Team:Potsdam Bioware/Biobricks

From 2012.igem.org

(Difference between revisions)
(→Biobricks)
Line 5: Line 5:
= Biobricks =
= Biobricks =
----
----
-
<partinfo>BBa_K929000 short</partinfo>
+
<html>
-
{| style="color:black" cellpadding="6" cellspacing="1" border="2" align="right"
+
<p><SPAN style='font-size: 150%; font-weight: bold;'>AID with CMV promoter and hGH-polyadenylation signal sequence</SPAN>
-
! colspan="2" style="background:#66bbff;"|[http://partsregistry.org/Part:BBa_K929000 CMV_wtAID_pA]
+
</p>
-
|-
+
<table style="color:black" cellpadding="6" cellspacing="1" border="2" align="right">
-
! colspan="2"|[[Image:UP12_PlasmidCMV_wtAID_pA.png|300px]]
+
<tr>
-
|-
+
<th colspan="2" style="background:#66bbff;"><a href="http://partsregistry.org/Part:BBa_K929000" class="external text" title="http://partsregistry.org/Part:BBa_K929000" rel="nofollow">CMV_wtAID_pA</a>
-
|'''BioBrick Nr.'''
+
</th></tr>
-
|[http://partsregistry.org/Part:BBa_929000 BBa_929000]
+
<tr>
-
|-
+
<th colspan="2"><a href="/Image:UP12_PlasmidCMV_wtAID_pA.png" class="image" title="UP12 PlasmidCMV wtAID pA.png"><img alt="" src="/wiki/images/thumb/2/2e/UP12_PlasmidCMV_wtAID_pA.png/300px-UP12_PlasmidCMV_wtAID_pA.png" width="300" height="109" border="0" /></a>
-
|'''RFC standard'''
+
</th></tr>
-
|[http://partsregistry.org/Help:Assembly_standard_10 RFC 10]
+
<tr>
-
|-
+
<td><b>BioBrick Nr.</b>
-
|'''Requirement'''
+
</td><td><a href="http://partsregistry.org/Part:BBa_929000" class="external text" title="http://partsregistry.org/Part:BBa_929000" rel="nofollow">BBa_929000</a>
-
|pSB1C3<br>  
+
</td></tr>
-
|-
+
<tr>
-
|'''Source'''
+
<td><b>RFC standard</b>
-
|existing parts:([http://partsregistry.org/Part:BBa_K103001 BBa_K103001];[http://partsregistry.org/Part:BBa_I712004 BBa_I712004]; [http://partsregistry.org/Part:BBa_K404108 BBa_K404108])
+
</td><td><a href="http://partsregistry.org/Help:Assembly_standard_10" class="external text" title="http://partsregistry.org/Help:Assembly_standard_10" rel="nofollow">RFC 10</a>
-
|-
+
</td></tr>
-
|'''Submitted by'''
+
<tr>
-
|[https://2012.igem.org/Team:Potsdam_Bioware Potsdam_Bioware2012]
+
<td><b>Requirement</b>
-
|}
+
</td><td>pSB1C3<br />
-
<br>
+
</td></tr>
-
[[Image:UP12_PlasmidCMV_wtAID_pA2.png|left|thumb|400px|'''Figure 1:'''pSB1C3-Plasmid with AID with CMV promoter and hGH-polyadenylation signal sequence]]<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br>
+
<tr>
-
 
