experiment

Do and enjoy it.

Index 1 Overview 2 Diary    2.1 Summary    2.2 Model    2.3 Assumptions    2.4 Solution    2.5 Evaluation    2.6 References 3 Confirmation Experiment    2.1 Summary    2.2 Model    2.3 Assumptions    2.4 Solution 3 Help

1 Overview

2 Diary

3 Confirmation Experiment

4 Protocols

1、LB Medium
Liquid: 10 g of tryptone,
5 g of yeast extract,
10 g of NaCl,
1 liter of distilled water
Solid: 10 g of tryptone,
5 g of yeast extract,
10 g of NaCl,
15 g of agar,
1 liter of distilled water
Semi-Solid：10 g of tryptone,
5 g of yeast extract,
10 g of NaCl,
7 g of agar,
1 liter of distilled water

2、Transforming DNA from Distribution Plates:
1.Thaw competent cells on ice.
2. Add 10 microliters of pure water to each well of DNA from plates, pipette up and down.
3. Transfer into storage tube.
4. Pipette 1-2 microliters of the DNA into the competent cell tubes.
5. Stir with pipette tip, gently flick tube.
6. Leave on ice for 30 minutes.
7. Heat Shock for 45 sec by using a water bath set to 42°C and then chill on ice for 2 min.
8. Pipette 500 micro Liters of S.O.C. (LB + glucose) into 14ml culture tubes; transfer the competent cells into these tubes and incubate in a 37 degree shaker for 0-60 minutes before plating.
9. For source plate DNA, plate 100 microliters.
3、Plasmids Miniprep
1. Inoculate 1-4 mL LB containing appropriate antibiotic with a fresh colony from a freshly streaked selective plate. Incubate at 37°C for 14-16 hours with vigorous shaking.
Note: Prolonged incubation (> 16 hours) is not recommended since the E.coli starts to lyse and the plasmid yields may be reduced. Note: Do not grow the culture directly from the glycerol stock. Note: This protocol is optimized for E. coli strain cultured in LB medium. When using TB or 2xYT medium, special care needs to be taken to ensure the cell density doesn’t exceed 3.0 (OD600). Buffers need to be scaled up proportionally if over amount of cultures are being processed.
2. Harvest the bacterial culture by centrifugation for 1 min at 10,000 rpm. Pour off the supernatant and blot the inverted tube on a paper towel to remove residue medium. Remove the residue medium completely.
Note: Residue medium will cause,
• Poor cell lysis and thus lower DNA yield.
• Loose pellet after centrifugation in step 6.
3. Add 250 μL Buffer A1 (Add RNase A to Buffer A1 before use) and completely resuspend bacterial pellet by vortexing or pipetting
Note: Complete resuspension is critical for bacterial lysis and lysate neutralization.
4. Add 250 μL Buffer B1, mix gently by inverting the tube 10 times (do not vortex), and incubate at room temperature for 5 minutes.
Note: Do not incubate for more than 5 minutes. Note: Buffer B1 precipitates (cloudy look) below room temperature. Warm up Buffer B1 at 50°C to dissolve precipitation before use. 5. Add 350 μL Buffer N1, mix completely by inverting/shaking the vial for 5 times and sharp hand shaking for 2 times.
Note: Incubating the lysate in ice for 1 min will improve the yield. Note: It is critical to mix the solution well. If the mixture still appears conglobated, brownish or viscous, more mixing is required to completely neutralize the solution.
6. Centrifuge the lysate at 13,000 rpm for 10 minutes at room temperature.
Note: If the lysate doesn’t appear clean, reverse the tube angle, centrifuge for 5 more minutes and then transfer the clear lysate to DNA column.
7. Carefully transfer the clear lysate into a DNA column with a collection tube, avoid the precipitations, spin at 13,000 rpm for 1 minute, discard the flow-through and put the column back to the collection tube.
8. Optional: Add 500 μL Buffer KB into the spin column, centrifuge at 13,000 rpm for 1 minute. Remove the spin column from the tube and discard the flow-through. Put the column back to the collection tube.
Note: Buffer KB is recommended for endA+ strains such as HB101, JM101, TG1 or their derived strains. It is not necessary for isolating DNA from endA- strains such as Top 10 and DH5a. Please reference Table 2 on page 3.
9. Add 650 μL DNA Wash Buffer (Add ethanol to DNA wash buffer before use) into the spin column, centrifuge at 13,000 rpm for 1 minute at room temperature. Remove the spin column from the tube and discard the flow-through. Repeat step “9” to improve the recovery.
10. Reinsert the spin column, with the lid open, into the collection tube and centrifuge for 2 minutes at 13,000 rpm.
Note: Residual ethanol can be removed more efficiently with the column lid open. It is critical to remove residual ethanol completely.
11. Carefully transfer the spin column into a sterile 1.5 mL tube and add 50-100 μL (> 50 μL) Sterile ddH20 or Elution Buffer into the center of the column and let it stand for 2 minutes. Elute the DNA by centrifugation at 13,000 rpm for 1 minute. Reload the eluate into the column and elute again.
Note: If ddH2O is applied, please make sure the pH is no less than 7.0 (7.0-8.5 is preferred). NaOH could be used to adjust the pH of ddH2O. Note: The DNA is ready for downstream applications such ascloning/subcloning, RFLP, library screening, in vitro translation, sequencing, transfection of robust cells such as HEK293 cells. Note: It’s highly recommended to remove the endotoxin (PD1212) if the DNA is used for endotoxin-sensitive cell lines, primary cultured cells or microinjection.
12. The DNA concentration can be calculated as follows,
Concentration (μg/mL) = OD260nm x 50 x dilution factor

