"
Team:Trieste/parts/10
From 2012.igem.org
(Difference between revisions)
| Line 10: | Line 10: | ||
<div class="box_contenuti"> | <div class="box_contenuti"> | ||
<h2>Description </h2> | <h2>Description </h2> | ||
| - | </br> | + | This part is composed by J23100-B0034-β-glucosidase-B0015. When this part is expressed in bacteria, they become able to metabolize cellobiose converting it in two molecules of glucose. |
| + | </br> | ||
| + | </br> | ||
<h2>Assembly</h2> | <h2>Assembly</h2> | ||
| + | This composite part is developed by previous work by UNITS iGEM team 2011 and Edinburgh team 2011. They discovered that BBa_K392008 (Osaka 2010), coding for a Cellumonas fimi β-glucosidase, possess an apparent frameshift near the start of the coding sequence. The coding sequence has now been determined to start from an ATG located 220 bp downstream of the reported one. We therefore decided to correct the Bba_K392008 in order to have the correct coding sequence. In order to do this we made a PCR on Bba_K392008 by using the following primers: | ||
| + | </br> | ||
| + | </br> | ||
| + | Short β-Glucosidase_Fw | ||
| + | GCATGAATTCGCGGCCGCTTCTAGATGACCACCACGCGCCCCTC (start codon underlined) | ||
</br> | </br> | ||
<h2>Results</h2> | <h2>Results</h2> | ||
Revision as of 15:57, 25 September 2012
The Jolly JoCare
a safe probiotic platform for protein expression
BBa_K875020
More
Description
This part is composed by J23100-B0034-β-glucosidase-B0015. When this part is expressed in bacteria, they become able to metabolize cellobiose converting it in two molecules of glucose.Assembly
This composite part is developed by previous work by UNITS iGEM team 2011 and Edinburgh team 2011. They discovered that BBa_K392008 (Osaka 2010), coding for a Cellumonas fimi β-glucosidase, possess an apparent frameshift near the start of the coding sequence. The coding sequence has now been determined to start from an ATG located 220 bp downstream of the reported one. We therefore decided to correct the Bba_K392008 in order to have the correct coding sequence. In order to do this we made a PCR on Bba_K392008 by using the following primers: Short β-Glucosidase_Fw GCATGAATTCGCGGCCGCTTCTAGATGACCACCACGCGCCCCTC (start codon underlined)Results
Modelling
Looking forward
Link to the Registry