+
<td><b>Source</b>
-
The BioBrick "AID with CMV promoter and hGH-polyadenylation signal sequence" ([http://partsregistry.org/Part:BBa_K929000 BBa_K929000]) is an extended version of the existing AID BioBrick ([http://partsregistry.org/Part:BBa_K103001 BBa_K103001]). It is built of 3 parts: CMV promoter ([http://partsregistry.org/Part:BBa_I712004 BBa_I712004]), AID [http://partsregistry.org/Part:BBa_K103001 BBa_K103001])and hGH polyadenylation signal sequence ([http://partsregistry.org/Part:BBa_K404108 BBa_K404108]).<br>
+
</td><td>existing parts:(<a href="http://partsregistry.org/Part:BBa_K103001" class="external text" title="http://partsregistry.org/Part:BBa_K103001" rel="nofollow">BBa_K103001</a>;<a href="http://partsregistry.org/Part:BBa_I712004" class="external text" title="http://partsregistry.org/Part:BBa_I712004" rel="nofollow">BBa_I712004</a>; <a href="http://partsregistry.org/Part:BBa_K404108" class="external text" title="http://partsregistry.org/Part:BBa_K404108" rel="nofollow">BBa_K404108</a>)
-
'''AID''':<br>
+
</td></tr>
-
AID is known to be responsible for somatic hypermutation and the class-switch recombination of immunoglobulin in B cells. This enzyme of 28 kDa originally occurs in B cells but does also show activity after transfection into CHO cells. AID induces the deamination of cytidine to uridine at actively transcribed single strand DNA. The replacement of cytidine by uridine leads to a mismatch during DNA replication and integrates a single base substitution predominantly in the immunoglobulin genes. <br>
+
<tr>
-
'''CMV promoter:'''<br>
+
<td><b>Submitted by</b>
-
CMV is an immediate-early Cytomegalovirus promoter for high-level expression. The CMV promoter is commonly used due to its very strong activity and effectivity in a broad range of cell types. The BioBrick is therefore improved via addition of the strong promoter. <br>
+
</td><td><a href="https://2012.igem.org/Team:Potsdam_Bioware" class="external text" title="https://2012.igem.org/Team:Potsdam_Bioware" rel="nofollow">Potsdam_Bioware2012</a>
-
'''hGH polyadenylation signal sequence:'''<br>
+
</td></tr></table>
 +
<p><br />
 +
</p>
 +
<div class="thumb tleft"><div class="thumbinner" style="width:402px;"><a href="/Image:UP12_PlasmidCMV_wtAID_pA2.png" class="image" title="UP12 PlasmidCMV wtAID pA2.png"><img alt="" src="/wiki/images/thumb/4/41/UP12_PlasmidCMV_wtAID_pA2.png/400px-UP12_PlasmidCMV_wtAID_pA2.png" width="400" height="335" border="0" class="thumbimage" /></a>  <div class="thumbcaption"><div class="magnify"><a href="/Image:UP12_PlasmidCMV_wtAID_pA2.png" class="internal" title="Enlarge"><img src="/wiki/skins/common/images/magnify-clip.png" width="15" height="11" alt="" /></a></div></div></div></div><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br />
 +
<p>The BioBrick "AID with CMV promoter and hGH-polyadenylation signal sequence" (<a href="http://partsregistry.org/Part:BBa_K929000" class="external text" title="http://partsregistry.org/Part:BBa_K929000" rel="nofollow">BBa_K929000</a>) is an extended version of the existing AID BioBrick (<a href="http://partsregistry.org/Part:BBa_K103001" class="external text" title="http://partsregistry.org/Part:BBa_K103001" rel="nofollow">BBa_K103001</a>). It is built of 3 parts: CMV promoter (<a href="http://partsregistry.org/Part:BBa_I712004" class="external text" title="http://partsregistry.org/Part:BBa_I712004" rel="nofollow">BBa_I712004</a>), AID <a href="http://partsregistry.org/Part:BBa_K103001" class="external text" title="http://partsregistry.org/Part:BBa_K103001" rel="nofollow">BBa_K103001</a>)and hGH polyadenylation signal sequence (<a href="http://partsregistry.org/Part:BBa_K404108" class="external text" title="http://partsregistry.org/Part:BBa_K404108" rel="nofollow">BBa_K404108</a>).<br />
 +
<b>AID</b>:<br />
 +
AID is known to be responsible for somatic hypermutation and the class-switch recombination of immunoglobulin in B cells. This enzyme of 28 kDa originally occurs in B cells but does also show activity after transfection into CHO cells. AID induces the deamination of cytidine to uridine at actively transcribed single strand DNA. The replacement of cytidine by uridine leads to a mismatch during DNA replication and integrates a single base substitution predominantly in the immunoglobulin genes. <br />
 +
<b>CMV promoter:</b><br />
 +
CMV is an immediate-early Cytomegalovirus promoter for high-level expression. The CMV promoter is commonly used due to its very strong activity and effectivity in a broad range of cell types. The BioBrick is therefore improved via addition of the strong promoter. <br />
 +
<b>hGH polyadenylation signal sequence:</b><br />
Polyadenylation is a significant part for the translation and stability of mRNA. In eukaryotes, it is part of the process that produces mature messenger RNA (mRNA) for translation. It, therefore, forms part of the larger process of gene expression. hGH terminator gives a signal to start polyadenylation in the translation process.
Polyadenylation is a significant part for the translation and stability of mRNA. In eukaryotes, it is part of the process that produces mature messenger RNA (mRNA) for translation. It, therefore, forms part of the larger process of gene expression. hGH terminator gives a signal to start polyadenylation in the translation process.
-
 
+
</p><p><br />
-
<!-- Add more about the biology of this part here
+
</p><p><span class="h3bb">Sequence and Features</span>
-
===Usage and Biology===
+
</p>
-
 
