Team:WHU-China/Project/fatty acid degradation

From 2012.igem.org

(Difference between revisions)
Line 1: Line 1:
-
<HTML>
+
<!DOCTYPE HTML PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
-
<h1>
+
<!-- XHTML 1.0 Transitional DTD -->
-
            Fatty Acid Degradation Device
+
-
            </h1>
+
-
<h2>
+
-
            Purpose
+
-
</h2>
+
-
            <p>
+
-
            To help people lose weight without the need of food restriction. We designed a genetically modified <i>E.coli</i> that can sense and degrade excessive fatty acid intake by the host. We hope that, together with other two devices we designed, we can introduce our <i>E.coslim</i> as resident in intestine to consume the excessive calories intake by the host and regulate intestinal microbiota.
+
-
            </p>
+
-
<h2>
+
-
            Outline
+
-
</h2>
+
-
           
+
-
<P>
+
-
<img src="https://static.igem.org/mediawiki/2012/7/76/Fatty_Acid_M.png" width="300" height="400" hspace="2" vspace="1" border="2" style="float:left" />
+
-
Genes that are responsible for degradation and transportation of fatty acids (FAs) from <i>E.coli K12</i> and from <i>Salmonella enterica LT2</i> were cloned. Also, promoter that can under the sole regulation of fatty acids was also designed. By placing those fatty acids degradation genes downstream of the artificially designed promoter that can sense the concentration of FAs. We hope to create a device that to degrade FAs only when the concentration of FAs is high.
+
<html xmlns="http://www.w3.org/1999/xhtml">
-
            </p>
+
<head>
-
<p>
+
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
-
Long chain fatty acids are firstly being imported by the transmembrane protein FadL. After FAs get into cells, a CoA will be added by inner membrane-associated FadD (acyl-CoA synthase). β-oxidation is initiated by FadE(acyl-CoA dehydrogenase), which will convert acyl-CoA into enoyl-CoA. The followed cycles of hydration, oxidation, and thiolytic cleavage are carried out by tetrameric complex consisting of two FadA and two FadB proteins or two FadI and two FadJ in anaerobic condition. FadR is a transcriptional regulator that, when not binds to acyl-CoA, can either serve as activator for fatty acid synthetase gene like FabA, FabB and etc. or repressor for fatty acid degradation gene like FadA, FadB, FadD FadE, FadL, FadI, FadJ and etc. After long chain fatty acid is converted to fatty acyl- CoA by FadD, it can bind to FadR. The binding will alter the conformation of FadR, making FadR unable to bind to the DNA sequence it recognizes to fulfill its function. Therefore, FadR can no longer activate or repress the transcription of genes downstream FadR binding sites. However, to our knowledge, there is no promoter exists in nature that can respond solely to FadR since those promoters are often regulated by glucose concentration or oxidative stress and many other factors.</br>
+
<title>whu</title>
-
In our design, FadL, FadD, FadE, FadA, FadB FadI, FadJ and FadA from <i>Escherichia coli K12</i>, and FadA, FadB and FadE from <i>Salmonella enterica LT2</i> are placed downstream a synthetic promoter PfadR (BBa_K861060) to make them under the sole regulation of fatty acids concentration.</br>
+
<link href="logo.ico" type="image/x-icon" rel="Shortcut Icon" />
-
</br>
+
<style type="text/css">
 +
/*
 +
* base css, DO NOT MODIFY!
 +
*/
 +
* {
 +
margin: 0;
 +
padding: 0;
 +
border: 0;
 +
font-family: "Verdana", sans-serif;
 +
color: #333;
 +
list-style: none;
 +
outline: none;
 +
resize: none;
 +
}
 +
html {
 +
overflow-y: scroll;
 +
}
 +
body {
 +
background: url("body-bg.jpg") center center fixed;
 +
}
 +
a {
 +
text-decoration: none;
 +
}
 +
.clear {
 +
width: 0;
 +
height: 0;
 +
line-height: 0;
 +
display: block;
 +
clear: both;
 +
}
-
</p>
+
/*
-
 
+
* common css, include "header","footer"...
-
<h2>
+
*/
-
Progress
+
div.center {
-
</h2>
+
width: 940px;
-
<h3>
+
margin: 0 auto;
-
Cloning of the gene
+
}
-
</h3>
+
div.header {
-
<p>
+
width: 940px;
-
First, the genome of <i>Escherichia coli K12 str. DH5ɑ</i> and <i>Salmonella enterica LT2</i> (symbolized as S-) were got and amplified in PCR using primer for each gene. The sequences of the primers used are as bellow (5’---3’).</br>
+
height: 357px;
-
 
