|
|
| Line 1: |
Line 1: |
| - | <html>
| |
| - | <link rel="stylesheet" href="https://2012.igem.org/wiki/index.php?title=Team:TU_Darmstadt/css&action=raw&ctype=text/css" type="text/css" />
| |
| - | <div id="TUD">
| |
| - | <div id="top">
| |
| - | <ul>
| |
| - | <li><a href="http://www.igem.tu-darmstadt.de/igem/projekt/index.en.jsp" title="iGEM">iGEM@TUD</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt" title="Home">Home</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Project" title="Project">Project</a><ul>
| |
| - | <li><a href="/Team:TU_Darmstadt/Project" title="Team:Overview">Overview</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Project/Degradation" title="Degradation">1. Degradation</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Project/Transport" title="Transport">2. Transport</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Project/Metabolism" title="Metabolism">3. Metabolism</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Project/Material_Science" title="Material Science">4. Material Science</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Project/Simulation" title="Simulation">5. Simulation</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Project/Ecology" title="Ecology">Ecology</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Project/Philosophy" title="Philosophy">Philosophy</a></li></ul></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Team" title="Team:TU_Darmstadt/Team">Team</a><ul>
| |
| - | <li><a href="/Team:TU_Darmstadt/Team" title="Team:TU_Darmstadt/Team">Members</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Supporters" title="Team:TU_Darmstadt/Supporters">Supporters</a></li></ul></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Parts" title="BioBricks">BioBricks</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Documentation" title="Documentation">Documentation</a><ul>
| |
| - | <li><a href="/Team:TU_Darmstadt/Documentation" title="Documentation">Overview</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Labjournal" title="Labjournal">Labjournal</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Protocols" title="Protocols">Protocols</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Materials" title="Materials">Materials</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Modeling" title="Modeling">Modeling</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Safety" title="Safety">Safety</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Downloads" title="Downloads">Downloads</a></li></ul></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Human_Practice" title="Human Practice">Human Practice</a><ul>
| |
| - | <li><a href="/Team:TU_Darmstadt/Human_Practice/Panel_Discussion " title="Panel Discussion">Panel Discussion</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Human_Practice/Symposia" title="Symposia">Symposia</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Human_Practice/Classes" title="Classes">Classes</a></li></ul></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Sponsors" title="Sponsors">Sponsors</a><ul>
| |
| - | <li><a href="/Team:TU_Darmstadt/Sponsors" title="Sponsors">Overview</a></li>
| |
| - | <li><a href="/Team:TU_Darmstadt/Contact" title="Contact">Benefits</a></li></ul></li>
| |
| - | </ul>
| |
| - | <div id="igem"><a href="https://2012.igem.org/Main_Page"></a></div>
| |
| - | </div>
| |
| - | <!-- end #menu -->
| |
| - | </html>
| |
| | | | |
| - | <span style="font-size:200%;"><span style="color:#00689D;">Materials</span></span>
| |
| - |
| |
| - |
| |
| - | ==Primer==
| |
| - |
| |
| - | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
| - | |- style="font-size:11pt;font-weight:bold" align="center" valign="bottom"
| |
| - | | width="22" height="15" | No.
| |
| - | | width="89" | Name
| |
| - | | width="422" | 5´-->3´
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 1
| |
| - | | tphA2-l-F
| |
| - | | TCATGCTTGCATCTCCTGTC
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 2
| |
| - | | tphA2-l-Prefix
| |
| - | | GAATTCGCGGCCGCTTCTAGATGCAAGAATCCATCATCCAGTGGC
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 3
| |
| - | | tphA1-Suffix_R
| |
| - | | CTGCAGCGGCCGCTACTAGTACTAATGGTTGCCAGTCGGGTCTG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 4
| |
| - | | tphA3-Suffix_R
| |
| - | | CTGCAGCGGCCGCTACTAGTATCATAGCGGCAATGACATCAGCGTG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 5
| |
| - | | tphA3-Prefix_F
| |
| - | | GAATTCGCGGCCGCTTCTAGATGATCCATGAAATTCAAATCGCGG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 6
| |
| - | | tphA1-l-R
| |
| - | | CTAATGGTTGCCAGTCGGGT
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 7
| |
| - | | tphA1-l-PstI(99)-F
| |
| - | | CATGGTCTCCTCCAGGCCGGCATCGAGCT
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 8
| |
| - | | tphA1-l-Prefix
| |
| - | | GAATTCGCGGCCGCTTCTAGATGAACCACCAGATCCATATCCACG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 9
| |
| - | | tphA3-l-F
| |
| - | | TCATAGCGGCAATGACATCA
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 10
| |
| - | | tphA3-l-Prefix
| |
| - | | GAATTCGCGGCCGCTTCTAGAGATGATCCATGAAATTCAAATCGC
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 11
| |
| - | | Prefix
| |
| - | | GAATTCGCGGCCGCTTCTAGAG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 12
| |
| - | | tphB-l-F
| |
| - | | TCAGACCGGTTGGGCTCCGA
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 13
| |
| - | | tphB-l-Prefix
| |
| - | | GAATTCGCGGCCGCTTCTAGAGATGACAATAGTGCACCGTAGATT
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 14
| |
| - | | tphA2-l-R
| |
| - | | ATGCAAGAATCCATCATCCAG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 15
| |
| - | | tphA1-l-R
| |
| - | | ATGAACCACCAGATCCATATC
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 16
| |
| - | | tphA1-l-PstI(99)-R
| |
| - | | CATGGTCTCCTGGAGGGCTGCATCCAGTAC
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 17
| |
| - | | tphA3-l-R
| |
| - | | ATGATCCATGAAATTCAAAT
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 18
| |
| - | | Suffix
| |
| - | | CTGCAGCGGCCGCTACTAGTA
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 19
| |
| - | | tphB-l-Suffix-R
| |
| - | | CTGCAGCGGCCGCTACTAGTATCAGACCGGTTGGGCTCCGAGTA
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 20
| |
| - | | EcoRIGFxa-tphA1
| |
| - | | TTCTGGAATTCGGGTATTGAAGGAAGAATGAACCACCAGATCCATAT
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 21
| |
| - | | EcoRIGFxa-tphA2
| |
| - | | TTCTGGAATTCGGGTATTGAAGGAAGAATGCAAGAATCCATCATCCA
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 22
| |
| - | | EcoRIGFxa-tphA3
| |
| - | | TTCTGGAATTCGGGTATTGAAGGAAGAATGATCCATGAAATTCAAAT
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 23
| |
| - | | EcoRIGFxa-tphB
| |
| - | | TTCTGGAATTCGGGTATTGAAGGAAGAATGACAATAGTGCACCGTAG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 24
| |
| - | | EcoRIGFxa-aroY
| |
| - | | TTCTGGAATTCGGGTATTGAAGGAAGAATGACAGCGCCTATCCAG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 25
| |
| - | | RBS-tphA1
| |
| - | | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGAACCACCAGATCCATAT
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 26
| |
| - | | RBS-tphA2
| |
| - | | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGCAAGAATCCATCATCCA
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 27
| |
| - | | RBS-tphA3
| |
| - | | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGATCCATGAAATTCAAAT
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 28
| |
| - | | RBS-tphB
| |
| - | | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGACAATAGTGCACCGTAG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 29
| |
| - | | RBS-aroY
| |
| - | | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGACAGCGCCTATCCAG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 30
| |
| - | | VF2
| |
| - | | TGCCACCTGACGTCTAAGAA
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 31
| |
| - | | VR
| |
| - | | ATTACCGCCTTTGAGTGAGC
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 32
| |
| - | | pPR-IBA2 rev
| |
| - | | TAGTTATTGCTCAGCGGTGG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 33
| |
| - | | pPR-IBA2 for
| |
| - | | TAATACGACTCACTATAGGG
| |
| - |
| |
| - | |}
| |
| - |
| |
| - | ==Plasmids==
| |
| - |
| |
| - | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
| - | |- style="font-size:11pt;font-weight:bold" align="center"
| |
| - | | width="60" height="15" | No.
| |
| - | | width="60" | Name
| |
| - | | width="60" | Sequence
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 1
| |
| - | | pSB1C3
| |
| - | |style="text-decoration:underline;color:#0000FF" | [http://partsregistry.org/Part:pSB1C3 Get]
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold;text-decoration:none" align="center" height="15" | 2
| |
| - | | pSB1AK3
| |
| - | |style="text-decoration:underline;color:#0000FF" | [http://partsregistry.org/Part:pSB1AK3 Get]
| |
| - |
| |
| - | |- align="center"
| |
| - | |style="font-size:11pt;font-weight:bold;text-decoration:none" align="center" height="15" | 3
| |
| - | | BBa_J61002
| |
| - | |style="font-size:11pt;text-decoration:underline;color:#0000FF" | [http://partsregistry.org/Part:BBa_J61002 Get]
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold;text-decoration:none" align="center" height="15" | 4
| |
| - | | pSB1A2
| |
| - | |style="text-decoration:underline;color:#0000FF" | [http://partsregistry.org/Part:pSB1A2 Get]
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold;text-decoration:none" align="center" height="15" | 5
| |
| - | | pPR-IBA2
| |
| - | |style="text-decoration:underline;color:#0000FF" | [http://www.iba-lifesciences.com/isotope/2/2-1391-000-Sequence-pPR-IBA2.txt Get]
| |
| - |
| |
| - | |}
| |
| - |
| |
| - | ==Biobricks from the registry==
| |
| - |
| |
| - | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
| - | |- style="font-size:11pt;font-weight:bold" align="center"
| |
| - | | width="60" height="15" | No.
| |
| - | | width="65" | Name
| |
| - | | width="60" | Platte
| |
| - | | width="60" | Well
| |
| - | | width="60" | Resistence
| |
| - | | width="90" | Plasmid backbone
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 1
| |
| - | | BBa_K316003
| |
| - | | align="center" | 4
| |
| - | | 15C
| |
| - | | C
| |
| - | | pSB1C3
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 2
| |
| - | | BBa_J23100
| |
| - | | align="center" | 1
| |
| - | | 18C
| |
| - | | A
| |
| - | | BBa_J61002
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 3
| |
| - | | BBa_B0015
| |
| - | | align="center" | 1
| |
| - | | 23L
| |
| - | | A und K
| |
| - | | pSB1AK3
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 4
| |
| - | | BBa_J61101
| |
| - | | align="center" | 1
| |
| - | | 5L
| |
| - | | A
| |
| - | | pSB1A2
| |
| - |
| |
| - | |}
| |
| - |
| |
| - |
| |
| - | ==Bacteria==
| |
| - |
| |
| - | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
| - | |- style="font-size:11pt;font-weight:bold" align="center"
| |
| - | | width="180" height="30" | Species
| |
| - | | width="76" | Strain
| |
| - | | width="501" | Genotype
| |
| - | | width="46" | DSM-No.
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | | height="22" | Escherichia coli
| |
| - | | DH5α
| |
| - | | F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK- mK+), λ–
| |
| - | | 6897
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | | height="17" | Escherichia coli
| |
| - | | MG1655
| |
| - | | F- λ- ilvG- rfb-50 rph-1
| |
| - | | 18039
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | | height="19" | Escherichia coli
| |
| - | | BL21(DE3)pLysS
| |
| - | | F- ompT gal dcm lon hsdSB(rB- mB-) λ(DE3) pLysS(cmR)
| |
| - | | none
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | | height="15" | Comamonas testosteroni
| |
| - | | Kf-1
| |
| - | | -
| |
| - | | 14576
| |
| - |
| |
| - | |}
| |
| - |
| |
| - | ==Enzymes==
| |
| - |
| |
| - | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
| - | |- style="font-size:11pt;font-weight:bold" align="center"
| |
| - | | width="60" height="15" | No.
| |
| - | | width="250" | Enzyme
| |
| - | | width="154" | Supplier
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 1
| |
| - | | Antarctic Phosphatase
| |
| - | | NEB
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 2
| |
| - | | BsaI
| |
| - | | NEB
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 3
| |
| - | | EcoRI-HF
| |
| - | | NEB
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 4
| |
| - | | Phusion® High-Fidelity DNA Polymerase
| |
| - | | NEB
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 5
| |
| - | | PstI-HF
| |
| - | | NEB
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 6
| |
| - | | SpeI-HF
| |
| - | | NEB
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 7
| |
| - | | T4 DNA Ligase
| |
| - | | NEB
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 8
| |
| - | | Taq DNA Polymerase with ThermoPol Buffer
| |
| - | | NEB
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 9
| |
| - | | XbaI
| |
| - | | NEB
| |
| - |
| |
| - | |}
| |
| - |
| |
| - | ==Chemicals==
| |
| - |
| |
| - | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
| - | |- style="font-size:11pt;font-weight:bold" align="center" valign="bottom"
| |
| - | | width="60" height="15" | No.
| |
| - | | width="332" | Name
| |
| - | | width="104" | Firma
| |
| - | | width="77" | Order-ID
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 1
| |
| - | | Terephthalat
| |
| - | | Sigma-Aldrich
| |
| - | | 185361-500G
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 2
| |
| - | | Acetic acid
| |
| - | | Roth
| |
| - | | 6755.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 3
| |
| - | | Methanol
| |
| - | | Roth
| |
| - | | CP43.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 4
| |
| - | | Coomassie Brilliant Blue R-250
| |
| - | | Roth
| |
| - | | 9598.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 5
| |
| - | | Trypton
| |
| - | | Roth
| |
| - | | 8952.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 6
| |
| - | | Ethylene glycol
| |
| - | | Roth
| |
| - | | 9516.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 7
| |
| - | | 3,4-Dihydroxybenzoic acid
| |
| - | | Sigma-Aldrich
| |
| - | | 37580-25G-F
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 8
| |
| - | | Catechol
| |
| - | | Sigma-Aldrich
| |
| - | | C9510-100G
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 9
| |
| - | | Isopropyl β-D-1-thiogalactopyranoside
| |
| - | | Roth
| |
| - | | CN08.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 10
| |
| - | | Tetramethylethylenediamine
| |
| - | | Roth
| |
| - | | 2367.3
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 11
| |
| - | | Ammonium persulfate
| |
| - | | Roth
| |
| - | | 9592.3
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 12
| |
| - | | Bromophenol blue
| |
| - | | Roth
| |
| - | | A512.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 13
| |
| - | | Glucose
| |
| - | | Roth
| |
| - | | X997.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 14
| |
| - | | Calcium chloride
| |
| - | | Roth
| |
| - | | CN92.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 15
| |
| - | | Dithiothreitol
| |
| - | | Roth
| |
| - | | 6908.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 16
| |
| - | | Sodium carbonate
| |
| - | | Roth
| |
| - | | 8563.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 17
| |
| - | | Phenylmethanesulfonylfluoride
| |
| - | | Roth
| |
| - | | 6367.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 18
| |
| - | | NADH-Disodium
| |
| - | | Roth
| |
| - | | AE12.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 19
| |
| - | | Nicotinamide adenine dinucleotide
| |
| - | | Roth
| |
| - | | AE11.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 20
| |
| - | | orthophosphoric acid 85%
| |
| - | | Roth
| |
| - | | 9079.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 21
| |
| - | | Trichloroacetic acid
| |
| - | | Roth
| |
| - | | 8789.2
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 22
| |
| - | | Quick-Load® 100 bp DNA Ladder
| |
| - | | NEB Biolabs
| |
| - | | N0467S
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 23
| |
| - | | Phenol
| |
| - | | AppliChem
| |
| - | | A4458.0250
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 24
| |
| - | | Dimethyl sulfoxide
| |
| - | | AppliChem
| |
| - | | A1584.0100
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 25
