Contents 1 Protocol 1.1 General 1.2 PCR 1.3 RNA Extraction 1.4 Making Competent cells 1.5 Miniprep 1.6 Ethanol Precipitation 1.7 Elecrophoresis 1.8 PCR Purification 1.9 qRT-PCR 1.10 Ligation 1.11 Restrictive Digestion 1.12 Media 1.13 Buffer TB 1.14 DNS reaegnt 1.15 Solubilization of Antibiotics 1.16 Transformation 1.17 Sequence 1.18 Florigen 1.18.1 Western blotting 1.18.1.1 Gel solution 1.18.1.2 4x Sample buffer 1.18.1.3 10x electrode buffer 1.18.1.4 blotting buffer 1.18.1.5 TBST 1.18.1.6 blocking buffer 1.18.1.7 AP color development buffer 1.18.2 Verification of R9 function by GFP 1.18.3 Cultivation of Arabidopsis thaliana 1.19 Strains 1.19.1 E.coli 1.19.2 Plant 1.20 Primers 1.20.1 Florigen

Protocol

General

PCR

PCR: ToYoBo KOD FX or ToYoBo KOD PLUS

• Dilute template DNA. If the concentration of DNA is 2-100ng/µL, transfer 1µL to a clean tube and add 99µL MilliQ.
  
• Dilute Primer. If the concentration of Primer is XµM, dilute primer X timers and transfer 1µL to a clean tube and add 99µL MilliQ.
  
• Mix the following.
  

For use of KOD plus ver2

25mM MgSO4	3µL
2mM dNTPs	5µL
10xBuffer for KOD plus ver.2	5µL
Template DNA (5ng/µL)	5µL
Primer Forward (10µM)	1.5µL
Primer Reverse (10µM)	1.5µL
KOD plus ver.2	1µL
MilliQ	28µL
Total	50µL

For use of KOD FX

2mM dNTPs	10µL
2xBuffer for KOD FX	25µL
Template DNA	5µL
Primer Forward (10µM)	1.5µL
Primer Reverse (10µM)	1.5µL
KOD FX	1µL
MilliQ	6µL
Total	50µL

• Let stand for 2min at 94℃.
  
• 25-40 cycles for 10s at 98℃, for 30s at Tm-5℃, and for 1min (1min for 1kb) at 68℃ (Tm is temparature at which primer will dissolve).
  
• Agarose Gel Electrophoresis for confirmation.
  
  

PCR: Takara Ex taq

• Mix the following (Do on PCR Bench).
  

10x PCR buffer (TAKARA)	40µL
2.5mM dNTP	8µL
Primer-1 (10pmol/µL)	8µL
Primer-2 (10pmol/µL)	8µL
Ex Taq HS (TAKARA)	1.6µL
MilliQ	334µL (to total 400µL)
Total	400µL

• Dispense 25µL to 15 tubes.
  
• Pick a single colony and transfer it to each tubes.
  
• Suspend the colony.
  
• Let stand for 10min at 90℃.
  
• 35 cycles for 30s at 94℃, for 30s 55℃, and for 1min at 72℃.
  
• Let stand for 4min at 72℃.
  
• Add 5mL Loading Buffer to the tubes.
  
• Agalose Gel Electrophoresis for confirmation.
  
• Negative Control: Use nothing.
  
• Positive Control: Use a colony that will yield a product with this primers.
  

RNA Extraction

Use　ISOGEN－LS（NIPPON　GENE,311-02621

• Add 1mL ISOGEN-LS to sample and vortex.
  
• Store for 5min on ice.
  
• Add 250µL chloroform and shake vigorously for 15 sec.
  
• Store for 3min. on ice.
  
• Centrifuge 17400xg for 10min. at 4℃.
  
• Transfer aqueous phase to another tube and add 0.8 volume isopropanol.
  
• Store for 10min. on ice.
  
• Centrifuge 17400xg for 10min. at 4℃.
  
• Discard the supernatant.
  
• Add 800µL 80% ethanol and vortex.
  
• Centrifuge 7500xg for 5min. at 4℃.
  
• Discard the supernatant.
  
• Dry briefly.
  
• Dissolve in nuclease-free water.
  

