"
Team:Carnegie Mellon/Bio-Submitted
From 2012.igem.org
(Difference between revisions)
Enpederson (Talk | contribs) |
|||
| Line 152: | Line 152: | ||
<h3 class="pre-experiment">Measured strength of the hybrid T7Lac promoters</h3> | <h3 class="pre-experiment">Measured strength of the hybrid T7Lac promoters</h3> | ||
| - | Using the model we developed in MATLAB, we fitted experimental results of both RNA and protein expression rates and calculated the following properties with respect to the wild-type promoter. | + | We have measured both RNA and protein expression levels of the designed T7Lac promoters using the engineered fluorogen-activated biosensors (see details in Methods). Using the model we developed in MATLAB, we fitted experimental results of both RNA and protein expression rates and calculated the following properties with respect to the wild-type promoter. |
<table border="1"> | <table border="1"> | ||
Revision as of 00:36, 2 October 2012
Submitted Parts
We have submitted three T7Lac promoter parts to the registry. The followings show the sequences of these constructs.
BBa_K613007: TAATACGACTCACTATAGGGAGAGGAATTGTGAGCGGATAACAA
(BBa_K921000) Mutant I: TAATGCGACTCACTATAGGACAATTGTGGGCGGACAACAATTCCAA
(BBa_K921001) Mutant II: TAATACGACTCACTACAGGGCGGAATTGTGAGCGGATAACAATTCCAA
(BBa_K921002) Mutant III: CAATCCGACTCACTAAAGAGAGAATTGTGAGCGGATAACAATTCCAA
Predicted strength of the hybrid T7Lac promoters
Expected promoter strength of the mutants (relative to BBa_K613007):Mutant I: <100%
Mutant II: ~100%
Mutant III: ~50%
Expected LacI leaky expression of different mutants:
Mutant I: More than average
Mutant II: Average
Mutant III: Average
Measured strength of the hybrid T7Lac promoters
We have measured both RNA and protein expression levels of the designed T7Lac promoters using the engineered fluorogen-activated biosensors (see details in Methods). Using the model we developed in MATLAB, we fitted experimental results of both RNA and protein expression rates and calculated the following properties with respect to the wild-type promoter.| Promoter | Mutant I | Mutant II | Mutant III |
|---|---|---|---|
| Transcription Strength | 97% | 72% | 127% |
| Translational Efficiency | 6% | 6% | 94% |
| RNA degradation constant (assumed) | 100% | 100% | 100% |
| Protein degradation constant (fit) | 4% | 6% | 60% |
