Team:Caltech/Notebook/Proteorhodopsin

From 2012.igem.org

(Difference between revisions)
Line 39: Line 39:
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
<br>
<br>
 +
 +
Edward - Ran low melting temp gel with the AMP resistant backbone
 +
 +
Samples should be 2.2kb long
 +
BB should be shorter than insert (if they are not they need to be relabled) ---- was correct
 +
 +
Sample (25 microL DNA + 6 microL Dye)
 +
5 microL ladder
 +
Purified (2 microL DNA + .5 microL Dye)
 +
 +
61C 62C 63C 64C 65C Ladder BB insert
 +
 +
 +
1% low melting temp gel
 +
 +
Will be followed by a gel extraction
 +
 +
Resulted in 2ng/microL and two 5ng/microL samples ---- not good enough to do the Gibson reaction
 +
Next will order new primers to try and have more efficient copying of backbone with AMP resistance
 +
 +
Gibson-bb-f
 +
Gibson suffix region 5' - TACTAGTAAACAGGGTTCTCGAGC - 3'              Melting temp 55.7
 +
 +
Gibson-bb-r
 +
RC from Gibson prefix region 5' - CTCTAGAAAGATCTCCGCAGCA - 3'    Melting temp 54.8
 +
<br>
<br>
Line 48: Line 74:
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
<a a style="float:right;" href="https://2012.igem.org/Team:Caltech/Notebook/Degradation#Calendar">Back to the top</a>
<br>
<br>
 +
Edward - Run PCR with new primers to make backbone
 +
 +
Gel to check PCR
 +
5 microL ladder
 +
2 microL sample + .5microL dye
 +
Ladder Sample
 +
 +
 +
Mix with insert from old reaction in Gibson
 +
<br>
<br>

Revision as of 01:00, 3 October 2012



Proteorhodopsin Notebook


6/22/12

Julia - transformed K572005 (proteorhodopsin gene from the Parts Registry)
Daisy - ordered primers for Polymerase Cycling Assembly (PCA) reaction to create a proteorhodopsin optimized for E. coli
Back to the top

6/25/12

Chenxi - Transformed pKD46 into wild type MG1655 E.coli strain using electroporation; designed primers to PCR pKD4 Kan resistance gene for lambda red knockout of nuo and ndh genes (NADH dehydrogenases)
Julia - miniprepped K572005 and sent it in for sequencing
Daisy - made 50 uL aliquots of electrocompetent E. coli cells
Back to the top

6/26/12

Chenxi - PCR pKD4 kan for nuo and ndh; ran gel
Julia - K572005 sequence is completely different from the one listed in the Parts Registry, but the sequence matches with a different part (contamination)
Back to the top
Edward - Ran low melting temp gel with the AMP resistant backbone Samples should be 2.2kb long BB should be shorter than insert (if they are not they need to be relabled) ---- was correct Sample (25 microL DNA + 6 microL Dye) 5 microL ladder Purified (2 microL DNA + .5 microL Dye) 61C 62C 63C 64C 65C Ladder BB insert 1% low melting temp gel Will be followed by a gel extraction Resulted in 2ng/microL and two 5ng/microL samples ---- not good enough to do the Gibson reaction Next will order new primers to try and have more efficient copying of backbone with AMP resistance Gibson-bb-f Gibson suffix region 5' - TACTAGTAAACAGGGTTCTCGAGC - 3' Melting temp 55.7 Gibson-bb-r RC from Gibson prefix region 5' - CTCTAGAAAGATCTCCGCAGCA - 3' Melting temp 54.8
6/27/12

Daisy - began PCA protocol: ran PCR to make the preassembly mix, IPIPE, and VPIPE constructs; ran gel electrophoresis on the PCR products to check that the PCRs worked
Back to the top
Edward - Run PCR with new primers to make backbone Gel to check PCR 5 microL ladder 2 microL sample + .5microL dye Ladder Sample Mix with insert from old reaction in Gibson
6/28/12

Daisy - continued PCA protocol: ran PCR to make the CPEC and IPIPE (from existing IPIPE, not preassembly mix) constructs; transformed electrocompetent cells with CPEC+VPIPE (positive control; no change the protocol), CPEC-VPIPE (negative control; replaced VPIPE with sterile water), IPIPE+VPIPE (alternate positive control), and VPIPE (alternate negative control) and plated them
Back to the top

6/29/12

Daisy - plate results: VPIPE and CPEC-VPIPE negative controls had no colonies, IPIPE+VPIPE had only one colony, CPEC+VPIPE had many colonies; started overnight cultures of IPIPE+VPIPE and CPEC+VPIPE constructs of proteorhodopsin
Back to the top

6/30/12

Daisy - miniprepped the overnight cultures and measured their concentrations
Back to the top

7/1/12


Back to the top

7/2/12

Daisy - sent miniprep samples in for sequencing
Back to the top

7/3/12

Daisy - sequencing results returned: IPIPE+VPIPE construct is incorrect; accidentally mixed the CPEC+VPIPE sequences (will redo)
Back to the top

7/4/12

Daisy - regrew 3 CPEC+VPIPE overnight cultures and made glycerol stocks
Back to the top

7/5/12

Daisy - miniprepped the CPEC+VPIPE cultures, measured their concentrations, and sent them in for sequencing
Back to the top

7/6/12

Daisy -
Back to the top

Retrieved from "http://2012.igem.org/Team:Caltech/Notebook/Proteorhodopsin"