials

• plasmids:

• • CFP linked on VP2 (1875 ng)

• • VP2 knock out (1875 ng)

• • GOI = mVenus (1875 ng)

• • phelper (1875 ng)

• PEI (transfection reagent)

• opti MEM (transfection medium)

Methods:

• transfection preparation1875 ng per plasmid; add 200 µL opti MEM-medium per each transfection

• 4.8 * DNA --> 72 µL PEI add 200 µL per each transfection

• three times 10 s mixing

• 2 min incubation at RT

• centrifagation

• add the PEI preparation to the DNA preparation

• mixing

• 15 min incabation at RT ä

• add the transfection preparation to the HEK AAV 293 cells

Further tasks:

• change medium (DMEM) after 16 hours

• after three days virus maturation – preparation of the virus (17.09.2012)

Topic: EGFR - DNA preparation

Investigator: Kathi

Aim: preparation of the EGFR over night culture

Materials and Methods:

• over night culture

• GeneJET Plasmid Miniprep Kit

Results:

• concentration

• • EGFR - clon 1: c= 321 ng/µL v= 50 µL

• • EGFR - clon 2: c= 383 ng/µL v= 50 µL

Further tasks:

• Digestion

Topic:EGFR - preparatively digestion

Investigator: Kathi

Aim: digest the EGFR construct with XbaI and AgeI for the BioBrick and with XbaI and PstI for the arabinose plasmid

Materials:

• 10 x FD green buffer

• DNA (preped with JetGen-Kit)

• XbaI, AgeI and PstI

Methods:

• EGFR-construct clon 1:

• • degestion approach (BioBrick): 6,2 µL DNA (~ 2 µg DNA) + 2 µL of each enzyme (XbaI and AgeI) + 3 µL FD green buffer + 18,8 µL water

• • degestion approach (Arabinose): 6,2 µL DNA (~ 2 µg DNA) + 2 µL of each enzyme (XbaI and PstI) + 3 µL FD green buffer + 18,8 µL water

• EGFR-construct clon 2:

• • degestion approach (BioBrick): 5,2 µL DNA (~ 2 µg DNA) + 2 µL of each enzyme (XbaI and AgeI) + 3 µL FD green buffer + 19,8 µL water

• • degestion approach (Arabinose): 5,2 µL DNA (~ 2 µg DNA) + 2 µL of each enzyme (XbaI and PstI) + 3 µL FD green buffer + 19,8 µL water

• 2,5 hours; 37 °C

Further tasks:

gel electrophoresis

Topic: EGFR - gel-electrophoresis

Investigator: Kathi

Aim: seperation of the fragments

Materials and Methods:

• 1% agarose

• 1 x TBE buffer

• 90 min at 95 V

Results:

Further tasks:

gel extraction

Topic: EGFR - ligation

Investigator: Kathi

Aim: ligate the EGFR construct into the BioBrick plasmid (Backbone) and the arabinose plasmid

Materials:

• T4 ligase

• T4 ligase buffer

Methods:

• ligase approach:

• • EGFR-BioBrick:

• • • 2 µL Ta ligase buffer + 1 µL ligase + 1.2 µL psb1cplasmid (backbone) + 6.9 µL EGFR construckt (digest with XbaI, AgeI)

• • EGFR-agabinose:

• • • 2 µL Ta ligase buffer + 1 µL ligase + 3.7 µL arabinose plasmid (backbone) + 3.3 µL EGFR construckt (digest with XbaI, PstI)

Further tasks:

transformation

Topic: EGFR - transformation

Investigator: Kathi

Aim: transformation - EGFR construct/BioBrick and EGFR/arabinose

Materials:

• LB-medium

• competent cells (XL1-blue cells)

• antibiotics

• • arabinose backbone - Amp

• • BioBrick backbone - CM

Methods:

• transformation via manual, 10 µL of the ligation were used

Further tasks:

picking clones

Topic: lITR-antibiotic-rITR - picking clones

Investigator: Kathi

Aim: picking clones - over nicht clutute

Materials and Methods:

• LB-medium with CM

Further tasks:

DNA peparation

2012-09-15

Topic: Virus-construct - Virus preparation

Investigator: kathi

Aim: preparing the primary virus stock --> CFP on the surface anf GOI = mVenus

Materials:

• cell-culture --> HEK AAV 293 transfected cells on 14.09.2012

• 80 °C freezer

• 37 °C water bath

Methods:

• transfer transfected cells (incl. DMEM) into a falcon tube

• 4 times: 10 min freeze the falcon tube (-80 °C) and 15 min unfreezing (37 °C water bath)

• centrifugation (10 min, 10000 g, RT)

• supernatant = virus stocksore at -80 °C

Results:

• primary virus stock with CFP on the surface and mVenus = GOI

Further tasks:

• infection

Topic: exchange medium

Investigator: Kathi

Aim: Change the medium of the transfected HEK cells (transfection date: 14.09.2012)

Materials:

• PBS

• DMEM

Methods:

• asprirate the old medium

• wash with PBS

• add new DMEM to the cells

Further tasks:

• virus preparation on 17.09.2012 (three days virus maturation)