| |
| - | | Methylene blue
| |
| - | | AppliChem
| |
| - | | A4084.0025
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 26
| |
| - | | Magnesium sulfate
| |
| - | | AppliChem
| |
| - | | A6287.0250
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 27
| |
| - | | Cetrimonium bromide
| |
| - | | AppliChem
| |
| - | | A0805.0100
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 28
| |
| - | | Tetramethylethylenediamine
| |
| - | | AppliChem
| |
| - | | A1148.0025
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 29
| |
| - | | Urea
| |
| - | | AppliChem
| |
| - | | A5470.0500
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 30
| |
| - | | Tween20
| |
| - | | AppliChem
| |
| - | | A1389.0500
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 31
| |
| - | | Protein Marker III (6,5-200)
| |
| - | | AppliChem
| |
| - | | A4402.0001
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 32
| |
| - | | Thiamine hydrochloride
| |
| - | | AppliChem
| |
| - | | A09955.0050
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 33
| |
| - | | Triton X-100
| |
| - | | AppliChem
| |
| - | | A1388.0500
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 34
| |
| - | | DNA-Dye NonTox
| |
| - | | AppliChem
| |
| - | | A9555.1000
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 35
| |
| - | | Agarose
| |
| - | | Roth
| |
| - | | 3810.2
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 36
| |
| - | | Ethanol 96 %
| |
| - | | Roth
| |
| - | | T171.4
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 37
| |
| - | | Ethylenediaminetetraacetic acid
| |
| - | | Roth
| |
| - | | X986.2
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 38
| |
| - | | Ethanol
| |
| - | | Roth
| |
| - | | P076.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 39
| |
| - | | Tetracycline hydrochloride
| |
| - | | Roth
| |
| - | | 237.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 40
| |
| - | | D-Desthiobiotin 10x Buffer E
| |
| - | | iba
| |
| - | | 2-1000-025
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 41
| |
| - | | 2-(4-Hydroxyphenylazo)benzoic acid
| |
| - | | Sigma-Aldrich
| |
| - | | H5126-5G
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 42
| |
| - | | 10 mM dNTP-Mix
| |
| - | | Roth
| |
| - | | L785.2
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 43
| |
| - | | Hydrochloric acid
| |
| - | | Roth
| |
| - | | 9277.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 44
| |
| - | | Acrylamid - Bis (37,5:1)
| |
| - | | Roth
| |
| - | | 3029.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 45
| |
| - | | Ammonium acetate
| |
| - | | Roth
| |
| - | | 7869.2
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 46
| |
| - | | Agar-Agar
| |
| - | | Roth
| |
| - | | 5210.3
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 47
| |
| - | | Chloroform
| |
| - | | Roth
| |
| - | | 4423.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 48
| |
| - | | Glycine
| |
| - | | Roth
| |
| - | | 3790.2
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 49
| |
| - | | Dipotassium phosphate
| |
| - | | Roth
| |
| - | | T875.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 50
| |
| - | | Sodium chloride
| |
| - | | Roth
| |
| - | | 9265.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 51
| |
| - | | Yeast extract
| |
| - | | Roth
| |
| - | | 2363.2
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 52
| |
| - | | Monopotassium phosphate
| |
| - | | Roth
| |
| - | | P018.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 53
| |
| - | | Glycerine
| |
| - | | Roth
| |
| - | | 3783.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 54
| |
| - | | Sodium hydroxide
| |
| - | | Roth
| |
| - | | P031.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 55
| |
| - | | Tris-Base
| |
| - | | Roth
| |
| - | | AE15.2
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 56
| |
| - | | Isopropyl alcohol
| |
| - | | Roth
| |
| - | | CP41.3
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 57
| |
| - | | Isoamyl alcohol
| |
| - | | Roth
| |
| - | | T870.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 58
| |
| - | | Acetonitrile
| |
| - | | Roth
| |
| - | | 7330.2
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 59
| |
| - | | Acetone
| |
| - | | Roth
| |
| - | | 5025.5
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 60
| |
