Team:Wisconsin-Madison/SDF

• Team

  • Team Members
  • Advisors
  • Sponsors

• Projects

  • Engineering Limonene Production in E.coli
  • Translational Coupling Cassette (TCC)

• Parts

  • Translational Coupling Cassette
  • Negative TCC Control
  • Positive TCC Control
  • Codon-optomized LIMS1

• Modeling

• Protocol

• Safety

• Human practice

Translational Coupling – an explanation

Why are we using translational coupling?

In the beginning of the summer our team’s goal was to produce a compound called limonene. All of our strains failed to produce limonene, and we were unsure of the cause. One hypothesis was that there was a problem in the translation of limonene synthase. To test this hypothesis, we used a translational coupling cassette to determine if limonene synthase was even being translated, or if the problem was elsewhere in the cell.

How the translational coupling cassette works

The translational coupling cassette is designed to establish if a target gene is being translated or not. This is achieved by the use of an mRNA hairpin located downstream of the target gene. Embedded in this mRNA hairpin is the stop codon and a His-tag for the target gene, as well as a ribosome binding site for a response gene. In our case this response is red fluorescent protein. This hairpin, when intact, blocks the translation of the RFP. This engineered hairpin is just weak enough to be broken by a ribosome’s helicase activity. Finally, because the stop codon is taken out of the target gene and located downstream of the His-tag, complete translation of the target gene will break the hairpin. This frees the RBS and allow another ribosome to translate the response gene. Using this system, it is possible to determine if a target gene is being translated. Upon translation, there should be a detectable amount of RFP.

Assays for the translational coupling cassette

There were two main assays done to characterize the fluorescence produced by the translational coupling cassette.The first was done by using a Typhoon Trio. This plate reader excites the RFP, and takes a reading while scanning across a petri dish. The selective media plates were made using exactly 20mL of agar solution. This normalizes the fluorescence readings taken by the reader.

The J23102+E0040+TCC was used as our “positive control” for the translational coupling cassette. We used a green fluorescent protein as our positive control because it was necessary to see if we were getting translation of our target gene without the use of the coupling cassette. However, there was one drawback to using the GFP; when testing for red fluorescence in the Typhoon reader, we detected fluorescence given off by just GFP (J23100 + E0040). Thus, some of the red fluorescence given off by our positive control construct was due to the GFP located upstream of the hairpin and RFP. This required us to normalize the pixel data we took from the images of our positive control.

The codon optimized limonene synthase with a stop codon was used as our negative control for the cassette. If translation is stopped halfway through the target gene, the helicase on the ribosome will not break the hairpin and RFP will not be generated.

From this data, we can determine two things. First, our positive control is producing RFP. Second, the codon optimized limonene synthase seems to be translating, and the non-codon optimized seems to not. The fluorescence produced by the codon optimized construct is much lower than our positive control, but we cannot explain this. Many different factors could cause this to happen, and if we knew why we might be able to explain why we were not able to produce limonene.

The second assay used to quantify fluorescence was done by using a 96-well plate reader. Optical densities and fluorescence were taken over a 24 period, and used to determine if our target gene was being translated. The same strains used in the Typhoon were tested using this method. Fluorescence was divided by optical density because all of the strains did not grow at the same rate. This allowed the normalization of fluorescence, and thus the quantification and comparison of it between strains.

This plot backs up the conclusions drawn from the Typhoon images. The translational coupling cassette produces RFP. The codon optimized limonene synthase seems to be translating more efficiently than the non-codon optimized version. In fact, the limonene synthase may not be translating at all. However, we still have not been able to detect any amount of limonene in our GC/MS assays. We were able to make amorphadiene, so we know that the mevalonate pathway works correctly up until the GPP synthase gene. From this point onwards, all we know is that the limonene synthase (now codon optimized) is being translated. From here, we would require more time and materials to fully troubleshoot why no limonene is being produced. We do have a few hypotheses, based on observations and information about this pathway. First, limonene synthase may be forming an inclusion body in the cell. Second, it is a possibility that GPP is not being produced, and we would require standards (which are quite expensive) and a new protocol to detect for it on the GC/MS. If we had these standards, we would also be able to try to purify limonene synthase using our TCC his-tagged version. This purified enzyme could then be doped with GPP, and hopefully create limonene. If this was the case, we would know that GPP is not being produced, or something is happening to the limonene synthase between translation and the active synthesis of limonene. Third, many of the molecules and enzymes in the mevalonate pathway can be toxic to Escherichia coli cells at high levels, including limonene.

How to clone using the Translational Coupling Cassette

In order to use the translational coupling cassette, the target gene must be PCR amplified using BioFusion primers. If the gene is amplified using standard BioBrick primers, an open reading frame shift will occur, a premature stop codon will be formed, and the hairpin may not break. In addition to using BioFusion primers, the stop codon must also be taken out of the target gene being amplified for the same reason. If a stop codon prematurely stops translation, then the hairpin may not break and the response gene (RFP) will not be translated. As an example:

We cloned in the E0040 gene (GFP) into the TCC as the target gene. The first and last 30 base pairs of the E0840 ribosome binding site plus open reading frame (GFP) are as follows:

attaaagaggagaaatactagatgcgtaaa

catggcatggatgaactatacaaataataa

The forward and reverse primers (respectively) would then have to be:

5’                                                                                                       3’

CCCCGAATTCGCGGCCGCTTCTAGAattaaagaggagaaatactagatgcg

5’                                                          3’

CCGCTACTAGTtttgtatagttcatccatgccatg

This PCR fragment would then have to be cut with EcoR1 and Spe1, while the translational coupling cassette should be cut with EcoR1 and Xba1.

Reference: