Team:Carnegie Mellon/Bio-Submitted

From 2012.igem.org

(Difference between revisions)
Line 152: Line 152:
<h3 class="pre-experiment">Measured strength of the hybrid T7Lac promoters</h3>
<h3 class="pre-experiment">Measured strength of the hybrid T7Lac promoters</h3>
-
We have measured both RNA and protein expression levels of the designed T7Lac promoters using the engineered fluorogen-activated biosensors (see details in Methods). Using the model we developed in MATLAB, we fitted experimental results of both RNA and protein expression rates and calculated the following properties with respect to the wild-type promoter.
+
We have measured both RNA and protein expression levels of the designed T7Lac promoters using fluorogen-activated biosensors (see details in Methods & Results). These experimental results were analyzed using a mathematical model that we developed in MATLAB (see details in Model). Based on the analysis, we obtained the following properties of the new T7Lac promoters with respect to the wild-type T7Lac promoter.
<table border="1">
<table border="1">

Revision as of 00:38, 2 October 2012

Image:CMU_image6.jpeg




Submitted Parts

We have submitted three T7Lac promoter parts to the registry. The followings show the sequences of these constructs.
BBa_K613007: TAATACGACTCACTATAGGGAGAGGAATTGTGAGCGGATAACAA
(BBa_K921000) Mutant I: TAATGCGACTCACTATAGGACAATTGTGGGCGGACAACAATTCCAA
(BBa_K921001) Mutant II: TAATACGACTCACTACAGGGCGGAATTGTGAGCGGATAACAATTCCAA
(BBa_K921002) Mutant III: CAATCCGACTCACTAAAGAGAGAATTGTGAGCGGATAACAATTCCAA

Predicted strength of the hybrid T7Lac promoters

Expected promoter strength of the mutants (relative to BBa_K613007):
Mutant I: <100%
Mutant II: ~100%
Mutant III: ~50%

Expected LacI leaky expression of different mutants:
Mutant I: More than average
Mutant II: Average
Mutant III: Average

RBS used in construct is: CATATG AAGAAGGAGA TATACC

Measured strength of the hybrid T7Lac promoters

We have measured both RNA and protein expression levels of the designed T7Lac promoters using fluorogen-activated biosensors (see details in Methods & Results). These experimental results were analyzed using a mathematical model that we developed in MATLAB (see details in Model). Based on the analysis, we obtained the following properties of the new T7Lac promoters with respect to the wild-type T7Lac promoter.
Promoter Mutant I Mutant II Mutant III
Transcription Strength 97% 72% 127%
Translational Efficiency 6% 6% 94%
RNA degradation constant (assumed) 100% 100% 100%
Protein degradation constant (fit) 4% 6% 60%
Cheemeng:Need to comment on the results here.

Image:TartanFooter.jpeg