| - | | Chloramphenicol
| |
| - | | Roth
| |
| - | | 3886.2
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 61
| |
| - | | Ampicillin
| |
| - | | Roth
| |
| - | | K029.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 62
| |
| - | | Kanamycin
| |
| - | | Roth
| |
| - | | T832.1
| |
| - |
| |
| - | |- style="font-size:11pt" align="center" valign="bottom"
| |
| - | |style="font-weight:bold" align="center" height="15" | 63
| |
| - | | Sodium dodecyl sulfate
| |
| - | | Roth
| |
| - | | 5136.1
| |
| - |
| |
| - | |}
| |
| - |
| |
| - |
| |
| - | ==Kits==
| |
| - |
| |
| - | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
| - | |- style="font-size:11pt;font-weight:bold" align="center"
| |
| - | | width="60" height="15" | No.
| |
| - | | width="250" | Kit
| |
| - | | width="154" | Supplier
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 1
| |
| - | | PureYield™ Plasmid Miniprep System
| |
| - | | Promega
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 2
| |
| - | | PureYield™ Plasmid Midiprep System
| |
| - | | Promega
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 3
| |
| - | | Wizard® SV Gel and PCR Clean-Up System
| |
| - | | Promega
| |
| - |
| |
| - | |}
| |
| - |
| |
| - | ==Consumabels==
| |
| - |
| |
| - | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
| - | |- style="font-size:11pt;font-weight:bold" align="center"
| |
| - | | width="60" height="15" | No.
| |
| - | | width="250" | Article
| |
| - | | width="154" | Supplier
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 1
| |
| - | | epT.I.P.S.® Box pipette tips 0.1–20 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 2
| |
| - | | epT.I.P.S.® Box pipette tips 10–200 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 3
| |
| - | | epT.I.P.S.® Box pipette tips 100–1000 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 4
| |
| - | | epT.I.P.S.® Bulk pipette tips 0.1–20 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 5
| |
| - | | epT.I.P.S.® Bulk pipette tips 10–200 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 6
| |
| - | | epT.I.P.S.® Bulk pipette tips 100–1000 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 7
| |
| - | | PCR Tubes 0.2 mL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 8
| |
| - | | PCR Tube Strips 0.2 mL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 9
| |
| - | | Safe-Lock Tubes (1.5 mL)
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 10
| |
| - | | Safe-Lock Tubes (2 mL)
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 11
| |
| - | | Rotilabo®-syringe filters
| |
| - | | Carl Roth GmbH
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 12
| |
| - | | NORM-Ject Syringes
| |
| - | | Henke/Sass/Wolf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 13
| |
| - | | Multiply®-PCR-tubes 0.2 mL
| |
| - | | Sarstedt
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 14
| |
| - | | VWR® Pipet Tips (Standard Tips, 0.1–20 µL)
| |
| - | | VWR
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 15
| |
| - | | VWR® Pipet Tips (Standard Tips, 10–200 µL)
| |
| - | | VWR
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 16
| |
| - | | VWR® Pipet Tips (Standard Tips, 100-1000 µL)
| |
| - | | VWR
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 17
| |
| - | | VWR® Powder-Free Nitrile Examination Gloves
| |
| - | | VWR
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 18
| |
| - | | Eco-friendly centrifuge tubes (15 mL, unsterile)
| |
| - | | Carl Roth GmbH
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 19
| |
| - | | 50 mL Centrifuge tubes, sterile
| |
| - | | Greiner bio-one
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 20
| |
| - | | Sekuroka®-disposal bags
| |
| - | | Carl Roth GmbH
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 21
| |
| - | | Rotiprotect®-nitrile gloves, unpowdered
| |
| - | | Carl Roth GmbH
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 22
| |
| - | | UV-cuvettes PLASTIBRAND® (Micro z = 8,5 mm)
| |
| - | | Brand GmbH & Co. KG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 23
| |
| - | | Parafilm® M
| |
| - | | Pechiney Plastic Packaging
| |
| - |
| |
| - | |}
| |
| - |
| |
| - | ==Equipment==
| |
| - |
| |
| - | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
| - | |- style="font-size:11pt;font-weight:bold" align="center"
| |
| - | | width="60" height="15" | No.
