Team:Potsdam Bioware/Lab/Labjournal/October

From 2012.igem.org

(Difference between revisions)
(→2012-10-19)
(→Antibody)
Line 264: Line 264:
<b>Further Taks:</b>
<b>Further Taks:</b>
* extension PCR of scFv and nanobody
* extension PCR of scFv and nanobody
 +
<br>
 +
 +
 +
===<p style="background-color: rgb(240, 20, 70);"> 2012-09-20</p>===
 +
 +
<p style="background-color: rgb(238, 221, 130); font-weight:bold;">PCR:  amplification of nanobody/Fc with overhang of new RAGE-TMD</p>
 +
<b>Investigators:</b> Sascha<br>
 +
<b>Materials:</b>
 +
* Template: nanobody-geneart-construct
 +
* Phusion-polymerase
 +
* 10x Phusion buffer GC<br>
 +
* dNTPs (10mM)
 +
* nanobody-geneart-construct: rage:startprimer-fw_nano/Fc; rage-rv:Fc to rageTMD
 +
* Thermocycler<br>
 +
<b>Methods:</b>
 +
'''2x master mix of each: eYFP and mcherry'''
 +
<table border=1>
 +
<tr>
 +
<td>'''reagent''' </td>
 +
<td>'''volume [µL]''' </td>
 +
</tr>
 +
<tr>
 +
<td>10x Phusion BC buffer</td>
 +
<td>20</td>
 +
</tr>
 +
<tr>
 +
<td>dNTPs</td>
 +
<td>2</td>
 +
</tr>
 +
<tr>
 +
<td> rage:startprimer-fw_nano/Fc </td>
 +
<td>5</td>
 +
</tr>
 +
<tr>
 +
<td> rage-rv:Fc to rageTMD </td>
 +
<td>5</td>
 +
</tr>
 +
<tr>
 +
<td> template nanobody-geneart-construct (10ng/µl)</td>
 +
<td> 6</td>
 +
</tr>
 +
<tr>
 +
</tr>
 +
<tr>
 +
<td> Phusion Polymerase </td>
 +
<td> 1,0 </td>
 +
</tr>
 +
<tr>
 +
<td> water </td>
 +
<td> 92</td>
 +
</tr>
 +
<tr>
 +
</tr>
 +
</table>
 +
<br>
 +
'''Program'''
 +
<table border=1>
 +
<tr>
 +
<td>'''step''' </td>
 +
<td>'''Temperature [°C]''' </td>
 +
<td>'''duration [s]''' </td>
 +
<td>'''cycles''' </td>
 +
</tr>
 +
<tr>
 +
<td> initial denaturation </td>
 +
<td> 98 </td>
 +
<td>30</td>
 +
<td>1 </td>
 +
</tr>
 +
<tr>
 +
<td> denaturation </td>
 +
<td> 98 </td>
 +
<td> 8 </td>
 +
<td> 30</td>
 +
</tr>
 +
<tr>
 +
<td> annealing </td>
 +
<td> 520°C/62°C/65,5°C </td>
 +
<td> 10 </td>
 +
<td> 30 </td>
 +
</tr>
 +
<tr>
 +
<td> elongation </td>
 +
<td> 72 </td>
 +
<td> 15 </td>
 +
<td> 30</td>
 +
</tr>
 +
<tr>
 +
<td> final elongation </td>
 +
<td> 72 </td>
 +
<td> 600 </td>
 +
<td> 1 </td>
 +
</tr>
 +
<tr><td> cooling </td>
 +
<td> 8 </td>
 +
<td> ∞ </td>
 +
<td> 1 </td>
 +
</tr>
 +
<tr>
 +
</table>
 +
 +
<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: preparative gelelectrophoresis of amplified nanobody/Fc with RAGE-TMD overhangs</p>
 +
<b>Investigator:</b> Sascha<br>
 +
<b>Materials:</b><br>
 +
* agarose
 +
* 1xTAE-buffer
 +
* 10xFD Green Buffer <br>
 +
<b>Method:</b><br>
 +
* 1% agarosegel, 55ml
 +
* 120V
 +
<b>Results:</b><br>
 +
* amplified nanobody/Fc showed sufficient bp-size @ 1252bp <br>
 +
<b>Further Tasks:</b><br>
 +
* gel extraction and concentrations measurement
 +
 +
<p style="background-color: rgb(238, 221, 130); font-weight:bold;"> gel extraction of amplified eYFP and mcherry out of 1% agarosegel </p>
 +
<b>Investigators:</b>Sascha<br>
 +
<b>Results:</b>
 +
[nanobody/FC] = 2,5ng/µl</b>
 +
<b>Further Taks:</b>
 +
* extension PCR of scFv and nanobody
 +
* assembly-PCR of nanobody/Fc with mherry via RAGE-transmembrane domain
 +
 +
 +
 +
 +
<p style="background-color: rgb(238, 221, 130); font-weight:bold;">PCR:  assembly-PCR of nanobody/Fc with mcherry over RAGE-TMD</p>
 +
<b>Investigators:</b> Sascha<br>
 +
<b>Materials:</b>
 +
* Template: nanobody/FC and mcherry with TMD-overhangs
