Team:NTNU Trondheim/Notebook/August

From 2012.igem.org

(Difference between revisions)
(Monday 27.08.12)
 
(25 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:NTNU_Trondheim/Templates/Header}}
{{:Team:NTNU_Trondheim/Templates/Header}}
 +
<html>
 +
<div class="container">
 +
<div class="page-header-top">
 +
<h1>Notebook <small>August</small></h1>
 +
</div>
 +
</div>
-
=Notebook/August=
+
<div class="container main-container">
 +
 
 +
 
 +
<div class="row">
 +
 
 +
<div class="span10 offset1">
 +
</html>
__NOTOC__
__NOTOC__
-
+
 
 +
<html><div class="well well-small"></html>
{{:Team:NTNU_Trondheim/Templates/Calendar}}
{{:Team:NTNU_Trondheim/Templates/Calendar}}
 +
<html></div>
 +
 +
</div>
 +
</div>
 +
<div class="row-fluid">
 +
<div class="span12">
 +
</html>
 +
 +
===Monday 27.08.12===
 +
----
 +
 +
Colicin expressed from the K+RBS+Colicin+DTT plasmid was tested on ''E.coli'' DH5α cells.
 +
 +
Also, Plld w/ RBS from ''E.coli'' was cut with S+P, Plld w/RBS from ''C.glutamicum'' was cut with E+P, and linearized plasmid backbone pSB1A3 was cut with E+P. The samples will be purified and ligated tomorrow.
 +
 +
 +
Results from the miniprep:
 +
 +
 +
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
 +
!Gene
 +
!Concentration [ng/µl]
 +
|-
 +
|P<sub>lld</sub>CGr+YFP+DTT in pSB1A3 #1
 +
|29,5
 +
|-
 +
|P<sub>lld</sub>CGr+YFP+DTT in pSB1A3 #2
 +
|23,7
 +
|-
 +
|P<sub>lld</sub>CGr+YFP+DTT in pSB1A3 #3
 +
|47,7
 +
|-
 +
|P<sub>lld</sub>CGr+YFP+DTT in pSB1A3 #4
 +
|25,2
 +
|-
 +
|P<sub>lld</sub>CGr+YFP+DTT in pSB13 #1
 +
|18,8
 +
|-
 +
|P<sub>lld</sub>CGr+YFP+DTT in pSB1C3 #2
 +
|21,0
 +
|-
 +
|P<sub>lld</sub>CGr in pSB1C3 2.1
 +
|24,8
 +
|-
 +
|P<sub>lld</sub>CGr in pSB1C3 2.2
 +
|20,7
 +
|-
 +
|P<sub>lld</sub>CGr in pSB1C3 3.1
 +
|21,3
 +
|-
 +
|P<sub>lld</sub>CGr in pSB1C3 3.2
 +
|18,4
 +
|-
 +
|}
 +
 +
===Sunday 26.08.12===
 +
----
 +
 +
RNA was isolated from the RBS(<partinfo>BBa_B0030</partinfo>)+LacI(<partinfo>BBa_C0061</partinfo>)+DTT(<partinfo>BBa_B0014</partinfo>) and ''E.coli'' DH5α cells inoculated friday. RNA was isolated, and the DNAse reaction and the cDNA reaction were performed according to the protocol on the procedures page. The cDNA was frozen down to -80 &deg;C.
 +
 +
 +
===Friday 24.08.12===
 +
----
 +
 +
Inoculated one cell culture of ''E.coli'' DH5α containing a plasmid consisting of RBS (<partinfo>BBa_B0030</partinfo>) + LacI (<partinfo>BBa_C0061</partinfo>) + DTT (<partinfo>BBa_B0014</partinfo>), and one cell culture consisting of ''E.coli'' DH5α cells without plasmid. These colonies will be used for real time PCR.
 +
 +
===Thursday 23.08.12===
 +
----
 +
 +
BBa_K822001 in pSB1A3 was cut with Spe1 and Pst1, BBa_E0030 + terminator was cut with Xba1 and PSt1.
 +
 +
BBa_E0030 + terminator was run on gel, and got the consentration 4,5 ng/uL.
 +
 +
BBa_K822001 in pSB1A3 was purified using a PCR purifying kit, and an concentration of 1,2 ng/uL was obtained.
 +
 +
===Wednesday 22.08.12===
 +
----
 +
 +
P<sub>lld</sub> in pSB1A3 and pSB1C3 were miniprepped as described in the [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocol]. The concentrations are listed below.
 +
 +
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
 +
!Gene
 +
!Concentration [ng/µl]
 +
|-
 +
|P<sub>lld</sub> in pSB1A3
 +
|25,7
 +
|-
 +
|P<sub>lld</sub> in pSB1C3
 +
|39,5
 +
|-
 +
|}
 +
 +
 +
===Tuesday 21.08.12===
 +
----
 +
 +
The primers ordered came today, so PCR was performed on p<sub>lld</sub> with RBS (from ''Corynebacterium glutamicum''), lldR from ''E. coli'' and ''C. glutamicum'', and His-tagged lld from ''C. glutamicum''.
 +
 +
The PCR mix and program are given below.
 +
 +
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
 +
!Substance
 +
!Volume [µl]
 +
|-
 +
|dH<sub>2</sub>O
 +
|32,5
 +
|-
 +
|5x-buffer
 +
|10,0
 +
|-
 +
|dNTPs
 +
|1,0
 +
|-
 +
|fwd primer
 +
|2,5
 +
|-
 +
|rev primer
 +
|2,5
 +
|-
 +
|template
 +
|1,0
 +
|-
 +
|Phusion polymerase
 +
|0,5
 +
|-
 +
|}
 +
 +
The addition of the Phusion polymerase is done immediately before starting the PCR program.
 +
 +
{|
 +
| style="padding-right:7px;" |
 +
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
 +
! Step
 +
! Action
 +
! Temperature [°C]
 +
! Duration
 +
|-
 +
|1
 +
|Heated lid
 +
|103
 +
|
 +
|-
 +
|2
 +
|Initial denaturation
 +
|98
 +
|30 sek
 +
|-
 +
|3
 +
|Denaturation
 +
|98
 +
|10 sek
 +
|-
 +
|4
 +
|Annealing
 +
|x<sub>1</sub>
 +
|30 sek
 +
|-
 +
|5
 +
|Elongation
 +
|72
 +
|x<sub>2</sub>
 +
|-
 +
|6
 +
|Go to step 3, repeat 10 x
 +
|
 +
|
 +
|-
 +
|7
 +
|Denaturation
 +
|98
 +
|10 sek
 +
|-
 +
|8
 +
|Elongation
 +
|72
 +
|x<sub>2</sub>
 +
|-
 +
|9
 +
|Go to step 7, repeat 15 x, with 5 s extra each time
 +
|
 +
|
 +
|-
 +
|10
 +
|Final Elongation
 +
|72
 +
|5 min
 +
|-
 +
|11
 +
|Hold
 +
|4
 +
|∞
 +
|}
 +
 +
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
 +
!Amplicon
 +
!x<sub>1</sub> [°C]