| |
| - | | width="250" | Equipment
| |
| - | | width="154" | Supplier
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 1
| |
| - | | Mastercycler personal (Thermocycler)
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 2
| |
| - | | Heraeus Pico Microcentrifuge
| |
| - | | Thermo Scientific
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 3
| |
| - | | Multifuge® 1S-R
| |
| - | | Thermo Scientific
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 4
| |
| - | | VX-150 Autoclave
| |
| - | | Systec
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 5
| |
| - | | Uni-Drybath Thermoshaker
| |
| - | | Universal Labortechnik
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 6
| |
| - | | Vortex Genie 2
| |
| - | | Scientific Industries
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 7
| |
| - | | Universal Centrifuge
| |
| - | | Sigma Laborzentrifugen
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 8
| |
| - | | Dark Hood DH-40 with control panel and display
| |
| - | | Biostep
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 9
| |
| - | | BioMate 3S Spectrophotometer
| |
| - | | Thermo Scientific
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 10
| |
| - | | GENESYS 10S UV-Vis
| |
| - | | Thermo Scientific
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 11
| |
| - | | Heraeus LaminAir HA 2448 GS
| |
| - | | Heraeus
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="30" | 12
| |
| - | | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 10 µL
| |
| - | | VWR
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="30" | 13
| |
| - | | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 100 µL
| |
| - | | VWR
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="30" | 14
| |
| - | | Signature™ Ergonomic High Performance Single-Channel Variable Volume Pipettors 1000 µL
| |
| - | | VWR
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 15
| |
| - | | Research® plus, adjustable pipette 0.5 - 10 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 16
| |
| - | | Research® plus, adjustable pipette 10 - 100 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 17
| |
| - | | Research® plus, adjustable pipette 100 – 1000 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 18
| |
| - | | Research® plus, adjustable pipette 10 - 200 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 19
| |
| - | | Research® plus, adjustable pipette 0.5 - 20 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 20
| |
| - | | Reference, adjustable pipette 0.5 – 10 µL
| |
| - | | Eppendorf
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 21
| |
| - | | M-Prove Balances
| |
| - | | Sartorius
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 22
| |
| - | | M-Power Balances
| |
| - | | Sartorius
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 23
| |
| - | | Owl Series EasyCast™ Horizontal Mini-Gel Systems
| |
| - | | VWR
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 24
| |
| - | | Owl Series Horizontal Gel Systems
| |
| - | | VWR
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 25
| |
| - | | Owl Series Dual Gel Vertical Electrophoresis System
| |
| - | | VWR
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 26
| |
| - | | Power Supplies 250V
| |
| - | | VWR
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 27
| |
| - | | Incubation/Inactivation Water Bath 1008
| |
| - | | Gesellschaft für Labortechnik
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 28
| |
| - | | Lab-Shaker LSR-V
| |
| - | | Adolf Kühner AG
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 29
| |
| - | | MR Hei-Mix S
| |
| - | | Heidolph
| |
| - |
| |
| - | |- style="font-size:11pt" align="center"
| |
| - | |style="font-weight:bold" align="center" height="15" | 30
| |
| - | | FE20 – FiveEasy™ pH
| |
| - | | Mettler Toledo
| |
| - |
| |
| - | |}
| |
"