 +
* Phusion-polymerase
 +
* 10x Phusion buffer GC<br>
 +
* dNTPs (10mM)
 +
* Thermocycler<br>
 +
<b>Methods:</b>
 +
'''2x master mix of each: eYFP and mcherry'''
 +
<table border=1>
 +
<tr>
 +
<td>'''reagent''' </td>
 +
<td>'''volume [µL]''' </td>
 +
</tr>
 +
<tr>
 +
<td>10x Phusion BC buffer</td>
 +
<td>20</td>
 +
</tr>
 +
<tr>
 +
<td>dNTPs</td>
 +
<td>2</td>
 +
</tr>
 +
<tr>
 +
<td> rage:startprimer-fw_nano/Fc  was added after 15 assembling cycles</td>
 +
<td>5</td>
 +
</tr>
 +
<tr>
 +
<td> rage:endprimer in mcherry/loxp  was added after 15 assembling cycles</td>
 +
<td>5</td>
 +
</tr>
 +
<tr>
 +
<td> templates: nanobody/FC with TMD-overhangs ; mcherry with TMD-overhangs (10ng/µl)</td>
 +
<td> 2µl of mcherry and 8µl of nanobody/Fc </td>
 +
</tr>
 +
<tr>
 +
<td> Phusion Polymerase </td>
 +
<td> 1,0 </td>
 +
</tr>
 +
<tr>
 +
<td> water </td>
 +
<td> 57</td>
 +
</tr>
 +
<tr>
 +
</table>
 +
<br>
 +
'''Program'''
 +
<table border=1>
 +
<tr>
 +
<td>'''step''' </td>
 +
<td>'''Temperature [°C]''' </td>
 +
<td>'''duration [s]''' </td>
 +
<td>'''cycles''' </td>
 +
</tr>
 +
<tr>
 +
<td> initial denaturation </td>
 +
<td> 98 </td>
 +
<td>30</td>
 +
<td>15 </td>
 +
</tr>
 +
<tr>
 +
<td> denaturation </td>
 +
<td> 98 </td>
 +
<td> 10 </td>
 +
<td> 15</td>
 +
</tr>
 +
<tr>
 +
<td> annealing </td>
 +
<td> 60°C/70°C </td>
 +
<td> 12</td>
 +
<td> 15 </td>
 +
</tr>
 +
<tr>
 +
<td> elongation </td>
 +
<td> 72 </td>
 +
<td> 38 </td>
 +
<td> 15</td>
 +
</tr>
 +
<tr>
 +
<td> initial denaturation </td>
 +
<td> 98 </td>
 +
<td>30</td>
 +
<td>15</td>
 +
</tr>
 +
<tr>
 +
<td> denaturation </td>
 +
<td> 98 </td>
 +
<td> 10 </td>
 +
<td> 15</td>
 +
</tr>
 +
<tr>
 +
<td> annealing </td>
 +
<td> 60°C/70°C </td>
 +
<td> 12</td>
 +
<td> 15 </td>
 +
</tr>
 +
<tr>
 +
<td> elongation </td>
 +
<td> 72 </td>
 +
<td> 38 </td>
 +
<td> 15</td>
 +
</tr>
 +
<tr>
 +
<td> final elongation </td>
 +
<td> 72 </td>
 +
<td> 600 </td>
 +
<td> 1 </td>
 +
</tr>
 +
<tr>
 +
<td> cooling </td>
 +
<td> 8 </td>
 +
<td> ∞ </td>
 +
<td> 1 </td>
 +
</tr>
 +
<tr>
 +
</table>
 +
<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: analytical gelelectrophoresis of amplified nanobody/Fc with RAGE-TMD overhangs</p>
 +
<b>Investigator:</b> Sascha<br>
 +
<b>Materials:</b><br>
 +
* agarose
 +
* 1xTAE-buffer
 +
* 10xFD Green Buffer <br>
 +
<b>Method:</b><br>
 +
* 1% agarosegel, 55ml
 +
* 120V
 +
<b>Results:</b><br>
 +
* assembled nanobody/Fc-RAGE-TMD-mcherry showed sufficient bp-size: 2,1kb<br>
 +
<b>Further Tasks:</b><br>
 +
* PCR-Clean up of 60°C-assembling PCR-mix
 +
* amplification of assembeled nanobody/Fc-RAGE-TMD-mcherry
 +
 +
 +
<p style="background-color: rgb(238, 221, 130); font-weight:bold;"> PCR-Clean up of preparative gel electrophoresis of assembled nanobody/Fc-RAGE-TMD-mcherry and concentration measurement</p>
 +
<b>Investigator:</b> Sascha<br>
 +
<b>Materials:</b><br>
 +
* NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) <br>
 +
<b>Methods:</b>
 +
* according to CleanUp-protocol
 +
<b>Results:</b>
 +
[assembled nanobody/Fc-RAGE-TMD-mcherry ] = <br>
 +
<b>Further Taks:</b>
 +
* preparative gel electrophoresis of assembled nanobody/Fc-RAGE-TMD-mcherry
 +
 +
<br>
 +
 +
 +
===<p style="background-color: rgb(240, 20, 70);">2012-10-22</p>===
===<p style="background-color: rgb(240, 20, 70);">2012-10-22</p>===

