Team:WHU-China/Project

From 2012.igem.org

(Difference between revisions)
Line 113: Line 113:
{
{
title : '<strong>Device II: Cellulose Synthesis</strong>',
title : '<strong>Device II: Cellulose Synthesis</strong>',
-
dir : [
+
dir : []
-
  {
+
},
-
title : 'Outline',
+
-
href : '#Outline'
+
-
  }
+
-
                                                {
+
-
title : 'Description',
+
-
href : '#Description'
+
-
}
+
-
                                                {
+
-
title : 'Progress',
+
-
href : '#Progress'
+
-
}
+
-
                                                {
+
-
title : 'Results',
+
-
href : '#Results'
+
-
}
+
-
]
+
-
                                },
+
{
{
title : '<strong>Device III: Colonization</strong>',
title : '<strong>Device III: Colonization</strong>',

Revision as of 21:58, 24 September 2012

  •

                aaaa

                aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa aaaaa

                bbbb

                bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb bbbbb

                ccc

                ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc ccccc

                ddd

                dddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddddddd ddddd ddddd dddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd ddddddddd ddddd dddddvdddd ddddd ddddd

                Device II: Cellulose Synthesis

                Outline

                Cellulose is an essential material for keeping intestine peristalsis without producing energy, as prebiotics, feeding vegetarian bacteria flora (including Bacteroides, whose appropriate amount has proved important to prevent obesity[1]) of intestine as well. Thus, cellulose help people keep slim and healthy.

                The developing device aims at transforming glucose into cellulose, thus producing cellulose as well as reducing energy intake. To achieve this goal, we cloned genes of enzymes responding to cellulose synthesis from the Escherichia coli str. DH5α, constructing functional expressional elements with these genes respectively downstream of promoter activated by glucose. In this way, cellulose synthetase complex is built artificially under regulation of glucose, repressed under low concentration of glucose and activated under high concentration of glucose.

                In the future, this device can be integrated to the assembled “E. coslim”, activated when excess glucose is sensed in intestine, converting to cellulose.

                The same as device I (fatty acid metabolism), on one hand,we divide our work into two parallel sections. “Function” section includes a series of molecular biological manipulation on four genes of the cellulose synthetase complex and another two genes responding to producesubstrates for cellulose synthesis. On the other hand, the design, construction and function tests of glucose-activated promoter belong to “regulation” section.

                Description

                Genes to be Cloned

                4 genes, bcsA, bcsB, bcsZ and bcsC,from the rdar morphotype bacterium,are involved in cellulose biosynthesis.

                • BcsA is considered to be the catalytic subunit
                • BcsB can be activated the soon it binds to c-di-GMP
                • BcsZ encodes endo-1,4-D-glucanase which belongs to glycosyl hydrolase family Ⅷ. Activation of BcsZ is required for optimal synthesis and membrane translocation of cellulose
                • Although bcsC is transcribed constitutively, cellulose synthesis occurs only in the circumstances of AdrA
                • AdrA ,a diguanylate cyclase (DGC), cyclizestwo GTPs into c-di-GMP. In turn, the activity of cellulose synthase can be increased when binds to c-di-GMP. For more information of c-di-GMP, click Here
                • GalU catalyzes the addition of UTP to α-D-glucose 1-phosphate to yield UDP-D-glucose, which is the substrate for cellulose synthase complex
                • GalF is a predicted subunit of a GalU/GalF protein complex involved in colanic acid building blocks biosynthesis

                Indirect Regulation Pathway Design

                In a cell, total amount of ATP, ADP and AMP remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.

                We embed gene cI of lambda phage downstream promoter PcstA (BBa_K118011) activated by the binding of CRP, and genes of cellulose synthesis respectively downstream the promoter BBa_R0051 repressed by protein cI. In this way ,we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as supposed, cellulose production will be increased following the elevation of glucose concentration, and vice versa. For more information, click Here.

                Direct Regulation Pathway Design

                Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we modified a constitutive promoter (BBa_J23119) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on Standard), but we shall focus on the design itself now.

                We designed promoter Pcar(BBa_K861171) based on promoter BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region. Since steric hindrance of CRP dimer blocks the function of -10 region, genes downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results show, promoter Pcar works as we expect. For more information, please click Here.

                Progress

                Clone of genes

                As for the genes that we cloned, there is no difference between E. Coli str. K12 MG1655 and more available DH5α.we purified and amplified these genes from genome of Escherichia coli str. DH5α?using PCR. The primers contain standard restriction enzyme cutting sites. The sequences of the primers used are as below.

                • bcsA Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG
                  Sense CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG
                • bcsB Antisense CCTGCAGTACTAGTATTACTCGTTATCCGGGTTAAGAC
                  Sense CGAATTCTTCTAGAGATGAAAAGAAAACTATTCTGGATTTG
                • bcsZ Antisense CCTGCAGTACTAGTATTAGTGTGAATTTGCGCATTCCTGG
                  Sense CGAATTCTTCTAGAGATGAATGTGTTGCGTAGTGGAATCG
                • bcsC Antisense CCTGCAGTACTAGTATTACCAGTCGGCGTAAGGTATCA
                  Sense CGAATTCTTCTAGAGATGCGCAAATTCACACTAAACATATTC
                • galF Antisense CCTGCAGTACTAGTATTATTCGCTTAACAGCTTCTCG
                  Sense CGAATTCTTCTAGAGATGACGAATTTAAAAGCAGTTATACC
                • galU Antisense CCTGCAGTACTAGTATTACTTCTTAATGCCCATCTCTTCT
                  Sense CGAATTCTTCTAGAGATGGCTGCCATTAATACGAAAG
                Then the genes were digested with restriction enzymes and assembled to RBS (BBa_B0030) and terminator (BBa_B0024).

                Construction of the plasmid expressing cellulose synthetase controlled by promoter we designed

                All coding sequences were assembled to RBS and terminator, afterwards, they were embedded downstream the promoter Pcar, which can be activated at high glucose concentration. If you want to know it for details, please click Here.
                The biobricks constructed were showed as bellow:

                All new composite parts mentioned above were transformed to competent cells of Escherichia coli str. DH5α. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.

                Detection of Cellulose Synthesis

                To detect the cellulose synthesis, we used cellulase to degrade cellulose in the cell culture. Then total reducing sugar in the culture was measured. So the difference of total reducing sugar between culture before and after treated with cellulase represents the total cellulose synthetised by the cell. For detailed information, please click Here.

                Results

                Clone of genes

                The gene bcsA is 2619bp, bcsB is 2340bp, bcsZ is 1107 bp, bcsC is 3474bp, galU is 909bp and galF is 894 bp. After PCR amplification, DNA fragments were examined by agarose gel electrophoresis.All genes proved correct. Then the genes were digested with restriction enzymes and embedded into plasmid backbone pSB1A2. To confirm the accuracy of sequences, positive clones were sent for sequencing after transformation. And the results showed that no mutation existed in genes.

                Detection of Cellulose Synthesis

                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

                Retrieved from "http://2012.igem.org/Team:WHU-China/Project"