Team:LMU-Munich/Bacillus BioBricks

From 2012.igem.org

Revision as of 10:57, 12 September 2012

• Home
• Team
• Project
  • Why Beadzillus?
  • Bacillus Introduction
  • Bacillus BioBrickBox
  • GerminationSTOP
  • Sporobeads
  • Data
  • Applications
• Extras
  • Attributions
  • Collaborations
  • Registry
  • Bacillus Strains
  • Special: Inverter
  • Achievements
• Safety
  • Project Safety
  • Release for application
• Lab Notebook
  • Weekly Journal
  • Protocols
• Human Practice
  • SynBio Day
  • Students Practical Course
  • CAS SynBio Conference
  • Berlin Conference
• Sponsors

Bacillus BioBricks

We will create a toolbox of Bacillus BioBricks to contribute to the registry.

This BacillusBioBrickBox contains Bacillus specific:

Bacillus Vectors

Here is a list of all the vectors we cloned and used. Please note that pMAD is not in a BioBrick standard, but it is a useful tool to knock out genes in Bacillus subtilis.

For the use of our vectors, please see our Protocols page. A general introduction to Bacillus subtilis and its integrative vectors can be found here. All vectors have ampicillin as E. coli resistance and RFP as selection marker.

The number in the vector's name codes for the insertion locus and the following letter for the Bacillus subtilis resistance gene according to the following table:

The concentrations of the antibiotics and the insertion tests can be found in our Protocol section.

The promoters we submit are:

Pveg, PliaI, PliaG, plepA, Pxyl, Pxyl+XylR

We also tested the [http://partsregistry.org/Promoters/Catalog/Anderson Anderson promoter collection] in Bacillus subtilis with pSB_Bs3C-luxABCDE. The data will be online in our Data section soon.

Furthermore we plan to submit reporter genes optimized for Bacillus subtilis, namely GFP, lacZ, luc and mKate2.

Useful for the registry are also 5 tags in Freiburg Standard (cMyc, 10His, Flag, Strep, HA).

More details to come soon.

Bacillus Promoters

To get a set of promoters with different strength we characterized several promoters in B. subtilis. They can be divided in three different groups: the constitutive promoters from the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] from the Partsregistry, the constitutive promoters P_liaG, P_veg and P_lepA from B. subtilis, and the inducible promoters P_liaI and P_xyl-XylR from B. subtilis. For the characterization of the different promoters we used the two reporter vectors pSBBs4S-luxABCDE and pSBBs1C-lacZ as well as the reporters lacZ luc and mKate in BioBrick standard.

Anderson promoters

The first group of promoters evaluated are the promoters of the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] which we call Anderson promoters. They have already been measured in Escherichia coli where they all showed a constitutive behavior with a different strength. In this project, eleven Anderson promoters were characterized in B. subtilis. Therefore we used the reporter vector pSB_Bs3C-luxABCDE from the BioBrickBox were they showed quiet a low activity in B. subtilis (see Data). To confirm this result some Anderson promoters were also evaluated in the reporter vector pSB_Bs1C-lacZ(see Data).

• J23100 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823004 BioBrick:BBa_K823004]
• J23101 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823005 BioBrick:BBa_K823005]
• J23102 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823006 BioBrick:BBa_K823006]
• J23103 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823007 BioBrick:BBa_K823007]
• J23106 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823008 BioBrick:BBa_K823008]
• J23107 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823009 BioBrick:BBa_K823009]
• J23113 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823010 BioBrick:BBa_K823010]
• J23114 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823011 BioBrick:BBa_K823011]
• J23115 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823012 BioBrick:BBa_K823012]
• J23117 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823013 BioBrick:BBa_K823013]
• J23118 [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823014 BioBrick:BBa_K823014]

Constitutive promoters from B. subtilis

The second group of promoters charaterized are constitutive promoters from B. subtilis. We evaluated the promoters P_liaG, P_veg and P_lepA. Therefore we used the reporter vectors pSB_Bs3C-luxABCDE and pSB_Bs1C-lacZ as well as the reporter BioBricks lacZ, luc and mKate2.

