Team:Caltech/Notebook/Proteorhodopsin

From 2012.igem.org

(Difference between revisions)
Line 25: Line 25:
<br>
<br>
Daisy - made 50 uL aliquots of electrocompetent E. coli cells
Daisy - made 50 uL aliquots of electrocompetent E. coli cells
 +
<br>
 +
Edward -Ran PCR on AMP resistant back bone with annealing temperatures from 61-65 degrees Celcius
<br>
<br>
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
Line 36: Line 38:
<br>
<br>
Julia - K572005 sequence is completely different from the one listed in the Parts Registry, but the sequence matches with a different part (contamination)
Julia - K572005 sequence is completely different from the one listed in the Parts Registry, but the sequence matches with a different part (contamination)
 +
 +
Edward- Ran low melting temp gel with the AMP resistant backbone
<br>
<br>
-
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
 
-
<br>
 
-
 
-
Edward - Ran low melting temp gel with the AMP resistant backbone
 
-
 
Samples should be 2.2kb long
Samples should be 2.2kb long
 +
<br>
  BB should be shorter than insert (if they are not they need to be relabled) ---- was correct
  BB should be shorter than insert (if they are not they need to be relabled) ---- was correct
-
 
+
<br>
Sample (25 microL DNA + 6 microL Dye)
Sample (25 microL DNA + 6 microL Dye)
 +
<br>
5 microL ladder  
5 microL ladder  
 +
<br>
Purified (2 microL DNA + .5 microL Dye)
Purified (2 microL DNA + .5 microL Dye)
-
 
+
<br>
-
61C 62C 63C 64C 65C Ladder BB insert
+
61C 62C 63C 64C 65C Ladder BB insert
-
+
<br>
-
 
+
1% low melting temp gel
1% low melting temp gel
-
 
+
<br>
-
Will be followed by a gel extraction
+
followed by a gel extraction
-
 
+
<br>
Resulted in 2ng/microL and two 5ng/microL samples ---- not good enough to do the Gibson reaction
Resulted in 2ng/microL and two 5ng/microL samples ---- not good enough to do the Gibson reaction
 +
<br>
Next will order new primers to try and have more efficient copying of backbone with AMP resistance
Next will order new primers to try and have more efficient copying of backbone with AMP resistance
-
 
+
<br>
Gibson-bb-f
Gibson-bb-f
Gibson suffix region 5' - TACTAGTAAACAGGGTTCTCGAGC - 3'              Melting temp 55.7
Gibson suffix region 5' - TACTAGTAAACAGGGTTCTCGAGC - 3'              Melting temp 55.7
-
 
+
<br>
Gibson-bb-r
Gibson-bb-r
RC from Gibson prefix region 5' - CTCTAGAAAGATCTCCGCAGCA - 3'    Melting temp 54.8
RC from Gibson prefix region 5' - CTCTAGAAAGATCTCCGCAGCA - 3'    Melting temp 54.8
 +
<br>
 +
<br>
 +
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
 +
<br>
<br>
<br>
Line 71: Line 77:
<br>
<br>
Daisy - began PCA protocol: ran PCR to make the preassembly mix, IPIPE, and VPIPE constructs; ran gel electrophoresis on the PCR products to check that the PCRs worked
Daisy - began PCA protocol: ran PCR to make the preassembly mix, IPIPE, and VPIPE constructs; ran gel electrophoresis on the PCR products to check that the PCRs worked
 +
<br>
 +
Edward - Ran PCR with new primers to make backbone
<br>
<br>
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
<br>
<br>
-
Edward - Run PCR with new primers to make backbone
 
-
 
-
Gel to check PCR
 
-
5 microL ladder
 
-
2 microL sample + .5microL dye
 
-
Ladder Sample
 
-
 
-
 
-
Mix with insert from old reaction in Gibson
 
-
 
<br>
<br>
Line 124: Line 122:
<font size="+2"><a name="7_2_12">7/2/12</a></font>
<font size="+2"><a name="7_2_12">7/2/12</a></font>
<br>
<br>
 +
<br>
 +
Edward-
 +
Gel extraction for the bb on both
 +
Products from extraction mixed
<br>
<br>
Daisy - sent miniprep samples in for sequencing
Daisy - sent miniprep samples in for sequencing
Line 133: Line 135:
<font size="+2"><a name="7_3_12">7/3/12</a></font>
<font size="+2"><a name="7_3_12">7/3/12</a></font>
<br>
<br>
 +
<br>
 +
Edward - transformation with product from 7/2 ligated to pSB1A3
<br>
<br>
Daisy - sequencing results returned: IPIPE+VPIPE construct is incorrect; accidentally mixed the CPEC+VPIPE sequences (will redo)
Daisy - sequencing results returned: IPIPE+VPIPE construct is incorrect; accidentally mixed the CPEC+VPIPE sequences (will redo)
Line 142: Line 146:
<font size="+2"><a name="7_4_12">7/4/12</a></font>
<font size="+2"><a name="7_4_12">7/4/12</a></font>
<br>
<br>
 +
<br>
 +
Edward-PCR with Phusion on colonies
<br>
<br>
Daisy - regrew 3 CPEC+VPIPE overnight cultures and made glycerol stocks
Daisy - regrew 3 CPEC+VPIPE overnight cultures and made glycerol stocks
Line 161: Line 167:
<br>
<br>
<br>
<br>
-
Daisy -  
+
Edward - sequencing unsuccessful, ordered new primers
 +
<br>
 +
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
 +
<br>
 +
<br>
 +
 
