Team:RHIT/Parts
From 2012.igem.org
Line 54: | Line 54: | ||
</div> | </div> | ||
<div class="rhit-genericBox"> | <div class="rhit-genericBox"> | ||
- | <p>The RHIT iGEM team’s BioBrick uses several pre-existing parts; a <a href="http://partsregistry.org/wiki/index.php/Part:BBa_K592100">fluorescent domain</a>, the <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J176013">VP64 activator domain</a>, and the combination part of the <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K165018">nuclear localization sequence and terminator</a>. The remaining sequences used were the <a href="http://www.yeastgenome.org/cgi-bin/getSeq?map=amap&chr=3&beg=71603&end=71803&rev="Ste12 promoter containing Fus1 binding sites</a>, <a href="http://mic.sgmjournals.org/content/150/11/3783.full">LexA binding sites</a>, and the <a href="http://heptamer.tamu.edu/cgi-bin/gb2/gbrowse_details/BW2952?ref=NC_012759;start=4193983;end=4194591;name=lexA;class=Sequence;feature_id=7826;db_id=main%3Adatabase">LexA binding domain</a>.</p><br /><br /> | + | <p>The RHIT iGEM team’s BioBrick uses several pre-existing parts; a <a href="http://partsregistry.org/wiki/index.php/Part:BBa_K592100">fluorescent domain</a>, the <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J176013">VP64 activator domain</a>, and the combination part of the <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K165018">nuclear localization sequence and terminator</a>. The remaining sequences used were the <a href="http://www.yeastgenome.org/cgi-bin/getSeq?map=amap&chr=3&beg=71603&end=71803&rev=">Ste12 promoter containing Fus1 binding sites</a>, <a href="http://mic.sgmjournals.org/content/150/11/3783.full">LexA binding sites</a>, and the <a href="http://heptamer.tamu.edu/cgi-bin/gb2/gbrowse_details/BW2952?ref=NC_012759;start=4193983;end=4194591;name=lexA;class=Sequence;feature_id=7826;db_id=main%3Adatabase">LexA binding domain</a>.</p><br /><br /> |
<p>The Fus1 binding sequences appear at 188, 176, and 160 base pairs before the start codon; they are 8, 6, and 7 base pairs long, respectively. Several LexA binding sites were added to the Ste12 promoter sequence at 140, 103, and 90 base pairs before the start codon; they are each nine base pairs long. This was done to allow the promoter to respond to two different signals, the Fus1 transcription factor and the LexA/VP64 transcription factor. LexA is a commonly used DNA-binding domain. The VP64 domain is a viral activator protein; it does not bind to DNA, but if it is fused to something that does, it will recruit the transcriptional apparatus. When LexA is fused to the VP64 protein, they form a potent transcriptional activator.</p><br /><br /> | <p>The Fus1 binding sequences appear at 188, 176, and 160 base pairs before the start codon; they are 8, 6, and 7 base pairs long, respectively. Several LexA binding sites were added to the Ste12 promoter sequence at 140, 103, and 90 base pairs before the start codon; they are each nine base pairs long. This was done to allow the promoter to respond to two different signals, the Fus1 transcription factor and the LexA/VP64 transcription factor. LexA is a commonly used DNA-binding domain. The VP64 domain is a viral activator protein; it does not bind to DNA, but if it is fused to something that does, it will recruit the transcriptional apparatus. When LexA is fused to the VP64 protein, they form a potent transcriptional activator.</p><br /><br /> | ||
<p>Since the promoter sequence came from a pre-existing gene, there was no need to add a ribosome binding site or transcriptional start site. Therefore, following the Ste12 promoter was the blue fluorescent domain, followed by a short Gly-Ser linker (GGTTCTGGTTCTGGTTCTGGTTCTGGTTCTGGTTCT), another fluorescent domain, and then the linker again. This simply makes the heteroprotein easier to detect, as it will have more fluorescence. Following this was the LexA binding domain. Connecting the LexA binding domain to the VP64 activator domain was the following linker: GCTTCTCCAAAAAAAAAAAGAAAAGTTGGTAGAGCTCT. At the end of our sequence, after the VP64 activator domain, the combination nuclear localization sequence/terminator was added.</p><br /><br /> | <p>Since the promoter sequence came from a pre-existing gene, there was no need to add a ribosome binding site or transcriptional start site. Therefore, following the Ste12 promoter was the blue fluorescent domain, followed by a short Gly-Ser linker (GGTTCTGGTTCTGGTTCTGGTTCTGGTTCTGGTTCT), another fluorescent domain, and then the linker again. This simply makes the heteroprotein easier to detect, as it will have more fluorescence. Following this was the LexA binding domain. Connecting the LexA binding domain to the VP64 activator domain was the following linker: GCTTCTCCAAAAAAAAAAAGAAAAGTTGGTAGAGCTCT. At the end of our sequence, after the VP64 activator domain, the combination nuclear localization sequence/terminator was added.</p><br /><br /> |
Revision as of 03:43, 2 October 2012