|
|
Line 9: |
Line 9: |
| ===Introduction=== | | ===Introduction=== |
| ---- | | ---- |
- | <html>
| |
| | | |
- | <p><SPAN style='font-size: 150%; font-weight: bold;'>AID with CMV promoter and hGH-polyadenylation signal sequence</SPAN>
| |
- | </p>
| |
- | <table style="color:black" cellpadding="6" cellspacing="1" border="2" align="right">
| |
- | <tr>
| |
- | <th colspan="2" style="background:#66bbff;"><a href="http://partsregistry.org/Part:BBa_K929000" class="external text" title="http://partsregistry.org/Part:BBa_K929000" rel="nofollow">CMV_wtAID_pA</a>
| |
- | </th></tr>
| |
- | <tr>
| |
- | <th colspan="2"><a href="/Image:UP12_PlasmidCMV_wtAID_pA.png" class="image" title="UP12 PlasmidCMV wtAID pA.png"><img alt="" src="/wiki/images/thumb/2/2e/UP12_PlasmidCMV_wtAID_pA.png/300px-UP12_PlasmidCMV_wtAID_pA.png" width="300" height="109" border="0" /></a>
| |
- | </th></tr>
| |
- | <tr>
| |
- | <td><b>BioBrick Nr.</b>
| |
- | </td><td><a href="http://partsregistry.org/Part:BBa_929000" class="external text" title="http://partsregistry.org/Part:BBa_929000" rel="nofollow">BBa_929000</a>
| |
- | </td></tr>
| |
- | <tr>
| |
- | <td><b>RFC standard</b>
| |
- | </td><td><a href="http://partsregistry.org/Help:Assembly_standard_10" class="external text" title="http://partsregistry.org/Help:Assembly_standard_10" rel="nofollow">RFC 10</a>
| |
- | </td></tr>
| |
- | <tr>
| |
- | <td><b>Requirement</b>
| |
- | </td><td>pSB1C3<br />
| |
- | </td></tr>
| |
- | <tr>
| |
- | <td><b>Source</b>
| |
- | </td><td>existing parts:(<a href="http://partsregistry.org/Part:BBa_K103001" class="external text" title="http://partsregistry.org/Part:BBa_K103001" rel="nofollow">BBa_K103001</a>;<a href="http://partsregistry.org/Part:BBa_I712004" class="external text" title="http://partsregistry.org/Part:BBa_I712004" rel="nofollow">BBa_I712004</a>; <a href="http://partsregistry.org/Part:BBa_K404108" class="external text" title="http://partsregistry.org/Part:BBa_K404108" rel="nofollow">BBa_K404108</a>)
| |
- | </td></tr>
| |
- | <tr>
| |
- | <td><b>Submitted by</b>
| |
- | </td><td><a href="https://2012.igem.org/Team:Potsdam_Bioware" class="external text" title="https://2012.igem.org/Team:Potsdam_Bioware" rel="nofollow">Potsdam_Bioware2012</a>
| |
- | </td></tr></table>
| |
- | <p><br />
| |
- | </p>
| |
- | <div class="thumb tleft"><div class="thumbinner" style="width:402px;"><a href="/Image:UP12_PlasmidCMV_wtAID_pA2.png" class="image" title="UP12 PlasmidCMV wtAID pA2.png"><img alt="" src="/wiki/images/thumb/4/41/UP12_PlasmidCMV_wtAID_pA2.png/400px-UP12_PlasmidCMV_wtAID_pA2.png" width="400" height="335" border="0" class="thumbimage" /></a> <div class="thumbcaption"><div class="magnify"><a href="/Image:UP12_PlasmidCMV_wtAID_pA2.png" class="internal" title="Enlarge"><img src="/wiki/skins/common/images/magnify-clip.png" width="15" height="11" alt="" /></a></div></div></div></div><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br /><br />
| |
- | <p>The BioBrick "AID with CMV promoter and hGH-polyadenylation signal sequence" (<a href="http://partsregistry.org/Part:BBa_K929000" class="external text" title="http://partsregistry.org/Part:BBa_K929000" rel="nofollow">BBa_K929000</a>) is an extended version of the existing AID BioBrick (<a href="http://partsregistry.org/Part:BBa_K103001" class="external text" title="http://partsregistry.org/Part:BBa_K103001" rel="nofollow">BBa_K103001</a>). It is built of 3 parts: CMV promoter (<a href="http://partsregistry.org/Part:BBa_I712004" class="external text" title="http://partsregistry.org/Part:BBa_I712004" rel="nofollow">BBa_I712004</a>), AID <a href="http://partsregistry.org/Part:BBa_K103001" class="external text" title="http://partsregistry.org/Part:BBa_K103001" rel="nofollow">BBa_K103001</a>)and hGH polyadenylation signal sequence (<a href="http://partsregistry.org/Part:BBa_K404108" class="external text" title="http://partsregistry.org/Part:BBa_K404108" rel="nofollow">BBa_K404108</a>).<br />
| |
- | <b>AID</b>:<br />
| |
- | AID is known to be responsible for somatic hypermutation and the class-switch recombination of immunoglobulin in B cells. This enzyme of 28 kDa originally occurs in B cells but does also show activity after transfection into CHO cells. AID induces the deamination of cytidine to uridine at actively transcribed single strand DNA. The replacement of cytidine by uridine leads to a mismatch during DNA replication and integrates a single base substitution predominantly in the immunoglobulin genes. <br />
| |
- | <b>CMV promoter:</b><br />
| |
- | CMV is an immediate-early Cytomegalovirus promoter for high-level expression. The CMV promoter is commonly used due to its very strong activity and effectivity in a broad range of cell types. The BioBrick is therefore improved via addition of the strong promoter. <br />
| |
- | <b>hGH polyadenylation signal sequence:</b><br />
| |
- | Polyadenylation is a significant part for the translation and stability of mRNA. In eukaryotes, it is part of the process that produces mature messenger RNA (mRNA) for translation. It, therefore, forms part of the larger process of gene expression. hGH terminator gives a signal to start polyadenylation in the translation process.