+
<script src='http://partsregistry.org/cgi/partsdb/seq_edit/all.js'></script> <DIV id='sequencePaneDiv'> <INPUT type='hidden' id='new_dna_format' name='new_dna_format' value='' /> <INPUT type='hidden' id='selection_start' name='selection_start' value='14' /> <INPUT type='hidden' id='selection_end'  name='selection_end'  value='0' /></DIV> <script> var sequence = new String('cgatgtacgggccagatatacgcgttgacattgattattgcctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattactagaaccatggacagcctcttgatgaaccggaggaagtttctttaccaattcaaaaatgtccgctgggctaagggtcggcgtgagacctacctgtgctacgtagtgaagaggcgtgacagtgctacatccttttcactggactttggttatcttcgcaataagaacggctgccacgtggaattgctcttcctccgctacatctcggactgggacctagaccctggccgctgctaccgcgtcacctggttcacctcctggagcccctgctacgactgtgcccgacatgtggccgactttctgcgagggaaccccaacctcagtctgaggatcttcaccgcgcgcctctacttctgtgaggaccgcaaggctgagcccgaggggctgcggcggctgcaccgcgccggggtgcaaatagccatcatgaccttcaaagattatttttactgctggaatacttttgtagaaaaccatgaaagaactttcaaagcctgggaagggctgcatgaaaattcagttcgtctctccagacagcttcggcgcatccttttgcccctgtatgaggttgatgacttacgagacgcatttcgtactttgggactttgaaagctttactagagacgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtcctt');        var seqFeatures = new Array( ['brick',1,654,'I712004', 1], ['brick',663,1262,'K103001', 1], ['brick',1276,1754,'K404108', 1], ['cds',665,1262,'AID', 0], ['stop',1259,1262,'UGA', 0], ['reg',1,654,'CMV promoter', 0], ['wiggle',663,668,'NcoI', 0], ['polya',1276,1754,'hGH terminator', 1], ['rarrow_p',665,667,'ATG', 0]); var subParts = null; var Format = '_ruler_'; var PrimaryPartID = '25749'; var Selection_Start = 0; var Selection_End = 0; showSeqFeatures(false);  </script><div style='position:relative;clear:both;width:100%'><div style=''>
-
<!-- -->
+
<p><STYLE type='text/css'>
-
<span class='h3bb'>Sequence and Features</span>
+
.compatibility_div ul,
-
<partinfo>BBa_K929000 SequenceAndFeatures</partinfo>
+
.compatibility_div li {
 +
display: inline;
 +
}
 +
.compatibility_div li {
 +
position: relative;
 +
padding-top: 2px;
 +
padding-left:4px;
 +
padding-right:3px;
 +
margin-right:2px;
 +
margin-bottom: 5px;
 +
}
 +
.compatibility_div .box {
 +
top:  35px;
 +
width: 200px;
 +
left:  0px;
 +
}
 +
.compatibility_div .box_white {
 +
border: 1px solid gray;
 +
background-color: white;
 +
}
 +
.compatibility_div .box_red {
 +
border: 1px solid #dd6666;
 +
background-color: #ffcccc;
 +
background-image: url('http://partsregistry.org/images/red_not/red_box.png');
 +
background-repeat: none;
 +
}
 +
.compatibility_div .box_green {
 +
border: 1px solid #44ee44;
 +
background-color: #aaffaa;
 +
}
 +
</p><p><br />
 +
</p>
 +
</html>

Revision as of 10:10, 25 September 2012


Biobricks

AID with CMV promoter and hGH-polyadenylation signal sequence

CMV_wtAID_pA
BioBrick Nr. BBa_929000
RFC standard RFC 10
Requirement pSB1C3
Source existing parts:(BBa_K103001;BBa_I712004; BBa_K404108)
Submitted by Potsdam_Bioware2012























The BioBrick "AID with CMV promoter and hGH-polyadenylation signal sequence" (BBa_K929000) is an extended version of the existing AID BioBrick (BBa_K103001). It is built of 3 parts: CMV promoter (BBa_I712004), AID BBa_K103001)and hGH polyadenylation signal sequence (BBa_K404108).
AID:
AID is known to be responsible for somatic hypermutation and the class-switch recombination of immunoglobulin in B cells. This enzyme of 28 kDa originally occurs in B cells but does also show activity after transfection into CHO cells. AID induces the deamination of cytidine to uridine at actively transcribed single strand DNA. The replacement of cytidine by uridine leads to a mismatch during DNA replication and integrates a single base substitution predominantly in the immunoglobulin genes.
CMV promoter:
CMV is an immediate-early Cytomegalovirus promoter for high-level expression. The CMV promoter is commonly used due to its very strong activity and effectivity in a broad range of cell types. The BioBrick is therefore improved via addition of the strong promoter.
hGH polyadenylation signal sequence:
Polyadenylation is a significant part for the translation and stability of mRNA. In eukaryotes, it is part of the process that produces mature messenger RNA (mRNA) for translation. It, therefore, forms part of the larger process of gene expression. hGH terminator gives a signal to start polyadenylation in the translation process.


Sequence and Features