 +
!x<sub>2</sub> [s]
 +
|-
 +
|His tagged lld, ''C. glutamicum''
 +
|62
 +
|60
 +
|-
 +
|P<sub>lld</sub>, ''C. glutamicum''
 +
|63
 +
|5
 +
|-
 +
|lldR, ''E. coli''
 +
| -
 +
|26
 +
|-
 +
|lldR, ''C. glutamicum''
 +
|66
 +
|21
 +
|-
 +
|}
===Monday 20.08.12===
===Monday 20.08.12===
 +
----
P<sub>lld</sub> in pSB1A3 was transformed into DH5α cells an plated out. Incubated at 37 °C.
P<sub>lld</sub> in pSB1A3 was transformed into DH5α cells an plated out. Incubated at 37 °C.
The cells inoculated to liquid medium on saturday were miniprepped. The concentrations are given below, together with the volume necessary for obtaining 1000 ng of plasmid
The cells inoculated to liquid medium on saturday were miniprepped. The concentrations are given below, together with the volume necessary for obtaining 1000 ng of plasmid
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Biobrick
!Biobrick
!Concentration [ng/µl]
!Concentration [ng/µl]
Line 50: Line 279:
===Saturday 18.08.12===
===Saturday 18.08.12===
 +
----
P<sub>lld</sub> cut with E+P and <partinfo>pSB1A3</partinfo> cut with E+P was ligated together to see if the P<sub>lld</sub> promoter will be more functional in an ampicillin plasmid.
P<sub>lld</sub> cut with E+P and <partinfo>pSB1A3</partinfo> cut with E+P was ligated together to see if the P<sub>lld</sub> promoter will be more functional in an ampicillin plasmid.
Line 62: Line 292:
Vgb+RBS religated, Vgb+RBS+LuxR+DTT #1, Vgb+RBS+LuxR+DTT #2, LuxI+DTT, K+RBS+LacI+DTT and his-tagged LldR was miniprepped using the Promega SV miniprep kit. The concentrations of isolated plasmid are given below:
Vgb+RBS religated, Vgb+RBS+LuxR+DTT #1, Vgb+RBS+LuxR+DTT #2, LuxI+DTT, K+RBS+LacI+DTT and his-tagged LldR was miniprepped using the Promega SV miniprep kit. The concentrations of isolated plasmid are given below:
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Plasmid
!Plasmid
!Concentration [ng/µl]
!Concentration [ng/µl]
Line 108: Line 338:
Cut of the parts consisting the genes, LuxI (<partinfo>Bba_C0061</partinfo>) and LuxR+term (<partinfo>BBa_C0062</partinfo>, <partinfo>BBa_B0015</partinfo>), and extracted the DNA from the gel. Concentrations are listed below.
Cut of the parts consisting the genes, LuxI (<partinfo>Bba_C0061</partinfo>) and LuxR+term (<partinfo>BBa_C0062</partinfo>, <partinfo>BBa_B0015</partinfo>), and extracted the DNA from the gel. Concentrations are listed below.
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!BioBrick
!BioBrick
!Enzymes
!Enzymes
Line 125: Line 355:
Ligation mixes were made according to [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocol] with the following ingredients, as well as religation of the backbones:
Ligation mixes were made according to [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocol] with the following ingredients, as well as religation of the backbones:
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Backbone
!Backbone
!Insert
!Insert
Line 148: Line 378:
10 µl of the liquid cultures for K+RBS+colicin and LuxR+DTT was transferred to 5 ml of new liquid medium to be used in testing of the colicin biobrick. The rest of the samples were miniprepped using the Promega SV Miniprep kit. The concentrations of the samples are given below:
10 µl of the liquid cultures for K+RBS+colicin and LuxR+DTT was transferred to 5 ml of new liquid medium to be used in testing of the colicin biobrick. The rest of the samples were miniprepped using the Promega SV Miniprep kit. The concentrations of the samples are given below:
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Biobrick
!Biobrick
!Concentration [ng/µl]
!Concentration [ng/µl]
Line 168: Line 398:
Did a restriction digest on the following biobricks, as described in the [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocol].
Did a restriction digest on the following biobricks, as described in the [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocol].
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Biobricks
!Biobricks
!BioBrick no.
!BioBrick no.
Line 203: Line 433:
The concentrations on the purified parts are as follows:
The concentrations on the purified parts are as follows:
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Biobricks
!Biobricks
!BioBrick no.
!BioBrick no.
Line 233: Line 463:
The concentrations were as follows:
The concentrations were as follows:
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Biobrick
!Biobrick
!Concentration ng/uL
!Concentration ng/uL
Line 264: Line 494:
The following primers were used:
The following primers were used:
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Primer
!Primer
!Sequence
!Sequence
Line 276: Line 506:
The PCR machine was programmed according to the following table:
The PCR machine was programmed according to the following table:
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
 