Making Competent cells

• Streak E.coli cells on an LB plate; (BL21(DE3)LysS cells on LB plate+34 mg/ml chloramphenicol)
  
• Allow cells to grow at 37oC overnight
  
• Place one colony in 10 mL LB media (+antibiotic selection if necessary), grow overnight at 37oC
  
• Take 2 ml LB media and save for blank. Transfer 5 mL overnight DH5a culture into 500 mL LB media in 3 L flask
  
• Allow cell to grow at 37oC (250 rpm), until OD600= 0.4 (~2-3 hours)
  
• Transfer cells to 2 centrifuge bottles (250 mL), and place cells on ice for 20 mins
  
• Centrifuge cells in Sorval GSA rotor at 4oC for 10 mins at 3,000 g.
  
• Subsequent resuspensions may be done in the same bottle. Cells must remain cold for the rest of the procedure: Transport tubes on ice and resuspend on ice in the cold room
  
• Pour off media and resuspend cells in 30 mL of cold 0.1 M CaCl2. Transfer the suspended cells into 50 mL polypropylene falcon tubes, and incubate on ice for 30 mins
  
• Centrifuge cells using Sorval RT6000B rotor at 4oC for 10 mins at 3,000 g (2500 rpm)
  
• Pour supernatant and resuspend cells (by pipetting) in 8 mL cold 0.1M CaCl2 containing 15% glycerol. Transfer 140 mL into (1.5 mL)
  *Ependorff tubes placed on ice. Freeze the cells in liquid nitrogen. Cells stored at -80oC can be used for transformation for up to ~6 months
  

Miniprep

Use QIAprep Spin Miniprep Kit Cat. No. 27104 by QIAGEN

• Pick a single colony from a freshly streaked selective plate and inoculate a culture of about 3mL LB medium containing the appropriate selective antibiotic.
  
• Incubate at 170rpm for 8h at 37℃ with vigorous shaking.
  
• Transfer a half of the culture to a tube.
  
• Harvest the bacterial cells by centrifugation at 14,000g for 1min at 4℃. Remove the medium by decanting.
  
• Transfer the half of the culture to same tube and harvest as same. Remove the medium by pippetting.
  
• Resuspend pelleted bacterial cells in 250µL Buffer P1 and mix thoroughly by pippeting.
  
• Add 250µL Buffer P2 and mix thoroughly by inverting the tube gently 4-6 times.
  
• Add 350µL Buffer N3 and mix immediately and thoroughly by inverting the tube 4-6 times.
  
• Centrifuge for 10min at 14,000g at 4℃.
  
• Apply the supernatants from step 10 to the QIAprep spin column by pipetting.
  
• Centrifuge for 10s in a table-top microcentrifuge. Discard the flow-through.
  
• Wash the QIAprep spin column by adding 0.5mL Buffer PB and centrifuging for 10s in a table-top microcentrifuge. Discard the flow-through.
  
• Wash QIAprep spin column by adding 0.65mL Buffer PeE and centrifuging fo 10s in a table-top microcentrifuge.
  
• Discard the flow-through, and centrifuge for and additional 1min to remove residual wash buffer.
  
• Place the QIAprep column in a clean tube. To elute DNA, add 50µL water to the center of each QIAprep spin column, let stand for 1min, and centrifuge for 1min.
  
• Discard the QIAprep spin column.
  
• Measure the concentration of DNA by using eppendorf BioPhotometer plus.
  
• Restriction Digestion.
  
• Agarose Gel Electrophoresis for Confirmation.
  

Ethanol Precipitation

Use Ethachinmate (NIPPON GENE、312-01791).

• Add 3.3 µL of 3M Sodium Acetate (attached with Ethachinmate) into 100µL of DNA solution.
  
• Add 1µL of Ethachinmate.
  
• Vortex.
  
• Add ethanol, 200-250µL.
  
• Vortex.
  
• Centrifuge at 12000xg for 5min.
  
• Precipitation.
  

Elecrophoresis

• Prepare 200mL of a 1.0% agarose solution:
  
• Measure 2.0g agarose into a beaker.
  
• Add 200mL 1xTAE buffer.
  
• Wrap the top of the beaker with plastic wrap.
  
• Punch a hole through the wrap with a pipette tip (To let out steam).
  
• Dissolve the agarose by heating in microwave and swirling without boiling.
  
• Allow the agarose to cool.
  
• Pour the agarose solution into a gel tray on a gel maker.
  
