Team:St Andrews/Procedure
From 2012.igem.org
(Difference between revisions)
Line 178: | Line 178: | ||
attctgcccttcatcatgtag</p></div> | attctgcccttcatcatgtag</p></div> | ||
</ul> | </ul> | ||
- | |||
</div> | </div> | ||
Revision as of 11:25, 25 July 2012
Lab Book
Procedure
anyone really keen to write this up, up to protein visualization? Don't forget to mention the differing restriction enzymes and vectors of each team. I can add in links to the protocols page.
Please also refer to our Protocols page.
Start from lipid extraction
primers, sequence results
Sequenceswho knows what those Metal Mickies are up to. Eating nachos in the Whey Pat most likely.