Team:Westminster/Experiments
From 2012.igem.org
Line 214: | Line 214: | ||
<h2>Experimental Design</h2> | <h2>Experimental Design</h2> | ||
<h3>Experiment 1:Identification</h3> | <h3>Experiment 1:Identification</h3> | ||
- | |||
<p>This experiment is designed to help in identifying cancer stem cells from normal cancer cells, by using their ability to characteristically express ALDH. The genetic construct resulting from this experiment would contain fluorescent reporters and a bacterial selection marker. Only stem cells with ALDH activity will be express ALDH promoter activity resulting in Fluorescence of those cells. These cells can be visually identified.</p> | <p>This experiment is designed to help in identifying cancer stem cells from normal cancer cells, by using their ability to characteristically express ALDH. The genetic construct resulting from this experiment would contain fluorescent reporters and a bacterial selection marker. Only stem cells with ALDH activity will be express ALDH promoter activity resulting in Fluorescence of those cells. These cells can be visually identified.</p> | ||
- | <img src="https://static.igem.org/mediawiki/2012/7/76/Construct_1.png" alt="ALDH1A1 directions" title="1A1" width=" | + | <img src="https://static.igem.org/mediawiki/2012/7/76/Construct_1.png" alt="ALDH1A1 directions" title="1A1" width="490" height="425" /> |
+ | <h3>Experiment 2:Isolation</h3> | ||
+ | <p>The second part of the experiment is designed to isolate the cancer stem cells form normal cells by rendering them resistance to antibiotics. Neomycin was used as the mammalian selection marker. When grown in a medium containing the corresponding antibiotic, only those cells with resistance will survive.</p> | ||
+ | <img src="https://2012.igem.org/File:Construct2_(2).png" alt="ALDH1A1 directions" title="1A1" width="476" height="437" /> | ||
+ | <h3>Experiment 3:Destruction</h3> | ||
+ | <p>The final part of the experiment is to make a construct that will help to destroy the cancer stem cells. The antibiotic resistance marker will be flanked with two lox sites that will be excised in the presence of cre recombinase. The cre will be induced by the presence of doxycycline in the medium..</p> | ||
+ | <img src="https://static.igem.org/mediawiki/2012/c/c4/Construct3_%282%29.png" alt="ALDH1A1 directions" title="1A1" width="476" height="430" /> | ||
+ | |||
+ | |||
Revision as of 21:56, 26 September 2012
Promoter Seqeunce Identification
The team isolated regions of approximately 1kbp where the gene promoter was likely to be found. These were compared with commercial promoters (if available) and European Promoter database (EPD). The promoter sequences that appeared on the EPD site have been experimentally analysed, and also did not contain any illegal sites. Thus they were selected, in case of ADH1A1 and ALDH3A1. ALDH1A3 identified by the team had no illegal site, so it was maintained. However, ALDH2 promoter sequence on the EPD site was too small to be included. Therefore a commercial promoter of ALDH2 was selected.
The following gives an example of how a promoter sequences were identified by the iSTEM team:
ALDH1A1
Directionality:5-3
TAATAA= TATA box
GCTGCATACetc = the 5’UTR region.
The promoter includes elements of the 5’UTR plus the grey sequence upstream of it, up to and including the yellow region coding for the forward primer (about 1,000bp in total).
ATGTCATCCetc = start of gene at -75567940 approx
F: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCATCATATGACTTTTTTCAAC
R: GTTTCTTCCTGCAGCGGCCGCTACTAGTATTCTGATTCGGCTCCTGGAA
The promoter sequences identified are represented below:
ALDH1A1 (552BP)
ALDH2 (903BP)
ALDH1A3 (932BP)
ALDH3A1 (600BP)
Primer Design
The primers for these sequences were designed using Gingko bioworks part design tool that allows the sequences to be flanked with biobrick suffix and prefix. The primers are represented in the table below:
Experimental Design
Experiment 1:Identification
This experiment is designed to help in identifying cancer stem cells from normal cancer cells, by using their ability to characteristically express ALDH. The genetic construct resulting from this experiment would contain fluorescent reporters and a bacterial selection marker. Only stem cells with ALDH activity will be express ALDH promoter activity resulting in Fluorescence of those cells. These cells can be visually identified.
Experiment 2:Isolation
The second part of the experiment is designed to isolate the cancer stem cells form normal cells by rendering them resistance to antibiotics. Neomycin was used as the mammalian selection marker. When grown in a medium containing the corresponding antibiotic, only those cells with resistance will survive.
Experiment 3:Destruction
The final part of the experiment is to make a construct that will help to destroy the cancer stem cells. The antibiotic resistance marker will be flanked with two lox sites that will be excised in the presence of cre recombinase. The cre will be induced by the presence of doxycycline in the medium..