Team:St Andrews/Procedure
From 2012.igem.org
(Difference between revisions)
Line 28: | Line 28: | ||
</header> | </header> | ||
- | <div class="tabbable"> | + | <div class="tabbable"> |
<ul class="nav nav-tabs"> | <ul class="nav nav-tabs"> | ||
<li class="active"><a href="#tab1" data-toggle="tab">General Methods</a></li> | <li class="active"><a href="#tab1" data-toggle="tab">General Methods</a></li> | ||
Line 34: | Line 34: | ||
<li><a href="#tab3" data-toggle="tab">Metal-binding peptides</a></li> | <li><a href="#tab3" data-toggle="tab">Metal-binding peptides</a></li> | ||
</ul> | </ul> | ||
+ | |||
<div class="tab-content"> | <div class="tab-content"> | ||
+ | |||
<div class="tab-pane active" id="tab1"> | <div class="tab-pane active" id="tab1"> | ||
<p>anyone really keen to write this up, up to protein visualization? Don't forget to mention the differing restriction enzymes and vectors of each team. I can add in links to the protocols page.</p> | <p>anyone really keen to write this up, up to protein visualization? Don't forget to mention the differing restriction enzymes and vectors of each team. I can add in links to the protocols page.</p> | ||
- | |||
<p>Please also refer to our <a href="https://2012.igem.org/Team:St_Andrews/Lab-book"><font color="gray">Protocols</font></a> page.</p> | <p>Please also refer to our <a href="https://2012.igem.org/Team:St_Andrews/Lab-book"><font color="gray">Protocols</font></a> page.</p> | ||
</div> | </div> | ||
- | + | ||
<div class="tab-pane" id="tab2"> | <div class="tab-pane" id="tab2"> | ||
<p>Start from lipid extraction</p> | <p>Start from lipid extraction</p> | ||
Line 78: | Line 79: | ||
</a> | </a> | ||
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
- | + | <div class="span5"><p><font size="1">atgactgccacgattcccccgttgacaccaacggtaacgcccagcaatcccgatcgcccg | |
attgcggatctcaaactacaagacatcattaaaaccctgcccaaggaatgcttcgagaaa | attgcggatctcaaactacaagacatcattaaaaccctgcccaaggaatgcttcgagaaa | ||
aaagcgagcaaagcctgggcttctgttttgattaccctaggggcgatcgccgtgggctat | aaagcgagcaaagcctgggcttctgttttgattaccctaggggcgatcgccgtgggctat | ||
Line 105: | Line 106: | ||
</a> | </a> | ||
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
- | + | <div class="span5"><p><font size="1">gtgcgtctagaaatttcatcgcctcaaacaaagcttccttaccccaaaactgaagaatta | |
ccatttaccctccaagagctcagaaacgctattccagcggattgttttgagccatcggta | ccatttaccctccaagagctcagaaacgctattccagcggattgttttgagccatcggta | ||
gtccggtccttgggctacttttttttggatgttggtttaattgccgggttttatgctcta | gtccggtccttgggctacttttttttggatgttggtttaattgccgggttttatgctcta | ||
Line 133: | Line 134: | ||
</a> | </a> | ||
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
- | + | <div class="span5"><p><font size="1">atgctaacagcggaaagaattaaatttacccagaaacgggggtttcgtcgggtactaaac | |
caacgggtggatgcctactttgccgagcatggcctgacccaaagggataatccctccatg | caacgggtggatgcctactttgccgagcatggcctgacccaaagggataatccctccatg | ||
tatctgaaaaccctgattattgtgctctggttgttttccgcttgggcctttgtgcttttt | tatctgaaaaccctgattattgtgctctggttgttttccgcttgggcctttgtgcttttt | ||
Line 182: | Line 183: | ||
<BR> </BR> | <BR> </BR> | ||
- | |||
<span class="label">Primers</span> | <span class="label">Primers</span> | ||
<BR> </BR> | <BR> </BR> | ||
- | <dl class="dl-horizontal"> | + | |
+ | <dl class="dl-horizontal"> | ||
<dt>date</dt> | <dt>date</dt> | ||
<dd>what we did</dd> | <dd>what we did</dd> | ||
</dl> | </dl> | ||
- | + | </div> | |
- | + | ||
- | + | ||
<BR> </BR><BR> </BR><BR> </BR><BR> </BR><BR> </BR><BR> </BR> | <BR> </BR><BR> </BR><BR> </BR><BR> </BR><BR> </BR><BR> </BR> | ||
<BR> </BR><BR> </BR><BR> </BR><BR> </BR><BR> </BR> | <BR> </BR><BR> </BR><BR> </BR><BR> </BR><BR> </BR> | ||
+ | </div> | ||
- | + | <div class="tab-pane" id="tab3"> | |
- | + | <p>who knows what those Metal Mickies are up to. Eating nachos in the Whey Pat most likely.</p> | |
- | <p>who knows what those Metal Mickies are up to. Eating nachos in the Whey Pat most likely.</p> | + | </div> |
- | </div> | + | |
</div> | </div> | ||
+ | |||
+ | |||
</div> | </div> | ||
Revision as of 11:23, 25 July 2012
Lab Book
Procedure
anyone really keen to write this up, up to protein visualization? Don't forget to mention the differing restriction enzymes and vectors of each team. I can add in links to the protocols page.
Please also refer to our Protocols page.
Start from lipid extraction
primers, sequence results
SequencesPrimers
- date
- what we did
who knows what those Metal Mickies are up to. Eating nachos in the Whey Pat most likely.