• If there is air bubbles, pushing them with a pipette tip.
  
• Place comb in the maker.
  
• Cover the maker with a plastic wrap.
  
• Let stand for about 45min.
  
• Remove the comb carefully.
  
• Store in the Tupperware in the refrigerator.
  
• Place the tray in electrophoresis chamber.
  
• Cover the tray with 1xTAE buffer.
  
• To prepare samples for electrophoresi, add 1µL of 6x Loading Buffer for every 5µL of DNA solution and mix well.
  
• Load 6µL of the DNA solution per well.
  
• Electrophorese at 100V for about 30min until Loading Buffer have migrated approximately three-quaters of the gel.
  
• Stain the gel in 0.5µg/mL ethidium bromide for 20-30min.
  
• Rinse the gel with MilliQ.
  
• Place a plastic wrap on the transilluminator in the cabinet of Printgraph.
  
• Place the gel on the transilluminator.
  
• Turn on the transilluminator and confirm the position of the gel.
  
• Shoot the picture.
  
• Turn off the transilluminator.
  
• Dispose of the gel.
  

PCR Purification

Use Wizard SV Gel and PCR Clean-Up System by Promega.

• Combine 1 part sample (PCR product) with one part Membrane Binding Solution (e.g. 50μl sample+ 50μl).
  
• Apply the solution to the column, and let stand for 1min.
  
• Centrifuge for 1min at 13000rpm. Discard the flow-through.
  
• Add 700µl Membrane Wash Solution.
  
• Centrifuge for 1min and discard the through.
  
• Add 500μl Membrane Wash Solution.
  
• Centrifuge for 5min and discard the through.
  
• Place the column in a clean tube.
  
• Add 60µl MilliQ to the center of each column, let stand for 1min.
  
• Centrifuge for 1min at 13000rpm.
  
• Discard the column.
  

qRT-PCR

Use QuantiTect SYBR green PCR kit Cat. No. 204143 by QIAGEN

• Dilute primer to 1.5μM.
  
• Dilute RT products.
  
• Mix the following;
  

2x QuantiTect SYBR Green PCR Master Mix	22.5μL
1/20xRT products	4.5μL
MilliQ	9μL
total	36μL

• Mix the reaction mix thoroughly ,and dispense 36μL into 96 wells plate.
  
• Add primer set 9μL.
  
• Mix by inverting and voltex.
  
• Dispense 10μL into 384 wells plate and centrifuge.
  
• Let stand for 2min at 50°C and for 15min for 95°C.
  
• 40 cycles for 15sec at 95°C, for 30sec at 60°C, and for 1min at 72°C.
  
• Let stand for 15sec at 95°C.
  

Ligation

• Make 2µL of Mixture (the vector and the insert at 1 : 5-10) and Control (only the vector).
  
• Add 5µL Ligation High, 1µL T4 Kinase, and 7µL MilliQ to create a solution.
  
• Incubate at 16℃ for 30 min. If the colonies of E.coli transformed with the Control
  

Restrictive Digestion

Use EcoRI, XbaI, SpeI, PstI, (NEB)

• Mix the following.

Sample	5µL
10xBuffer	1µL
Restriction Enzyme	0.1µL
MilliQ	-3.9µL

• Let stand for 2h at 37℃
  

Media

M9 medium

• Stir Na2HPO4 6 g, KH2PO4 3 g, NaCl 0.5 g and NH4Cl 1 g with water 1L.
  
• After autoclave, add 10 ml filter sterilized 100 mM MgSO4, 20 % glucose, 10 mM CaCl2, 100 mM thiamine-HCl.
  

If you need, add 10 ml filter sterilized 20 % casamino acid.
LB medium

• Stir Tryptone 20 g, Yeast extract 10 g and NaCl 10 g with water 200ml.
  
• If you make LB plates, add agar 10 g.
  
• Autoclave.
  

SOB medium

• Stir Tryptone 20g and Yeast extract 5g with water.
  
• Add 2 ml 5 M NaCl and 840 ul 3 M KCl and add water up to 1L.
  
• After autoclave, add 10 ml filter sterilized 1 M MgSO4 and 1 M MgCl2.
  

SOC medium

• Add 2 M glucose 1 ml to 100 ml SOB.
  

Buffer TB

• Stir PIPES and CaCl2・2H2O with 100 ml water.
  