| |
- | </p><p><br />
| |
- | </p><p><span class="h3bb">Sequence and Features</span>
| |
- | </p>
| |
- | <script src='http://partsregistry.org/cgi/partsdb/seq_edit/all.js'></script> <DIV id='sequencePaneDiv'> <INPUT type='hidden' id='new_dna_format' name='new_dna_format' value='' /> <INPUT type='hidden' id='selection_start' name='selection_start' value='14' /> <INPUT type='hidden' id='selection_end' name='selection_end' value='0' /></DIV> <script> var sequence = new String('cgatgtacgggccagatatacgcgttgacattgattattgcctagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattactagaaccatggacagcctcttgatgaaccggaggaagtttctttaccaattcaaaaatgtccgctgggctaagggtcggcgtgagacctacctgtgctacgtagtgaagaggcgtgacagtgctacatccttttcactggactttggttatcttcgcaataagaacggctgccacgtggaattgctcttcctccgctacatctcggactgggacctagaccctggccgctgctaccgcgtcacctggttcacctcctggagcccctgctacgactgtgcccgacatgtggccgactttctgcgagggaaccccaacctcagtctgaggatcttcaccgcgcgcctctacttctgtgaggaccgcaaggctgagcccgaggggctgcggcggctgcaccgcgccggggtgcaaatagccatcatgaccttcaaagattatttttactgctggaatacttttgtagaaaaccatgaaagaactttcaaagcctgggaagggctgcatgaaaattcagttcgtctctccagacagcttcggcgcatccttttgcccctgtatgaggttgatgacttacgagacgcatttcgtactttgggactttgaaagctttactagagacgggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtcctt'); var seqFeatures = new Array( ['brick',1,654,'I712004', 1], ['brick',663,1262,'K103001', 1], ['brick',1276,1754,'K404108', 1], ['cds',665,1262,'AID', 0], ['stop',1259,1262,'UGA', 0], ['reg',1,654,'CMV promoter', 0], ['wiggle',663,668,'NcoI', 0], ['polya',1276,1754,'hGH terminator', 1], ['rarrow_p',665,667,'ATG', 0]); var subParts = null; var Format = '_ruler_'; var PrimaryPartID = '25749'; var Selection_Start = 0; var Selection_End = 0; showSeqFeatures(false); </script><div style='position:relative;clear:both;width:100%'><div style=''>
| |
- | <p><STYLE type='text/css'>
| |
- | .compatibility_div ul,
| |
- | .compatibility_div li {
| |
- | display: inline;
| |
- | }
| |
- | .compatibility_div li {
| |
- | position: relative;
| |
- | padding-top: 2px;
| |
- | padding-left:4px;
| |
- | padding-right:3px;
| |
- | margin-right:2px;
| |
- | margin-bottom: 5px;
| |
- | }
| |
- | .compatibility_div .box {
| |
- | top: 35px;
| |
- | width: 200px;
| |
- | left: 0px;
| |
- | }
| |
- | .compatibility_div .box_white {
| |
- | border: 1px solid gray;
| |
- | background-color: white;
| |
- | }
| |
- | .compatibility_div .box_red {
| |
- | border: 1px solid #dd6666;
| |
- | background-color: #ffcccc;
| |
- | background-image: url('http://partsregistry.org/images/red_not/red_box.png');
| |
- | background-repeat: none;
| |
- | }
| |
- | .compatibility_div .box_green {
| |
- | border: 1px solid #44ee44;
| |
- | background-color: #aaffaa;
| |
- | }
| |
- | </p><p><br />
| |
- | </p>
| |
- | </html>
| |
| {{:Team:Potsdam_Bioware/css}} | | {{:Team:Potsdam_Bioware/css}} |