Overview

Three problems came up while we start calculating: what sequences to input, which method to use and how cogent the result will be. As for sequence, we input the both the SD and the protein coding sequence.

Our goal is to calculate the total ΔG of each reaction and then predict the amount of protein expressed. There are several softwares dealing with DNA or RNA base-pairing progress, such as NUPACK, RBS-Calculator, and Vienna RNA etc. After comparison, we decide to use RBS-Calculator.

Due to the complication of translation progress and our lack of insight in this issue, the results of our modeling can’t be very precise. But at least it should have the precision of order of magnitude.

Input of Our Calculation

• RFP, normal RBS

ATTTCACACATACTAGAGAAAGAGGAGAAATACTAGATGGCTTCCTCCGAAGACGTTATCAAAGAGTTCATGC

GTT

• RFP, orthogonal RBS

ATTTCACACATGTTCCGTACTAGATGGCTTCCTCCGAAGACGTTATCAAAGAGTTCATGCGTT

• GFP, normal RBS

TACTAGAGAAAGAGGAGAAATACTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTT