Team:Trieste/parts/10

From 2012.igem.org

(Difference between revisions)
Line 11: Line 11:
<h2>Description </h2>  
<h2>Description </h2>  
This part is composed by J23100-B0034-β-glucosidase-B0015. When this part is expressed in bacteria, they become able to metabolize cellobiose converting it in two molecules of glucose.<br/>
This part is composed by J23100-B0034-β-glucosidase-B0015. When this part is expressed in bacteria, they become able to metabolize cellobiose converting it in two molecules of glucose.<br/>
 +
<br/>
 +
<center><img src="https://static.igem.org/mediawiki/igem.org/5/56/Trieste_B-Glucosidase_V.jpg" width="500px"/></center>
 +
<br/>
 +
<strong>This part is an improvement of part BBa_K392008 that was used by UNITS_Trieste 2011 Team, but was non functional.</strong>
<strong>This part is an improvement of part BBa_K392008 that was used by UNITS_Trieste 2011 Team, but was non functional.</strong>
<br/>
<br/>

Revision as of 22:54, 25 September 2012

BBa_K875020

More

Description

This part is composed by J23100-B0034-β-glucosidase-B0015. When this part is expressed in bacteria, they become able to metabolize cellobiose converting it in two molecules of glucose.


This part is an improvement of part BBa_K392008 that was used by UNITS_Trieste 2011 Team, but was non functional.

Assembly

This composite part is developed by previous work by UNITS iGEM team 2011 and Edinburgh team 2011. They discovered that BBa_K392008 (Osaka 2010), coding for a Cellumonas fimi β-glucosidase, possess an apparent frameshift near the start of the coding sequence. The coding sequence has now been determined to start from an ATG located 220 bp downstream of the reported one. We therefore decided to correct the Bba_K392008 in order to have the correct coding sequence. In order to do this we made a PCR on Bba_K392008 by using the following primers:

β-Glucosidase_Fw
GCATGAATTCGCGGCCGCTTCTAGATGACCACCACGCGCCCCTC

β-Glucosidase_Rev
GCATCTGCAGCGGCCGCTACTAGTATCAGGGCTGGTAGGTCGCGG

Results

The new Cellulomonas fimi β-Glucosidase was sequenced and then assembled in a transcriptional unit together with J23100, B0034 and B0015.
E.coli cells expressing the β-Glucosidase were able to grow in M9 minimal medium supplemented with cellobiose 1% as the only C source while E.coli without this composite part are not able to grow.


Looking forward


Link to the Registry


Università degli studi di Trieste ICGEB Illy Fondazione Cassa di Risparmio
iGEM 2012 iGEM 2012 iGEM 2012 iGEM 2012 iGEM 2012 iGEM 2012
HTML Hit Counter