• Add 8.315 ml 3 M KCl.
  
• Add KOH and adjust pH 6.8.
  
• Add MnCl2・4H2O.
  
• Add water up to 200 ml.
  
• Filter sterilize.
  

DNS reaegnt

• Add 1% DNS 88ml and Rochelle salt 25.5 g to 4.5% NaOH 30 ml (A solution)
  
• Add Phenol 1 g and water 7.8 ml to 10% NaOH 2.2 ml (B solution)
  
• Add NaHCO3 6.9g to B solution 6.9 ml
  
• Add A solution 118ml to B solution 6.9 ml
  
• Leave 2 days
  
• Store in brown bottle
  

Solubilization of Antibiotics

• Mix the following (Final concentration is 50mg/mL).
  

Ampicillin

Ampicillin	1.0g
MilliQ	20mL

Kanamycin

Kanamycin	0.5g
MilliQ	10mL

• Dispense 1.1mL of the solution into 1.5mL tubes.
  
• Store in the -20℃ freezer.
  

Transformation

• Unfreeze conpitent cells on ice.
  
• Dry a plate by letting the plate upside down and partly open in incubator.
  
• Add 1µL DNA solution and 20µL compitent cells to 1.5mL tube, let stand for 30min on ice. If few colony is observed, increase the amount of the compitent cells or DNA, but make the amount of DNA not to get over that of the compitent cells.
  
• Heatshock for 60s at 42℃.
  
• Let stand for 2min on ice.
  
• Culture for 1h in preculture medium (LB or SOC medium), and plate by using spreader. Do not heat spreader too much because e.coli will dead for heat.
  

Sequence

Use Big Dye Terminator 3.1（ABI）

• Mix the following
  

5xBuffer	2µL
Primer (3.2µM)	1µL
Template Plasmid	200ng
Big Dye Terminator 3.1	0.5µL
MilliQ	up to 10µL

• Let stand for 1min at 96℃.
  
• 35 cycles for 5s at 98℃, for 5s 50℃, and for 2.5min at 68℃.
  
• Add 25µL 100% ethanol and 1µL NAOAC
  

Florigen

Western blotting

Gel solution

	Running gel	Stacking gel
1.5M Tris-HCl(pH8.8)	2.5mL	-
0.25M Tris-HCl(pH6.8)	-	3.0mL
30% Acrylamide	5mL	0.6mL
10% SDS	0.2mL	0.12mL
DW	2.3mL	2.3mL
TEMED	15µL	7µL
10% APS	100µL	60µL
Total	10mL	6mL

4x Sample buffer

1M Tris-HCl	2mL
SDS	0.8g
100% glycerol	4mL
14.7M mercaptoethanol	0.4mL
0.5M EDTA	1mL
Bromophenol blue	8.0mg
DW	2.6mL

10x electrode buffer

Tris	15.15g
Glycin	71.55g
10%SDS	50mL
DW	450mL
Total	500mL

blotting buffer

Tris	12g
Glycin	14.4g
DW	800mL
Methanol	200mL

TBST

50mM	Tris
150mM	NaCl
0.1%	Tween-20

blocking buffer

• TBST
• 5% skim milk

AP color development buffer

• 100mM Tris (pH8.5)
• 100mM NaCl
• 5mM MgCl2

1. Spin down 100µL culture and suspend into sample buffer.
   
2. Boil at 95°C for 10 min.
   
3. Apply 10µL to polyacrylamide gel.
   
4. Electrophorese at 500V, 30mA for 50 min.
   
5. Transfer at 50V, 100mA for 30 min.
   
6. Add blocking buffer to the membrane and incubate with shaking for 30 min. at room temperature.
   
7. Add appropriate primary antibody diluted in TBST and incubate with shaking for 30 min. at RT.
   
8. Wash with TBST and incubate with shaking for 10 min, two times.
   
9. Add secondary antibody conjugated with AP and incubate with shaking for 30 min. at RT.
   
10. Wash with TBST and incubate with shaking for 10 min, three times.
    
11. Add 66µL NBT and 33µLof BCIP into color development buffer., and add the mixture to the membrane.
    
12. After the coloring, wash with DW.

Verification of R9 function by GFP

Verification of R9 function by TAKEUCHI

R9(20µg/µL)	0.9µL
GFP(1.2mg/mL)	2.23µL
RBS	16.85µL
total	20µL

X5

Method:
1. Peel cuticles on parafilm by using the head of pencil.(Menasha,wI,54952)
2. Put plant cells into GFP&R9 or GFP for 5~30min.
3. Put plant cells into PBS.
4. Hoechst dyeing.

