Team:BAU-Indonesia/Modeling

From 2012.igem.org

(Difference between revisions)
Line 80: Line 80:
<ul class='menu1'>
<ul class='menu1'>
<img src="https://static.igem.org/mediawiki/2012/1/19/Maskot_tim_iGEM_IPB.png"/>
<img src="https://static.igem.org/mediawiki/2012/1/19/Maskot_tim_iGEM_IPB.png"/>
-
<li><a href='https://2012.igem.org/Team:BAU-Indonesia/ProjectDesc' target="_blank" title='projectdesc'> Project Description </a></li>
+
 
-
<li><a href='https://2012.igem.org/Team:BAU-Indonesia/Safety' target="_blank" title='abstract'> Safety </a></li>
+
-
<li><a href='https://2012.igem.org/Team:BAU-Indonesia/Abstract' target="_blank" title='abstract'> Abstract </a></li>
+
<li><a href='#' onclick='MGJS.goTop();return false;'> Back to top </a></li>
<li><a href='#' onclick='MGJS.goTop();return false;'> Back to top </a></li>
</ul>
</ul>

Revision as of 20:46, 26 September 2012


Metamorphosis Design Free Css Templates

Modeling


Biobrick parts that we have been using is Coming Soon (in progress) because the Protein Coding Site (Cutinase gene) is in sequencing process. so we're not be able to post our parts.
We use cutinase gene (LC cutinase) which is homolog with Thermobifidafuscacutinase. We align some cutinase gene that we got from the gene bank, and create the DNA primer from it. Our forward primer is 5' AACCCCTACGAGCGCGGCCCC 3' and our reverse primer is5' AGAACGGGCAGGTGGAGCGGT 3'.
We use strong constitutive promoter, and we cut it from PET 14 plasmids then we'll connect it to the plasmid vector pSB1C3. We use the strong constitutive promoter because we want the enzyme secreted continuously.
We just use one modul, The Degradation Modul



Retrieved from "http://2012.igem.org/Team:BAU-Indonesia/Modeling"