Topic: EGFR - picking clones

Investigator: kathi

Aim: picking clones - the EGFR contruct into the arabinose and psb1c plasmid

Materials and Methods:

• LB-medium

• antibiotics

• • arabinose plasmid - Amp

• • psb1c plasmid - CM

• over night incubation - shaking - 37 °C

Further tasks:

• arabinose plasmid - mainculter - start expression

• psb1c plasmid - preparation of the DNA

Topic: ITR: preparation

Investigator: kathi

Aim: preparation of the ITR-neo over night cultur

Materials and Methods:

• GeneJET Plasmid Miniprep Kit

Results:

• concentration

• • clone 1: c= 335 ng/µL v= 50 µL

• • clone 2: c= 325 ng/µL v= 50 µL

Further tasks:

test digestion

Topic: ITR: Digestion

Investigator: kathi

Aim: Digestion of the prapared plasmids (leftITR+neo)

Materials:

• 10 x FD green buffer

• DNA (preped with JetGen-Kit)

• SpeI and PstI

Methods:

• 2 µg DNA + 3 µL FD green buffer + 2 µL of each enzyme + add 30 µL water

Results:

Further tasks:

new digestion with less DNA - 1000 ng and 500 ng

2012-09-16

Topic: Virus-construct - Virus preparation

Investigator: kathi

Aim: preparing the primary virus stock --> p10_psb1c3_CMV_kozak_sortase_myc and p10_psb1c3_CMV_kozak_sortase

Materials:

• cell-culture --> HEK AAV 293 transfected cells on 13.09.2012

• 80 °C freezer

• 37 °C water bath

Methods:

• transfer transfected cells (incl. DMEM) to a falcon tube

• 4 times: 10 min freeze the falcon tube (-80 °C) and 15 min unfreezing (37 °C water bath)

• centrifugation (10 min, 10000 g, RT)

• supernatant = virus stock store at -80 °C

Results:

• primary virus stock

• • p10_psb1c3_CMV_kozak_sortase_myc

• • p10_psb1c3_CMV_kozak_sortase

Further tasks:

• infection

Topic: EGFR - preparation (BioBrick)

Investigator: kathi

Aim: preparation of the EGFR construct

Materials and Methods:

• over night culture

• GeneJET Plasmid Miniprep Kit

Results:

• concentration EGFR (construct)- clone 1: c= 285 ng/µL v= 50 µL

• concentration EGFR (construct)- clone 1: c= 385 ng/µL v= 50 µL

Further tasks:

• Digestion

Topic: EGFR - Digestion (BioBrick)

Investigator: kathi

Aim: Test Digestion

Materials

• fast digest (FD) enzymes (XbaI and AgeI)

• FD green buffer

Methods:

• Digestion: 5 µL (1:10 diluted DNA) + 3 µL FD green buffer + 1 µL of each enzyme add 30 µL water

Results:

• the bands seems to be correct

Further tasks:

send for sequencing

2012-09-17

Topic: Virus-construct - Virus preparation

Investigator: kathi

Aim: preparing the primary virus stock --> CFP on the surface and GOI= mVenus

Materials:

• cell-culture --> HEK AAV 293 transfected cells on 14.09.2012

• 80 °C freezer

• 37 °C water bath

Methods:

• transfer transfected cells (incl. DMEM) to a falcon tube

• 4 times: 10 min freeze the falcon tube (-80 °C) and 15 min unfreezing (37 °C water bath)

• centrifugation (10 min, 10000 g, RT)

• supernatant = virus stock store at -80 °C

Results:

• primary virus stock

• • CFP on the surface and YFP = GOI

Further tasks:

• infection

Topic: EGFR - expression start

Investigator: kathi

Aim: start the expression with arabinose

Materials:

• LB-medium

• arabinose [10%]

• ampicilin

Methods:

• 200 µL over night culture into fresh LB medium (incl. Amp.)v= 150 µL

• incubation till OD 0,4

• start of the expression + 450 µL 10% arabinose solution

• 4 hours incubation 37 °C

• the pellet can be store at -20 °C

Further tasks:

preparation of the EGFR

Topic: qPCR

Investigator: kathi

Aim: test the genetic virus titer of the virus with YFP on the surface and GOI = CFP

Materials:

• 2 x QuantiFast SYBR-green (QIAGEN)
• Rnase free water
• RNaseI (NEB)
• CMV primer
  • CMV_forward_qPCR: 5' - GGGACTTTCCTACTTGGCA - 3'
  • CMV_reverse_qPCR: 5' - GGCGGAGTTGTTACGACA - 3'

Methods:

• the stard qPDR protocol were used

Results:

• there are no evaluable quantification curves

Further tasks:

• repetition of the experiment

2012-09-18

Topic: ITR-neo Digestion

Investigator: kathi

Aim: digestion of the ITR-neo contruct

Materials and Methods:

• ITR-neo clone 1

• • 3 µL DNA (1000 ng)+ 1,5 µL per enzyme (PstI; SpeI) + 3 µL buffer 4 (NEB) 22 µL water

