"
Non-antibiotic selectable and counter-selectable markers:
Sucrose Hydrolase
Background
Sucrose hydrolase is an enzyme from Escherichia coli O157:H7 strain Sakai which is involved in sucrose utilization (Jahreis, et al., 2002). Transforming Escherichia coli K12 strains with sucrose hydrolase allows the cells to grow with sucrose as a sole carbon source which the untransformed K12 strain cannot do. This allows this gene to be used as a selectable marker.
Cloning
CscA selection plasmid
The cscA and pSBIC3 gene were cloned using these primers. Method. pSBIC3-cscA ligation transformants are to be checked for the success of this cloning procedure.
Forward primer: GCTA gaattcgcggccgcttctagag caccagg agttgtt atg gat
Reverse primer: CATG ctgcag cggccgc t actagt a tta tt AGCACTCGG TCACAATCGT
Figure 12: DNA gel of PCR product s of pSBIC3 without chloramphenicol and cscA. One product is around 1.4 kb which corresponds to the size of cscA gene, the other is around 2.2 kb which corresponds to the pSBIC3 vector without cml resistance.
Close the primers.
Method: The purified cscA and psBIC3 PCR products were digested with NdeI and ClaI. Both products were ligated and E.coli cells transformed with the ligation.
Close the primers.
Characterization
Plates
Plates characterization showed that cscA is a suitable selectable marker- only cells which had the gene grew on sucrose as a sole carbon sourse. The drawback of this antibiotic-free selectable market is that more time is required for the growth of the cscA cells on sucrose (overnight at 37°C+4 days at room temperature).
Figure 13: cscA cells as well as control cells were spread on LB plate, minimal plate with sucrose, minimal plate with sucrose and minimal plate with no sugars. Both cscA and control cells do not grow on minimal plate with no sugars and grow on LB and minimal plate with glucose. However, cscA cells are growing on minimal media with sucrose while control cells are not.
Conclusion:
We successfully cloned the sucrose hydrolase gene and inserted it into biobrick vector.
We extensively characterized the sucrose gene in plates and liquid cultures.
We determined its suitability as selectable marker.
Further plans:
To check the success of pSBIC3-cscA selection plasmid and characterize it.
