"
Team:ZJU-China/project s1 2.htm
From 2012.igem.org
| Line 359: | Line 359: | ||
<p align="justify"> </p> | <p align="justify"> </p> | ||
<p align="justify">The base sequence of clover version 3 (complementary parts are shown in <b class="seq">blue</b>):</p> | <p align="justify">The base sequence of clover version 3 (complementary parts are shown in <b class="seq">blue</b>):</p> | ||
| - | <p class="seq">GGGGUCCUCGGUGAUACCAGC<b class="seq">ugacugugg</b> | + | <p class="seq">GGGGUCCUCGGUGAUACCAGC<b class="seq">ugacugugg</b>CCCUUGGCAGCACCGAGGACUGGGCACAGAAGAUAUGGCUUCGUGCCCAGUCG</br>AAUACGAGGAAGUGUUCGCACUUCACCUGGGACUC<b class="seq">ccacaguca</b>CUGGGGAGUCCCAGGUUCUCGUAUUCGCCCC</p> |
| - | + | ||
<p align="justify"> </p> | <p align="justify"> </p> | ||
Revision as of 10:55, 26 October 2012
Design
How could we make RNA scaffold tunable? We thought of riboswitch. A riboswitch usually consists of an allosteric aptamer and an expression platform. The structural interaction between them could inactivate gene expression. However, when a corresponding ligand is added, the interaction disappears with the structural altering of the aptamer and gene expression platform will be activated. It inspirited us to fuse an allosteric aptamer to the basic RNA scaffold to achieve the controllability of it.
Fig.1 The mechanism of riboswitch.
We utilized the well-known theophylline aptamer. The aptamer is a single RNA hairpin that binds theophylline in an inner loop region with high affinity. Previous studies have shown that mutations in the loop region were tolerated as long as the loop structure was preserved. This allowed us to mutate the loop of the theophylline aptamer to create an interaction between the theophylline aptamer and the MS2 aptamer. We changed the sequence in the mutation region of theophylline aptamer by making it a complementary one of part of MS2 aptermer.
Fig.2 The sequence of theophylline aptamer and the structure of theophylline. The sequence in the blue box is mutation region, while the one in the orange box is ligand-binding region.
In the absence of theophylline, the interaction prevents MS2 protein from binding to MS2 aptamer, so the scaffold cannot function. When theophylline is added, the interaction disappears as a result of the structural change of theophylline aptamer and the scaffold begins to work. This kind of tunable scaffold contains an allosteric aptamer, so we call them alloscaffolds.
Fig.3 The control mechanism of the theophylline aptamer.
We designed a series of alloscaffolds and named them clovers, because the structure of them resembles a clover.
Fig.4 The alloscafolds we designed are called ‘clover’.
At first, we designed two versions of clover.
Fig.5 The sequences of two aptamers in clover version 1and 2. As can be seen, version 1 and 2 have adjacent MS2 and theophylline aptamers. However, version 1 has an interaction between the loop of theophylline aptamer and the loop of MS2 aptamer, while version 2 has an interaction between the loop of theophylline aptamer and the stem of MS2 aptamer.
As our time was limited, we had only synthesized clover version 2 before Regional Jamboree. Although it shows a prominent function of tunable scaffold, some problems remain, for example, in the absence of theophylline, it also shows a remarkable function of a scaffold, which is not desirable for us.
Then after Regional Jamboree, clover version 3 was designed and synthesized. Unlike clover version 1 and 2, in which MS2 and theophylline aptamers are adjacent, clover version 3 has separated MS2 and theophylline aptamers in sequence. However, in the tertiary structure, the two aptamers get closer to each other and theophylline aptamer obviously fold towards the MS2 aptamer in the absence of theophylline.
Fig.6 The sequence and relative position of MS2 and theophylline aptamers in clover version 3.
Fig.7 A contrast of clover version 3 (left) and a scaffold including a theophyline aptamer without a complementary site of MS2 aptamer (right). It can be easily noticed that in clover version 3, the theophyline aptamer obviously fold towards the MS2 aptamer, which indicates the interaction between the complementary sites in the theophyline and MS2 aptamers. In contrast, the scaffold without complementary sites in the two aptamers shows no approach of the theophyline aptamer to the MS2 aptamer.
Followed are the sequences and structures of basic RNA scaffold and the series of clovers.
Basic scaffold D0
The base sequence of original scaffold D0:
GGGAGGACTCCCACAGTCACTGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGT TCGCACTTCTCTCGTATTCGATTCCC
 |
Fig.8 The secondary and the tertiary structures of D0. Color scale in secondary structure denotes positional entropy.
Clover version 1
The interaction is between the loop of theophylline aptamer and the loop of the MS2 aptamer.
And the theophylline aptamer is just beside the MS2 apatamer.
The base sequence of clover version 1 (complementary parts are shown in blue):
GGGGUCCUCGGUGAUACCAGCAUagugacuAUGCCCUUGGCAGCACCGAGGAGGACTCCCACagtcactGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGTTCGCACTTCTCTCGTATTCGCCCC
 |
Fig.9 The secondary and the tertiary structure of clover version 1. Color scale in secondary structure denotes positional entropy.
Clover version 2
The interaction is between the loop of the theophylline aptamer and the stem of the MS2 apatamer. And the theophylline aptamer is just beside the MS2 apatamer.
The base sequence of clover version 2 (complementary parts are shown in blue):
GGGGUCCUCGGUGAUACCAGCugacuguggCCCUUGGCAGCACCGAGGAGGACTCccacagtcaCTGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGTTCGCACTTCTCTCGTATTCGCCCC
 |
Fig.10 The secondary and the tertiary structure of clover version 2. Color scale in secondary structure denotes positional entropy.
Clover version 3
The interaction is between the loop of the theophylline aptamer and the stem of the MS2 apatamer. Although the theophylline and the MS2 apatamer is separated by the PP7 aptamer in the base sequence, they are close according to the tertiary structure prediction.
The base sequence of clover version 3 (complementary parts are shown in blue):
GGGGUCCUCGGUGAUACCAGCugacuguggCCCUUGGCAGCACCGAGGACUGGGCACAGAAGAUAUGGCUUCGUGCCCAGUCGAAUACGAGGAAGUGUUCGCACUUCACCUGGGACUCccacagucaCUGGGGAGUCCCAGGUUCUCGUAUUCGCCCC
|
Fig.11 The secondary and the tertiary structure of clover version 3. Color scale in secondary structure denotes positional entropy. Although the theophyline and MS2 aptamers are separated as the secondary structure showed, in the tertiary structure, the theophyline aptamer obviously fold towards the MS2 aptamer.
References:
1. Thodey, K. & Smolke, C.D. Bringing It Together with RNA. Science 333, 412-413 (2011). 2. Delebecque, C.J., Lindner, A.B., Silver, P.A. & Aldaye, F.A. Organization of Intracellular Reactions with Rationally Designed RNA Assemblies. Science 333, 470-474 (2011). 3. Qi, L., Lucks, J.B., Liu, C.C., Mutalik, V.K. & Arkin, A.P. Engineering naturally occurring trans-acting non-coding RNAs to sense molecular signals. Nucleic Acids Res 40, 5775-5786 (2012).
