"
Team:Trieste/parts
From 2012.igem.org
(Difference between revisions)
Corsogiulia (Talk | contribs) |
Drikicmarija (Talk | contribs) |
||
| Line 103: | Line 103: | ||
<th>Name</th> | <th>Name</th> | ||
<th>Seq 5'--> 3'</th> | <th>Seq 5'--> 3'</th> | ||
| - | <th>Notes</th> | + | <th>PCR Notes</th> |
</tr> | </tr> | ||
</thead> | </thead> | ||
Revision as of 01:37, 27 September 2012
The Jolly JoCare
a safe probiotic platform for protein expression
Parts Overview
More
List of the Submitted Parts
Click on the code of each part to have more information about the Biobrick, its construction, the results obtained and the relative link to the Registry.
| Name | Type | Description | ||
| BBa_K875001 | Regulatory | T5 Cumate Operator | ||
| BBa_K875002 | Regulatory | T5 Lac Operator | ||
| BBa_K875003 | Composit | CymR | ||
| BBa_K875004 | Composit | T5LacO-LPP-OmpA-scFv | ||
| BBa_K875005 | Composit | T5LacO-LPP-OmpA-SIP | ||
| BBa_K875006 | Composit | T5LacO-LPP-PelB-scFv | ||
| BBa_K875007 | Composit | T5 LacO-LPP-PelB-SIP | ||
| BBa_K875008 | Coding | IPTG inducible Tse2 toxin | ||
| BBa_K875009 | Coding | LL 37 - Cathelicidin | ||
| BBa_K875020 | Composit | β-Glucosidase |
Primers
| Name | Seq 5'--> 3' | PCR Notes |
|---|---|---|
| Vr | ATTACCGCCTTTGAGTGAGC | 95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞ |
| Vf2 | TGCCACCTGACGTCTAAGAA | 95° 5' | 30x ( 93° 30" | 50° 30" | 72° 30-120") | 72° 7' | 4° ∞ |
| GlmSTn7Fw | GCATGTGGAAGAGGTGATTG | 95° 5' | 30x (93° 30'' | 53.8° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| GlmSTn7Rev | ACTTTATTGTTCGCCCACA | 95° 5' | 30x (93° 30'' | 53.8° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| B0015XhoRev | ACTCGAGATTACTAGTTATAAACGCAGAAAGGCCCACCC | 95° 5' | 30x (93° 30'' | 58° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| B0015EcoFw | CGAATTCATCAGATCTCCAGGCATCAAATAAAACGAAAGG | 95° 5' | 30x (93° 30'' |58° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| T5EcoFw | CGAATTCATGAGATCTAAATCATAAAAAATTTATTTGCT | 95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
| T5XhoRev | TCTCGAGTTAGGATCCTTTCTCCTCTTTCTCTAGTAATA | 95° 5' | 30x (93° 30'' | 52° 30'' | 72° 30-120'' ) | 72° 7' | 4° ∞ |