Revision as of 23:55, 25 October 2012


Contents

AID

2012-10-10

Inoculation of plasmid samples of the 48h retransformation plates (after FACS)

Investigators: Tom


Time: 2012-10-10


Materials:

  • LB medium
  • Amp stock solution
  • plate with cultures:

EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP

(after FACS selection)

Method:

Inoculation of:

5 cultures per plate in 5 ml LB medium + 5µL Amp.

(--> 5 cultures)

Further tasks:

  • Miniprep


Antibody

2012-10-12

cell culture


Investigator:Kerstin

Topic: cell-culture

  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa


Topic: planning new primer for integration of new RAGE-transmembrane domain and RAGE-signalpeptide

Investigator: Sascha

Materials and Methods: Geneious



Topic: Primer design and ordering for integration of RAGE-transmembrane domain into scFVconstruct and nanobody-geneart construct

Investigator: Sascha

Materials and Methods: Geneious

Results:

  • scFv:startprimer-fw
    • GCCTCTAGAGCTAGCATGGCAGC
  • rvp:scfv+overhang to TEV/TMD
    • CGCCCAAGATTCCCAGGGCCAGGGCGAGGGTGCCGCTTCCGCCGCCACCGCTTCCCCCTTGAAAATATAAATTCTCTCCAGATCCCCGTTT

GATCTCCAGTTCTGTCC

  • fwp:nterm. of yfp to TMD
    • CCCTGGGAATCTTGGGCGGCCTGGGGACCGCTGCCCTCTTGATCGGCGTGATCCTGTGGCAGAGAAGGTCTGGAGTGAGCAAGGGCGAG

GAGC

  • scFv:endprimer-rv
    • GAGCTGCAGCGGCCG
  • rage:startprimer-fw_nano/Fc
    • CTTGAATTCGCGGCCG
  • rage-rv:Fc to rageTMD
    • CGCCCAAGATTCCCAGGGCCAGGGCGAGGGTGCCGCTTCCTAATAACTTCGTATAATGTATGCTATACGAAGTTATCCC
  • rage-fwp:mcherry/rageTMD
    • CCCTGGGAATCTTGGGCGGCCTGGGGACCGCTGCCCTCTTGATCGGCGTGATCCTGTGGCAGAGAAGGGGCTCCATGGTGTCCAAGG
  • rage:endprimer in mcherry/loxp
    • AAGTCACTGCAGCGGCC


2012-10-15

cell culture


Investigator:Kerstin

Topic: cell-culture

  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa


2012-10-17

cell culture


Investigator:Kerstin

Topic: cell-culture

  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa
  • passaging of stably transfected Clones 4.1, 4.2, 4.3, 4,4, 29.1, 29.2, 29.3 with 550µg/ml Hygromycin

2012-10-19

cell culture


Investigator:Stefan/Kerstin

Topic: cell-culture

  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa


PCR: amplification of EYFP and mcherry with overhang of new RAGE-TMD

Investigators: Sascha
Materials:

  • Template: EYFP_Bba_E0030 and nano body-geneart-construct
  • Phusion-polymerase
  • 10x Phusion buffer HF
  • dNTPs (10mM)
  • eYFP: fwp:nterm. of yfp to TMD; primerVI: c-terminus of eyfp w
  • mcherry: rage-fwp:mcherry/rageTMD; rage:endprimer in mcherry/loxp
  • Thermocycler

Methods: 2x master mix of each: eYFP and mcherry

reagent volume [µL]
10x Phusion HF buffer 20
dNTPs 2
fwp:nterm. of yfp to TMD; rage-fwp:mcherry/rageTMD 5
primerVI: c-terminus of eyfp w; rage:endprimer in mcherry/loxp 5
template EYFP (10ng/µl); template nanobody-geneart-construct (10ng/µl) 2
Phusion Polymerase 1,0
water 66


Program

step Temperature [°C] duration [s] cycles
initial denaturation 98 30 1
denaturation 98 8 30
annealing gradient: 64,7°C/71°C for eYFP; 62,0°C/66,1°C for nanobody-geneart-construct 10 30
elongation 72 15 30
final elongation 72 600 1
cooling 8 ∞ 1

Topic: preparative gelelectrophoresis of amplified EYFP and mcherry with RAGE-TMD and RAGE-signalpeptide overhangs

Investigator: Sascha
Materials:

  • agarose
  • 1xTAE-buffer
  • 10xFD Green Buffer

Method:

  • 1% agarosegel, 55ml
  • 120V

Results:

  • amplified eYFP and mcherry showed sufficient bp-size after PCR

Further Tasks:

  • gel extraction and concentration measurement
  • amplification of scFv-fragment and nanobody/Fc


gel extraction of amplified eYFP and mcherry out of 1% agarosegel

Investigators:Sascha
Results:
[eYFP] =
[mcherry] =
Further Taks:

  • extension PCR of scFv and nanobody



2012-09-20

PCR: amplification of nanobody/Fc with overhang of new RAGE-TMD

Investigators: Sascha
Materials:

  • Template: nanobody-geneart-construct
  • Phusion-polymerase
  • 10x Phusion buffer GC
  • dNTPs (10mM)
  • nanobody-geneart-construct: rage:startprimer-fw_nano/Fc; rage-rv:Fc to rageTMD
  • Thermocycler

Methods: 2x master mix of each: eYFP and mcherry

reagent volume [µL]
10x Phusion BC buffer 20
dNTPs 2
rage:startprimer-fw_nano/Fc 5
rage-rv:Fc to rageTMD 5
template nanobody-geneart-construct (10ng/µl) 6
Phusion Polymerase 1,0
water 92


Program

step Temperature [°C] duration [s] cycles
initial denaturation 98 30 1
denaturation 98 8 30
annealing 520°C/62°C/65,5°C 10 30
elongation 72 15 30
final elongation 72 600 1
cooling 8 ∞ 1

Topic: preparative gelelectrophoresis of amplified nanobody/Fc with RAGE-TMD overhangs

Investigator: Sascha
Materials:

  • agarose
  • 1xTAE-buffer
  • 10xFD Green Buffer

Method:

