Team:ZJU-China/project s1 2.htm

From 2012.igem.org

Revision as of 13:24, 24 October 2012

Design

We thought to add another aptamer onto the scaffold and construct an interaction between it and the MS2 aptamer, such that it could disrupt the binding of MS2 protein and the MS2 aptamer.

We thought about the well-known theophylline aptamer. The aptamer is a single RNA hairpin that binds theophylline in an inner loop region with high affinity. Previous studies have shown mutations in the loop region were tolerated as long as the loop structure was preserved. This allowed us to mutate the loop of the theophylline aptamer to create an interaction between the theophylline aptamer and the MS2 aptamer. The interaction inhibits the binding function of MS2 aptamer in the absence of theophylline. However, when theophylline is added, the fold of the loop is changed and thus the interaction will disappear, leading to the binding of MS2 aptamer and corresponding protein.

Fig.1 The control mechanism of the theophylline aptamer.

Since the reformed scaffolds consist of three aptamers, just like clovers, we call them 'clover'.

Fig.2 Our designed scaffolds are named 'clover'.

Three versions of 'clover' were designed.

Fig.3 Three versions of clovers. Version one and version two have adjacent MS2 and theophylline aptamer, while vesion three has separated ones. Version one has an interaction between the loop of theophylline aptamer and the loop of MS2 aptamer, while version two and version three have an interaction between the loop of theophylline aptamer and the stem of MS2 aptamer.

Original scaffold D0:

The base sequence of original scaffold D0:

GGGAGGACTCCCACAGTCACTGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGTTCGCACTTCTCTCGTATTCGATTCCC

Fig.4 The secondary (left) and the tertiary(right) structure of D0.

Clover version 1

The interaction is between the loop of theophylline aptamer and the loop of the MS2 aptamer.

And the theophylline aptamer is just beside the MS2 apatamer.

The base sequence of clover version 1:

GGGGUCCUCGGUGAUACCAGCAUagugacuAUGCCCUUGGCAGCACCGAGGAGGACTCCCACagtcactGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGTTCGCACTTCTCTCGTATTCGCCCC

Fig.5 The secondary (left) and the tertiary (right) structure of clover version 1.

Clover version 2

The interaction is between the loop of the theophylline aptamer and the stem of the MS2 apatamer. And the theophylline aptamer is just beside the MS2 apatamer.

The base sequence of clover version 2:

GGGGUCCUCGGUGAUACCAGCugacuguggCCCUUGGCAGCACCGAGGAGGACTCccacagtcaCTGGGGAGTCCTCGAATACGAGCTGGGCACAGAAGATATGGCTTCGTGCCCAGGAAGTGTTCGCACTTCTCTCGTATTCGCCCC

Fig.6 The secondary (left) and the tertiary (right) structure of clover version 2.

Clover version 3

The interaction is between the loop of the theophylline aptamer and the stem of the MS2 apatamer. Although the theophylline and the MS2 apatamer is separated by the PP7 aptamer in the base sequence, they are closed according to the three- dimensional structure prediction.

The base sequence of clover version 3:

GGGGUCCUCGGUGAUACCAGCugacuguggCCCUUGGCAGCACCGAGGACUGGGCACAGAAGAUAUGGCUUCGUGCCCAGUCGAAUACGAGGAAGUGUUCGCACUUCACCUGGGACUCccacagucaCUGGGGAGUCCCAGGUUCUCGUAUUCGCCCC

Fig.7 The secondary (left) and the tertiary (right) structure of clover version 3. Although the theophyline and MS2 aptamers are separated as the secondary structure showed, in the tertiary structure, the theophyline aptamer obviously fold towards the MS2 aptamer.

Fig.8 A contrast between clover version 3 and a scaffold including a theophyline aptamer without a complementary site with MS2 aptamer. It can be easily noticed that in clover version 3, the theophyline aptamer obviously fold towards the MS2 aptamer, which indicates the interaction between the complementary sites in the theophyline and MS2 aptamers. In contrast, the scaffold without complementary sites in the two aptamers shows no approach of the theophyline aptamer to the MS2 aptamer.

References:

1. Thodey, K. & Smolke, C.D. Bringing It Together with RNA. Science 333, 412-413 (2011).

2. Delebecque, C.J., Lindner, A.B., Silver, P.A. & Aldaye, F.A. Organization of Intracellular Reactions with Rationally Designed RNA Assemblies. Science 333, 470-474 (2011).

3. Qi, L., Lucks, J.B., Liu, C.C., Mutalik, V.K. & Arkin, A.P. Engineering naturally occurring trans-acting non-coding RNAs to sense molecular signals. Nucleic Acids Res 40, 5775-5786 (2012).