 +
<font size="+2"><a name="7_10_12">7/10/12</a></font>
 +
<br>
 +
<br>
 +
Edward - ran pcr with new primers 53C annealing temp (unsuccessful)
 +
<br>
 +
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
 +
<br>
 +
<br>
 +
 
 +
<font size="+2"><a name="7_15_12">7/15/12</a></font>
 +
<br>
 +
<br>
 +
Edward - reran pcr with primers at 60C - successful
 +
<br>
 +
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
 +
<br>
 +
<br>
 +
 
 +
<font size="+2"><a name="7_20_12">7/20/12</a></font>
 +
<br>
 +
<br>
 +
Edward - ligated and transformed using proteorhodopsin without retinal pathway
 +
<br>
 +
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
 +
<br>
 +
<br>
 +
 
 +
<font size="+2"><a name="7_21_12">7/21/12</a></font>
 +
<br>
 +
<br>
 +
Edward - colony pcr on cells
 +
<br>
 +
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
 +
<br>
 +
<br>
 +
 
 +
<font size="+2"><a name="7_25_12">7/25/12</a></font>
 +
<br>
 +
<br>
 +
Edward - received successful results from sequencing
<br>
<br>
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
<br>
<br>
<br>
<br>

Revision as of 06:34, 3 October 2012



Proteorhodopsin Notebook


6/22/12

Julia - transformed K572005 (proteorhodopsin gene from the Parts Registry)
Daisy - ordered primers for Polymerase Cycling Assembly (PCA) reaction to create a proteorhodopsin optimized for E. coli
Back to the top

6/25/12

Chenxi - Transformed pKD46 into wild type MG1655 E.coli strain using electroporation; designed primers to PCR pKD4 Kan resistance gene for lambda red knockout of nuo and ndh genes (NADH dehydrogenases)
Julia - miniprepped K572005 and sent it in for sequencing
Daisy - made 50 uL aliquots of electrocompetent E. coli cells
Edward -Ran PCR on AMP resistant back bone with annealing temperatures from 61-65 degrees Celcius
Back to the top

6/26/12

Chenxi - PCR pKD4 kan for nuo and ndh; ran gel
Julia - K572005 sequence is completely different from the one listed in the Parts Registry, but the sequence matches with a different part (contamination) Edward- Ran low melting temp gel with the AMP resistant backbone
Samples should be 2.2kb long
BB should be shorter than insert (if they are not they need to be relabled) ---- was correct
Sample (25 microL DNA + 6 microL Dye)
5 microL ladder
Purified (2 microL DNA + .5 microL Dye)
61C 62C 63C 64C 65C Ladder BB insert
1% low melting temp gel
followed by a gel extraction
Resulted in 2ng/microL and two 5ng/microL samples ---- not good enough to do the Gibson reaction
Next will order new primers to try and have more efficient copying of backbone with AMP resistance
Gibson-bb-f Gibson suffix region 5' - TACTAGTAAACAGGGTTCTCGAGC - 3' Melting temp 55.7
Gibson-bb-r RC from Gibson prefix region 5' - CTCTAGAAAGATCTCCGCAGCA - 3' Melting temp 54.8

Back to the top

6/27/12

Daisy - began PCA protocol: ran PCR to make the preassembly mix, IPIPE, and VPIPE constructs; ran gel electrophoresis on the PCR products to check that the PCRs worked
Edward - Ran PCR with new primers to make backbone
Back to the top

6/28/12

Daisy - continued PCA protocol: ran PCR to make the CPEC and IPIPE (from existing IPIPE, not preassembly mix) constructs; transformed electrocompetent cells with CPEC+VPIPE (positive control; no change the protocol), CPEC-VPIPE (negative control; replaced VPIPE with sterile water), IPIPE+VPIPE (alternate positive control), and VPIPE (alternate negative control) and plated them
Back to the top

6/29/12

Daisy - plate results: VPIPE and CPEC-VPIPE negative controls had no colonies, IPIPE+VPIPE had only one colony, CPEC+VPIPE had many colonies; started overnight cultures of IPIPE+VPIPE and CPEC+VPIPE constructs of proteorhodopsin
Back to the top

6/30/12

Daisy - miniprepped the overnight cultures and measured their concentrations
Back to the top

7/1/12


Back to the top

7/2/12

Edward- Gel extraction for the bb on both Products from extraction mixed
Daisy - sent miniprep samples in for sequencing
Back to the top

7/3/12

Edward - transformation with product from 7/2 ligated to pSB1A3
Daisy - sequencing results returned: IPIPE+VPIPE construct is incorrect; accidentally mixed the CPEC+VPIPE sequences (will redo)
Back to the top

7/4/12

Edward-PCR with Phusion on colonies
Daisy - regrew 3 CPEC+VPIPE overnight cultures and made glycerol stocks
Back to the top

7/5/12

Daisy - miniprepped the CPEC+VPIPE cultures, measured their concentrations, and sent them in for sequencing
Back to the top

7/6/12

Edward - sequencing unsuccessful, ordered new primers
Back to the top

7/10/12

Edward - ran pcr with new primers 53C annealing temp (unsuccessful)
Back to the top

7/15/12

Edward - reran pcr with primers at 60C - successful
Back to the top

7/20/12

Edward - ligated and transformed using proteorhodopsin without retinal pathway
Back to the top

7/21/12

Edward - colony pcr on cells
Back to the top

7/25/12

Edward - received successful results from sequencing
Back to the top

Retrieved from "http://2012.igem.org/Team:Caltech/Notebook/Proteorhodopsin"