  • 1% agarosegel, 55ml
  • 120V

Results:

  • amplified nanobody/Fc showed sufficient bp-size @ 1252bp

Further Tasks:

  • gel extraction and concentrations measurement

gel extraction of amplified eYFP and mcherry out of 1% agarosegel

Investigators:Sascha
Results: [nanobody/FC] = 2,5ng/µl</b> Further Taks:

  • extension PCR of scFv and nanobody
  • assembly-PCR of nanobody/Fc with mherry via RAGE-transmembrane domain



PCR: assembly-PCR of nanobody/Fc with mcherry over RAGE-TMD

Investigators: Sascha
Materials:

  • Template: nanobody/FC and mcherry with TMD-overhangs
  • Phusion-polymerase
  • 10x Phusion buffer GC
  • dNTPs (10mM)
  • Thermocycler

Methods: 2x master mix of each: eYFP and mcherry

reagent volume [µL]
10x Phusion BC buffer 20
dNTPs 2
rage:startprimer-fw_nano/Fc was added after 15 assembling cycles 5
rage:endprimer in mcherry/loxp was added after 15 assembling cycles 5
templates: nanobody/FC with TMD-overhangs ; mcherry with TMD-overhangs (10ng/µl) 2µl of mcherry and 8µl of nanobody/Fc
Phusion Polymerase 1,0
water 57


Program

step Temperature [°C] duration [s] cycles
initial denaturation 98 30 15
denaturation 98 10 15
annealing 60°C/70°C 12 15
elongation 72 38 15
initial denaturation 98 30 15
denaturation 98 10 15
annealing 60°C/70°C 12 15
elongation 72 38 15
final elongation 72 600 1
cooling 8 ∞ 1

Topic: analytical gelelectrophoresis of amplified nanobody/Fc with RAGE-TMD overhangs

Investigator: Sascha
Materials:

  • agarose
  • 1xTAE-buffer
  • 10xFD Green Buffer

Method:

  • 1% agarosegel, 55ml
  • 120V

Results:

  • assembled nanobody/Fc-RAGE-TMD-mcherry showed sufficient bp-size: 2,1kb

Further Tasks:

  • PCR-Clean up of 60°C-assembling PCR-mix
  • amplification of assembeled nanobody/Fc-RAGE-TMD-mcherry


PCR-Clean up of preparative gel electrophoresis of assembled nanobody/Fc-RAGE-TMD-mcherry and concentration measurement

Investigator: Sascha
Materials:

  • NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel)

Methods:

  • according to CleanUp-protocol

Results: [assembled nanobody/Fc-RAGE-TMD-mcherry ] =
Further Taks:

  • preparative gel electrophoresis of assembled nanobody/Fc-RAGE-TMD-mcherry




2012-10-22

cell culture


Investigator:Kerstin

Topic: cell-culture

  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa
  • transfection of stably transfected clone 29.1 with Cre Recombinase
  • seeding of HT1080 in Ibidi Dish for infection with virus

2012-10-23

cell culture


Investigator:Stefan

Topic: cell-culture

  • seeding of CHO and HeLa in Ibidi Dishes for transfection with new Nanobody RAGE construct
  • infection with Virus (CFP on surface and YFP as GOI, AAV with Sortase motif)

2012-10-24

cell culture


Investigator:Stefan/Kerstin

Topic: cell-culture

  • Transfection of new Nanobody RAGE construct in CHO and HeLa
  • seeding of CHO and HeLa in Ibidi Dishes for transfection with new scFv RAGE construct
  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa

2012-10-25

cell culture


Investigator:Stefan/Kerstin

Topic: cell-culture

  • transfection of new scFv RAGE construct
  • transfection of TAL-AID from cooperation with Freiburg iGEM Team in CHO cells (co-transfection with clone 4)
  • purification of Nanobody from supernatant of Cre recombinase transfected cells with magnetic beads
  • Western Blot of purified Nanobody

Virus

XXX

XXX

Investigator: XXX

Aim: XXX

Materials:

XXX

Method:

XXX

Results:

XXX

Further tasks

XXX

Retrieved from "http://2012.igem.org/Team:Potsdam_Bioware/Lab/Labjournal/October"