	1	2	3	4	5	6
R9	o	o	o	x	o	o
cuticle	o	o	o	o	x	x
soak in GFP	5min	15min	30min	5min	5min	30min

Cultivation of Arabidopsis thaliana

Preparation<nt>

• MS culture medium
• mixed salts for MS culture medium
• Vitamin stocked solution（×1000）You can preserve this solution in a refrigerator for a few months.
• Mix the following（以下、表の形式）

thiamine hydrochloride	300mg
nicotinic acid	500mg
pyridoxine hydrochloride	50mg
DW	up to 100ml

• sucrose
• 0,1N KOH
• Gellan gum or Gelrite
• sterilized solution (Prepare this solution when you need it.)
• Mix the following

DW

to 50ml

sodium hypochlorite	2,5ml
Tween 20	25μl

• sterilized water
• sterilized by heating 0,1%(w/v) agar
• 70% ethanol

Condition

• MS culture medium
• light intensity : 3,000 lux
• day length 8 hour light period(10:00 – 18:00) / 16 hour dark period
• temperature 22℃
• 4 seeds / a culture medium

Method

• Put seeds into a 1,5ml microtube.
• Add 1ml of 70% ethanol to it, and stir it well.
• Centrifuge a microtube lightly (6,000 rpm / a few seconds / at room temperature), and dump supernatant.
• Add 1ml of sterilized liquid to it, and stir it with rotater for 3~5 minutes. Work in a clean bench except centrifuging after this manipulation,.
• Centrifuge a microtube lightly, and dump supernatant.
• Add 1ml of sterilized liquid to it, and stir it well.
• Centrifuge a microtube lightly, and dump supernatant.
• Repeat steps of [6. to 7.] 3~5 times.
• Suspend seeds in a few hundreds~ one thousand μl of 0,1% agar solution.
• Take proper quantity of seeds with a micropipette, and drop it on culture medium.

<groupparts>iGEM012 Kyoto</groupparts>

Strains

E.coli

JM109 endA, recA1, gyrA96,thi,hsdR17,(rκ-,mκ+),relA1, supE44,λ-,Δ(lac-proAB),[F',traD36,proAB,laclqZΔM15]
BL21(DE3) F－, ompT, hsdSB(rB －mB － ), gal, dcm, (DE3)

Plant

Arabidopsis thaliana ecotype Columbia

Primers

Florigen

Name	sequence
FT(RBS+)forward	gctctagagaaagaggagaaaGTCGACATGTCTATAAATATAAGAGACCCTCT
FT(RBS+)reverse	aaactgcagcggccgctactagtaCCTTGAGCTCCTAAAGTCTTCTTCCTC
FT(RBS-)forward	ggaattcgcggccgcttctagagATGTCTATAAATATAAGAGACCCTCTT
FT for sequence forward	TGACCATGATTACGCCAAGC
FT for sequence reverse	ACGGCCAGTGAATTGTAATACG
FT(+His)forward	TCTATAAATATAAGAGACCCTCTTATAGTAAGCAGAGTTG
FT(+His)reverse	ATGGTGATGGTGATGGTGCATGTCGACtttctcctctttctctagtatctcc
FT mutation forward	CATTCATCGTGTCGTGTTTATATTGTTTCG
FT mutation reverse	CCAGCAGTGGGACTTGGATTTTCGTAACAC
FT mutation forward2	CATTCATCGTGTCGTGTTTATATTGTTTCGACAGC
TUBULIN forward	AAACTCACTACCCCCAGCTTTG
TUBULIN reverse	CACCAGACATAGTAGCAGAAATCAAGT
SEP3 forward	CTAAGACTAAGGTTAGCTGATGGGTA
SEP3 reverse	ATGATGACGACCGTAGTGATCAA
FUL forward	TGCGTAACCTCCTCCAGAGAT
FUL reverse	GTTCTACTCGTTCGTAGTGGTAGGAC
AP1 forward	ACATCCGCACTAGAAAAAACCAAC
AP1 reverse	CTTGGTTCTGCTGATCCCACA