• • 1,5 µL DNA (500 ng) + 1,5 µL per enzyme (PstI; SpeI) + 3 µL buffer 4 (NEB) 23,5 µL water

• ITR-neo clone 2

• • 3 µL DNA (1000 ng)+ 1,5 µL per enzyme (PstI; SpeI) + 3 µL buffer 4 (NEB) 22 µL water

• • 1,5 µL DNA (500 ng) + 1,5 µL per enzyme (PstI; SpeI) + 3 µL buffer 4 (NEB) 23,5 µL water

• 37 °C; 60 min

Results:

Further tasks:

• shorter digestion time

• desing of new primer

Topic: EGFR - send for sequencing

Investigator: kathi

Aim: send the EGFR in the psb1c plasmid for sequencing

Materials and Methods:

• send the EGFR clone 1 and clone 2 (c= 50 ng/µL)

• Primer forward and reverse psb1c primer

2012-09-19

Topic: EGFR - expression start

Investigator: Xenia

Aim: start the expression with arabinose

Materials:

• LB-medium

• arabinose [10%]

• ampicilin

Methods:

• 25 mL overnight culture into fresh 1 L LB medium (incl. Amp.)v= 1 mL

• incubation till OD 0.4

• start of the expression: 5 mL 10% arabinose solution (c=0.05 %)

• 4 hours incubation the one by 37 °C and the other by 30 °C

• the pellet can be stored at -20 °C

Further tasks:

Western blot: the band should appear by 24,8 kDa

• Gel: 12.5 %
  

• Sample for western blot: 80 µL Sample (OD ~ 2.5) + 20 µL Roti-Load1 reducing
  

• denaturation 10 min; 95 °C

2012-09-20

Topic: EGFR - SDS-PAGE

Investigators: Xenia and Kathi

Aim: separation of the EGFR using the SDS PAGE - control of the expresion

Materials:

• 12.5% SDS-gel

• 1 x TBS buffer

Methods:

• load 20 µL of the praparted samples to the SDS gel

• 100 V 1.5 hours

Further tasks:

Western blot: the band should appear by 24,8 kDa

Topic: EGFR - western blot

Investigator: Kathi

Aim: detection of the EGFR

Materials:

• membrane

• TBS-buffer + 5% milk powder

Methods:

• semi-dry plot of the SDS-PAGE

• blocking of the memrane over night

Topic: ITR - PCR clean up

Investigator: Kathi

Aim: PCR clean up of the 0.4 PCR

Materials and Methods:

• NucleoSpin Gel and PCR Clean-up Kit (macherey-nagel)

Further tasks:

• Digestion

Topic: ITR - Digestion

Investigator: Kathi

Aim: contol of the PCR product and the ligation (leftITR-neo)

Materials:

• fast digest enzyms

• fast digest green buffer

• Enzyms: PstI, XbaI, SpeI

Methods:

• leftITR-neo

• • Digestion: 1 µL SpeI + 0,3 µL PstI + 3 µL FD green buffer add 30 µL water (three times: 10 min, 20 min and 40 min digestion time)

• PCR

• • Digestion: 2 µL XbaI + 2 µL PstI + 3 µL FD green buffer add 30 µL water

• leftITR

• • Digestion: 2 µL SpeI + 2 µL PstI + 3 µL FD green buffer add 30 µL water

one hour at 37 °C

Results:

Further tasks:

• new PCR with neu primer

• new ligation with the neu pcr product

2012-09-21

Topic: EGFR - staining of the membrane

Investigators: Xenia and Kathi

Aim: staining of the membrane

Materials:

• TBST buffer + milk powder

• antibody:

Methods:

• washing three times of the membrane with TBST

• 15 min incubation with TBST buffer

• three times washing of the membrane

• incubation with the antibody

• three times washing of the membrane with TBST

• staining of the membraine

Results:

Further tasks:

• periplasma preparation
  

2012-09-22

Topic: Virus - transfection

Investigator: Kathi

Aim: The plasmids were transfected in HEK-cells with the following plasmids: pSB1C: GOI = CFP (1875 ng) phelper (1875 ng) P01: YFP linked on VP1 (1875 ng) p06: VP1 knock out (1875 ng)

Materials:

• Medium: opti Mem

• transfection reagent: PEI 15 µg per each transfection

Methods:

• transfection preparation 1875 ng per plasmid; add 200 µL opti MEM per each transfection 4.8 * DNA --> 72 µL PEI add 200 µL per each transfection

• three times 10 s mixing

• 2 min incubation at RT

• centrifagation

2012-09-25

Topic: Virus - qPCR

Investigator: Kathi

Aim: test the genomic virus titer of the viruses with YFP on the surface and CFP=GOI

Materials:

• RNase free watreä
• primer
  • CMV_forward_qPCR: 5' - GGGACTTTCCTACTTGGCA - 3'
  • CMV_reverse_qPCR: 5' - GGCGGAGTTGTTACGACA - 3'
• DNaseI (NEB)
• 2x QuantiFast SYBR-green (QIAGEN)

Methods:

• the real time standard protocol were used

Results:

• there are 3,47 copies of the virus in each PCR

</div>