• P_liaG [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823000 BioBrick:BBa_K823000]

P_liaG is a weak, constitutive promoter from B. subtilis. It is responsible for the transcription of the last four genes of the liaIHGFSR locus and therefore for the production of the components of the LiaRS system, which is important for the detection of cell wall antibiotics (Jordan et al., 2006). P_liaG was evaluated with the reporter vectors pSB_Bs3C-luxABCDE and pSB_Bs1C-lacZ as well as the reporter BioBrick lacZ. This promoter showed a much higher activity than the Anderson promoters which was still weak in comparison to the other evaluated Bacillus promoters (see Data).

• P_veg [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823003 BioBrick:BBa_K823003]

P_veg is known to show a strong constitutive activity during the vegetative growth phase and sporulation phase. This promoter is important for the transcription of the veg gene, which plays an important role during sporulation (Fukushima et al., 2003). P_veg was measured by using the reporter vector pSB_Bs1C-lacZ as well as the reporter BioBrick lacZ. This promoter was the strongest of our evaluated promoters (see Data). (

• P_lepA [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823002 BioBrick:BBa_K823002]

P_lepA is constitutive promoter which is important for the transcription of a bicistronic operon. One of the expressed proteins is the protein PlepA (Homuth et al., 1996). This protein plays an important role during the translation as it can move the mRNA-tRNA complex one step back in the ribosome which is expected to improve the fidelity of translation (Qin et al., 2006). This promoter was evaluated with the reporter vector pSB_Bs3C-luxABCDE as well as the reporter BioBricks luc and mKate2. The activity of this promoter is between the activity of the strongest promoter P_veg and the weak Bacillus promoter P_liaG (see Data).

Inducible promoters from B. subtilis

The last group of promoters consists of inducible promoters of B. subtilis e.g. P_liaI. They are useful to decide when to turn on gene expression because these promoters need an inducer to start transcription. P_liaI can be induced by antibiotics which interact with the lipidII cycle, e.g. bacitracin. In this project this promoter is evaluated like the constitutive promoters with the reporter vector pSB_Bs3C-luxABCDE which contains the lux operon as a reporter and with the vector pSB_Bs1C-lacZ which contains the lacZ reporter gene. Therefore the promoters will be amplified from the genome of B. subtilis with primers that contain the restriction sites of the BioBrick standard. Then these inducible promoters will be cloned into the empty vector pSB1C3 to send them to the registry as well as the two reporter vectors to evaluate their strength in B. subtilis. To turn the promoter on we have to add an inducer.

Bacillus Reporters

We designed some reporters that are commonly used in B. subtilis or are codon optimized versions of popular reporter genes. All reporters have a modified iGEM Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RCF 25]) pre- and suffix for assembly of in-frame fusion proteins. Our prefix also includes the B. subitlis optimized RBS.

prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

• GFP

We took a gfp derivate of the Bacillus subtilis plasmids pGFPamy and added the BioBrick compatiple pre- and suffix of the Freiburg standard (Assembly 25).

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K823039 BioBrick:BBa_K823039]

• mKate

We synthesized this rfp derivate with a codon-optimized version for the use in B. subtilis with pre- and suffix of the Freiburg standard

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029]

• LacZ

lacZ under the control of Pspac in pSBC3. Plate induced with Xylose (ng/µl)

This lacZ gene is derived from the Bacillus reporter vector pAC6. It is constructed in the Freiburg Standard (Assembly 25) for in-frame fusion proteins. It also includes a Shine-Dalgarno Sequence optimized for Bacillus subtilis translation.

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K823019 BioBrick:BBa_K823019]

• luc

We synthesized this luciferase for luminescence assays with luciferin as substrate.

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K823028 BioBrick:BBa_K823028]

Project Navigation

+--+--+--+--+--+--+--	+--+--+--+--+--	+--+--+--+--+--+--	+--+--+--+--+--+--
Bacillus Intro	Bacillus BioBrickBOX	SporeCoat FusionProteins	Germination STOP