+
background: url("header-bg.png") no-repeat;
-
FadR  Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG</br>
+
position: relative;
-
      Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC</br>
+
z-index: 50;
-
 
+
}
-
FadA  Forward: GGAATTCTCTAGAATGGAACAGGTTGTCATTGTCG</br>
+
div.nav {
-
      Reverse: GACTAGTTTAAACCCGCTCAAACACCGT</br>
+
position: absolute;
-
 
+
height: 80px;
-
FadB  Forward: GGAATTCTCTAGAATGCTTTACAAAGGCGACACC</br>
+
top: 206px;
-
      Reverse: GACTAGTTTAAGCCGTTTTCAGGTCGCC</br>
+
left: 350px;
-
 
+
}
-
FadD  Forward: GGAATTC TCTAGATTGAAGAAGGTTTGGCTTAACCG</br>
+
li.nav-outerLi {
-
      Reverse: GACTAGTTCAGGCTTTATTGTCCACTTTGC</br>
+
display: block;
-
 
+
float: left;
-
FadE  Forward: GGAATTC TCTAGAATGATGATTTTGAGTATTCTCG</br>
+
width: 80px;
-
      Reverse: GACTAGTTTACGCGGCTTCAACTTTCCG</br>
+
height: 80px;
-
 
+
margin: 0 6px;
-
FadL  Forward: GGAATTC TCTAGAATGAGCCAGAAAACCCTG</br>
+
background: url("nav-tabs.png") no-repeat;
-
Reverse: GACTAGTTAGAACGCGTAGTTAAAGTTAG</br>
+
cursor: pointer;
-
 
+
}
-
FadI  Forward: GGAATTC TCTAGA ATGGGTCAGGTTTTACC</br>
+
li.nav-outerLi1 {
-
    Reverse: GACTAGTTTATTCCGCCTCCAGAACCA</br>
+
background-position: 0 0;
-
 
+
}
-
FadJ  Forward: GGAATTCTCTAGAATGGAAATGACATCAGC</br>
+
li.nav-outerLi2 {
-
    Reverse: GACTAGTTTATTGCAGGTCAGTTGCAGTTG</br>
+
background-position: -80px 0;
-
 
+
}
-
S-FadA  Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG</br>
+
li.nav-outerLi3 {
-
      Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC</br>
+
background-position: -160px 0;
-
 
+
}
-
S-FadB  Forward: GGAATTCTCTAGAATGCTTTATAAAGGCGACACC</br>
+
li.nav-outerLi4 {
-
        Reverse: GACTAGTTAAGCCGTTTTCAGAGAACC</br>
+
background-position: -240px 0;
-
 
+
}
-
S-FadE  Forward: GGAATTCTCTAGAATGATGATTTTGAGTATTATCG</br>
+
li.nav-outerLi5 {
-
Reverse: GACTAGTTATGCGGCTTCGACTTTACGC</br>
+
background-position: -320px 0;
-
 
+
}
-
</p>
+
li.nav-outerLi6 {
-
<h3>
+
background-position: -400px 0;
-
Design of the Promoter PfadR Repressed by Fatty Acids
+
}
-
</h3>
+
li.nav-outerLi1:hover {
-
<p>
+
background-position: 0 -80px;
-
Promoter PfadR, is derived from BBa_J23110. Specifically, FadR binding site of FadL gene is placed overlapped with the last 3 bases of BBa_J23110 The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. We use overlapping PCR to get the double strand DNA. The sequence design of PfadR is as followed:</br>
+
}
-
Forward:
+
li.nav-outerLi2:hover {
-
GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT</br>
+
background-position: -80px -80px;
-
Reverse：
+
}
-
GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT
+
li.nav-outerLi3:hover {
-
 
+
background-position: -160px -80px;
-
</p>
+
}
-
 
+
li.nav-outerLi4:hover {
-
<h3>
+
background-position: -240px -80px;
-
Construction of Biobricks
+
}
-
</h3>
+
li.nav-outerLi5:hover {
-
<p>
+
background-position: -320px -80px;
-
Fatty acid degradation project is divided into two parts: Promoter, and gene function</br>
+
}
-
 
+
li.nav-outerLi6:hover {
-
For discover the optimal combination of those fatty acid genes, we:</br>
+
background-position: -400px -80px;
-
 