4、Taq PCR
Set up tubes with 19 ul ddH20, 2 ul template, 2 ul forward primer, 2 ul reverse primer, 25 ul PCR mix
Initial denaturation: 94°C for 10:00 min
30 cycles of:
 94°C for 0:30 min
 55°C for 1:00 min
 72°C for 1:00 min/Kb
Final extension: 72°C for 10:00 min
5、Colony PCR
Suspend colonies in 10 ul H20
Lyse with 98°C incubation for 10 minutes
Use 2 ul of this suspension as template
Set up tubes with 6 ul H20, 2 ul template, 1 ul forward primer, 1 ul reverse primer, 10 ul PCR mix
Cycle:
Initial denaturation: 94°C for 10:00 min
30 cycles of:
 98°C for 0:10 min
 55°C for 0:30 min
 72°C for 1:00 min/Kb
Final extension: 5 minutes at 72°C

6、Biobrick Assembly Restriction Digest
For a double digest:
1. To a pcr tube, add 15 ul of miniprepped plasmid or purified PCR product
2. Add 3 ul of the appropriate buffer
3. Add 1ul of each enzyme.
4. Incubate at 37˚C for 1 hour.

7、Biobrick Assembly Ligation
1. In a PCR tube, add restriction digested and PCR purified insert to backbone in a 4:1 molar ratio, usually 1 ul backbone with 4 ul insert works.
2. Add 10ul T4 ligase buffer
3. Add 1 ul T4 ligase
4. Create a negative control replacing the insert with water
5. Add reactions to thermal cycler. Incubate at 22˚C for 30 minutes, at 65˚C for 10 minutes to heat inactivate, and if not being used right away, leave at 4˚C.
7. Use 2 ul of the ligation reactions to transform cells.
8、PCR/Gel Extraction
Fresh TAE buffer as running buffer is recommended. Reusing running buffer will result the increase of the pH and then reduce yields
1. For cycle-pure (PCR reaction): Add 2 volumes of Buffer GC to 1 volume of the PCR reaction and mix completely by vortexing. Briefly spin the tube to collect any drops from the inside wall and tube lid. For PCR products less than 200 bp, add 5 volumes of Buffer GC to 1 volume of PCR reaction
2. For agarose gel: Excise the DNA fragment from the agarose gel and weigh it in a 1.5 mL microtube. Add 1 volume of Buffer GC to 1 volume of gel to the 1.5 mL microtube and incubate the mixture at 55-60°C for 8 min. Mix the tube by tapping the bottom every 2 min till the gel has melted completely. Cool the tube to room temperature. Note: A gel slice of 100 mg approximately equals to 100 μL. Note: For DNA fragment less than 200 bp, add 1 volume of isopropanol.
3. Transfer up to 700 μL DNA/Buffer GC mixture to a spin column with a collection tube. Centrifuge at 13,000 x g for 1 min at room temperature. Discard the flow-through and put the column back to the collection tube. Repeat this step to process the remaining solution.
4. Add 300 μL of Buffer GC into the DNA Mini Column. Centrifuge at 13,000 x g for 30 to 60 seconds at room temperature to wash the DNA Mini Column.
5. Add 650 μL DNA Wash Buffer to the column and centrifuge at 13,000 x g for 30 s at room temperature. Discard the flow through and insert the column, with the lid open, back to the collection tube. Repeat step “4”.
Note: Ensure that ethanol has been added to DNA Wash Buffer as instructed .
6. Centrifuge the empty DNA column, with the lid open, at 13,000 x g for 2 min to dry the ethanol residue in the matrix.
Note: The residual ethanol will be removed more efficiently with the column lid open during centrifugation.
7. Place the column into a clean 1.5 mL micocentrifuge tube and add 30-50 μL pre-warmed (60oC) Elution Buffer or ddH2O to the center of the column. Incubate at room temperature for 1 min. Centrifuge at 13,000 x g for 1 min
Genescript
Standardized primer design
groE
Forward primer:
5’>CGGAATTCGCTCTAGAGATACGGACTTTCTCAAAGGAGAG<3’
Reverse primer:
5’>AACTGCAGGGACTAGTGTTTGTTTATTTCTGCGAGGTGC<3’

cheZ
Forward primer:
5’>CGGAATTCGCGGCCGCTTCTAGAGTGAGGATGCGACTATGATGC<3’
Reverse primer:
5’>AACTGCAGCGGCCGCTACTAGTACACGCCACATCAGGCAATACA<3’

Fermentas
EcoRI
Recommended Protocol for Digestion
• Add:
nuclease-free water 16 μl
10X Buffer EcoRI 2 μl
DNA (0.5-1 μg/μl) 1 μl
EcoRI 0.5-2 μl*, **
• Mix gently and spin down for a few seconds.
• Incubate at 37°C for 1-16 hours**.
The digestion reaction may be scaled either up or down.
Recommended Protocol for Digestion of PCR Products Directly after Amplification
• Add:
PCR reaction mixture 10 μl (~0.1-0.5 μg of DNA)
nuclease-free water 18 μl
10X Buffer EcoRI 2 μl
EcoRI 1-2 μ*, **
• Mix gently and spin down for a few seconds.
• Incubate at 37°C for 1-16 hours**.

Fermentas
XbaI
Recommended Protocol for Digestion
• Add:
nuclease-free water 16 μl
10X Buffer Tango 2 μl
DNA (0.5-1 μg/μl) 1 μl
XbaI 0.5-2 μl*
• Mix gently and spin down for a few seconds.
• Incubate at 37°C for 1-16 hours.
The digestion reaction may be scaled either up or down.
Recommended Protocol for Digestion of PCR Products Directly after Amplification
• Add:
PCR reaction mixture 10 μl (~0.1-0.5 μg of DNA)
nuclease-free water 18 μl
10X Buffer Tango 2 μl
XbaI 1-2 μl*
• Mix gently and spin down for a few seconds.
• Incubate at 37°C for 1-16 hours.

Fermentas
Thermo
BcuI(SpeI)
Recommended Protocol for Digestion
• Add:
nuclease-free water 16 μl
10X Buffer Tango 2 μl
DNA (0.5-1 μg/μl) 1 μl
BcuI 0.5-2 μl
• Mix gently and spin down for a few seconds.
• Incubate at 37°C for 1-16 hours.
The digestion reaction may be scaled either up or down.
Recommended Protocol for Digestion of PCR Products Directly after Amplification
• Add:
PCR reaction mixture 10 μl (~0.1-0.5 μg of DNA)
nuclease-free water 18 μl
10X Buffer Tango 2 μl
BcuI 1-2 μl
• Mix gently and spin down for a few seconds.
• Incubate at 37°C for 1-16 hours.

Fermentas
PstI
Recommended Protocol for Digestion
• Add:
nuclease-free water 16 μl
10X Buffer R 2 μl
DNA (0.5-1 μg/μl) 1 μl
PstI 0.5-2 μl*
• Mix gently and spin down for a few seconds.
• Incubate at 37°C for 1-16 hours.
The digestion reaction may be scaled either up or down.
Recommended Protocol for Digestion of PCR Products Directly after Amplification
• Add:
PCR reaction mixture 10 μl (~0.1-0.5 μg of DNA)
nuclease-free water 18 μl
10X Buffer R 2 μl
PstI 1-2 μl*
• Mix gently and spin down for a few seconds.
• Incubate at 37°C for 1-16 hours.
Fermentas
HindIII
Recommended Protocol for Digestion
• Add:
nuclease-free water 16 μl
10X Buffer R 2 μl
DNA (0.5-1 μg/μl) 1 μl
HindIII 0.5-2 μl*
• Mix gently and spin down for a few seconds.
• Incubate at 37°C for 1-16 hours.
The digestion reaction may be scaled either up or down.
Recommended Protocol for Digestion of PCR Products Directly after Amplification
• Add:
PCR reaction mixture 10 μl (~0.1-0.5 μg of DNA)
nuclease-free water 18 μl
10X Buffer R 2 μl
HindIII 1-2 μl*
• Mix gently and spin down for a few seconds.
• Incubate at 37°C for 1-16 hours.

Thermo
T4 DNA Ligase 5u/ul
DNA INSERT LIGATION INTO VECTOR DNA
Sticky-end ligation
1. Prepare the following reaction mixture:
2. Incubate 10 min at 22°C.
3. Use up to 5 _l of the mixture for transformation of
50 _l of chemically competent cells or 1-2 _l per 50 _l of electrocompetent cells.