+
}
-
1. PCR to clone those genes in <i>E.coli K12</i> and <i>Salmonella enterica LT2</i></br>
+
img.nav-bg-logo {
-
2. Restriction digest and ligate those gene into pSB1C3</br>
+
position: absolute;
-
3. Restriction digest and ligate those gene with RBS(B0030)</br>
+
z-index: 100;
-
4. RBS-FadA, RBS-FadI, and RBS-S- FadA is ligated with both BBa_R0011 promoter and our PfadR</br>
+
}
-
  RBS-FadR, RBS-FadB, RBS-FadJ, RBS-FadE, RBS-FadD, RBS-FadL, RBS-S-FadB, and RBS-S-FadE are ligated with B0034</br>
+
div.middle {
-
5.PROMOTER-RBS-FadA is ligated with RBS-FadB-Terminator, PROMOTER-RBS-FadI is ligated with RBS-FadJ-Terminator and PROMOTER-RBS-S-FadA is ligated with RBS-S-FadB-Terminator. RBS-FadE-Terminator, RBS-FadD-Terminator, RBS-FadL-Terminator, and RBS-S-FadE-Terminator, are ligated with BBa_R0011 promoter and PfadR
+
width: 940px;
-
 
+
background: #e6deb8;
-
 
+
background: rgba(230,222,184,0.5);
-
For Promoter PfadR</br>
+
position: absolute;
-
1. promoter PfadR was synthesized using overlapping PCR</br>
+
top: 178px;
-
2. RFP reporter was ligated downstream the promoter and ligted into pSB6A1</br>
+
}
-
3. J23116+ RBS+ FadR+ Terminator was ligated to PfadR+ RFP in pSB6A1</br>
+
div.aside {
-
 
+
width: 174px;
-
</p>
+
height: 441px;
-
 
+
background: url("aside-bg.png") no-repeat;
-
<h2>
+
margin-left: 10px;
-
Result
+
float: left;
-
</h2>
+
padding: 179px 86px 0 40px;
-
</HTML>
+
}
 +
div.asideFixed {
 +
position: fixed;
 +
top: 0;
 +
}
 +
ul.aside-outerUl {
 +
position: relative;
 +
margin: 7px 10px;
 +
}
 +
li.aside-outerLi {
 +
margin: 10px 0;
 +
}
 +
li.aside-outerLi h2{
 +
padding: 4px 0;
 +
color: #725718;
 +
background: #fff1a9;
 +
font-size: 14px;
 +
line-height: 22px;
 +
font-weight: bold;
 +
text-align: center;
 +
cursor: pointer;
 +
}
 +
li.aside-outerLi:hover h2{
 +
background: #fff8d3;
 +
}
 +
ul.aside-innerUl {
 +
display: none;
 +
}
 +
ul.aside-innerUl li {
 +
background: #bdc9ad;
 +
margin: 3px 0;
 +
font-family: arial, sans-serif;
 +
font-size: 14px;
 +
line-height: 22px;
 +
text-align: center;
 +
cursor: pointer;
 +
}
 +
ul.aside-innerUl li:hover{
 +
background: #d4dcc9;
 +
}
 +
div.main {
 +
width: 580px;
 +
border: 1px solid #9e8366;
 +
background: #f0e2c1;
 +
float: right;
 +
margin: 149px 30px 30px 0;
 +
}
 +
div.passage {
 +
display: none;
 +
margin: 30px;
 +
}
 +
div.show{
 +
display: block;
 +
}
 +
div.passage h3 {
 +
font-size: 26px;
 +
line-height: 39px;
 +
font-weight: bold;
 +
background: #859f93;
 +
color: #f0e2c1;
 +
display: block;
 +
width: auto;
 +
padding: 0 10px;
 +
}
 +
div.passage p {
 +
margin: 14px 0;
 +
font-size: 13px;
 +
line-height: 20px;
 +
}
 +
div.passage img {
 +
display: block;
 +
float: right;
 +
padding: 0 0 20px 30px;
 +
background: #f0e2c1;
 +
}
 +
div.footer {
 +
}
 +
</style>
 +
</head>
 +
<body>
 +
<div class="center">
 +
<div class="header">
 +
<img class="nav-bg-logo" src="nav-bg-logo.png" />
 +
<div class="nav">
 +
<ul class="nav-outerUl">
 +
<a href="../home/"><li class="nav-outerLi nav-outerLi1" title="Home"></li></a>
 +
<a href="../team/"><li class="nav-outerLi nav-outerLi2" title="Team"></li></a>
 +
<a href="../project/"><li class="nav-outerLi nav-outerLi3" title="Project"></li></a>
 +
<a href="../standard/"><li class="nav-outerLi nav-outerLi4" title="Standard"></li></a>
 +
<a href="../notes/"><li class="nav-outerLi nav-outerLi5" title="Notes"></li></a>
 +
<a href="../human-practice/"><li class="nav-outerLi nav-outerLi6" title="Human Practice"></li></a>
 +
</ul>
 +
</div>
 +
</div>
 +
<div class="middle">
 +
<div class="aside">
 +
<ul class="aside-outerUl">
 +
<li class="aside-outerLi" name="projectCarton">
 +
<h2>Project Carton</h2>
 +
</li>
 +
<li class="aside-outerLi" name="background">
 +
<h2>Background</h2>
 +
<ul class="aside-innerUl">
 +
<a href="#zoupengcheng1"><li>zoupengcheng1</li></a>
 +
</ul>
 +
</li>
 +
<li class="aside-outerLi" name="device1">
 +
<h2>Devide I</h2>
 +
</li>
 +
<li class="aside-outerLi" name="device2">
 +
<h2>Device II</h2>
 +
</li>
 +
<li class="aside-outerLi" name="device3">
 +
<h2>Device III</h2>
 +
</li>
 +
<li class="aside-outerLi" name="futureProspective">
 +
<h2>Future Prospective</h2>
 +
<ul class="aside-innerUl">
 +
<a href="#teacher1"><li>teacher1</li></a>
 +
<a href="#teacher2"><li>teacher2</li></a>
 +
</ul>
 +
</li>
 +
</ul>
 +
</div>
 +
<div class="main">
 +
<div class="passage projectCarton show">
 +
<h3>Project Carton</h3>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
</div>
 +
<div class="passage background">
 +
<a name="zoupengcheng1"><h3>zoupengcheng1</h3></a>
 +
<p>zoupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchengzoupengcheng zoupengchengzoupengcheng zoupengchengzoupengcheng zoupengchengzoupengcheng </p>
 +
</div>
 +
<div class="passage device1">
 +
<h3>Device I</h3>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
</div>
 +
<div class="passage device2">
 +
<h3>Device II</h3>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
</div>
 +
<div class="passage device3">
 +
<h3>Device III</h3>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
<p>the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content</p>
 +
</div>
 +
<div class="passage futureProspective">
 +
<a name="teacher1"><h3>teacher1</h3></a>
 +
<p>teacherteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher teacherteacher teacherteacher teacherteacher teacherteacher </p>
 +
<a name="teacher2"><h3>teacher2</h3></a>
 +
<p>teacherteacher zoupenghengteacher zoupenghengteacher zoupenghengteacher teacherteacher teacherteacher teacherteacher teacherteacher </p>
 +
</div>
 +
</div>
 +
<em class="clear"></em>
 +
</div>
 +
<div class="footer"></div>
 +
</div>
 +
<script src="http://code.jquery.com/jquery-1.7.2.min.js"></script>
 +
<script>
 +
$(function() {
 +
//when scrolling, the "aside" div will be fixed
 +
$(window).scroll(function() {
 +
if ($(window).scrollTop() > 179) {
 +
$('div.aside').addClass('asideFixed');
 +
$('ul.aside-outerUl').css('top', function() {
 +
return (Math.max(169 - $(window).scrollTop(), -169) + 'px');
 +
});
 +
} else {
 +
$('div.aside').removeClass('asideFixed');
 +
$('ul.aside-outerUl').css('top', '0');
 +
}
 +
});
 +
$('li.aside-outerLi').click(function(){
 +
$(this).siblings().children('ul').slideUp();
 +
$(this).children('ul').slideDown();
 +
$('div.main').children().hide();
 +
$('div.main').children('.'+$(this).attr('name')).show();
 +
});
 +
//show nav
 +
});
 +
</script>
 +
</body>
 +
</html>

Revision as of 16:00, 14 September 2012

<!DOCTYPE HTML PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">

whu

Project Carton

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

zoupengcheng1

zoupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchupengchengzoupengcheng zoupengchengzoupengcheng zoupengchengzoupengcheng zoupengchengzoupengcheng zoupengchengzoupengcheng

Device I

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

Device II

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

Device III

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

the cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe cothe content the content the content the content the content the content the content the content the content the content the content the content

teacher1

teacherteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher zoupengchupengchengteacher teacherteacher teacherteacher teacherteacher teacherteacher

teacher2

teacherteacher zoupenghengteacher zoupenghengteacher zoupenghengteacher teacherteacher teacherteacher teacherteacher teacherteacher

Retrieved from "http://2012.igem.org/Team:WHU-China/Project/fatty_acid_degradation"