 +
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Step
!Step
!Action
!Action
Line 328: Line 559:
Performed miniprep on RBS (<partinfo>BBa_B0030</partinfo>) and plld+RBS. The concentration were as follows:
Performed miniprep on RBS (<partinfo>BBa_B0030</partinfo>) and plld+RBS. The concentration were as follows:
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Biobrick
!Biobrick
!Concentration ng/uL
!Concentration ng/uL
Line 342: Line 573:
Did a restriction digest as described in the [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocol] on the following parts. On the pieces to be used as inserts, the number of base pairs are also listed.
Did a restriction digest as described in the [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocol] on the following parts. On the pieces to be used as inserts, the number of base pairs are also listed.
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Biobrick/Construct
!Biobrick/Construct
!BioBrick
!BioBrick
Line 411: Line 642:
Ligated together the following, as described in [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocols]:
Ligated together the following, as described in [https://2012.igem.org/Team:NTNU_Trondheim/Protocols protocols]:
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Ligation #
!Ligation #
!Backbone
!Backbone
Line 432: Line 663:
3A assembly was used on the following parts, as described in the [https://2011.igem.org/Team:Northwestern/Notebook/Protocols/3A_Assembly Protocol], by Northwestern University:
3A assembly was used on the following parts, as described in the [https://2011.igem.org/Team:Northwestern/Notebook/Protocols/3A_Assembly Protocol], by Northwestern University:
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Ligation #
!Ligation #
!Backbone
!Backbone
Line 484: Line 715:
Miniprepped VHB+RBS+lysis (<partinfo>BBa_K258005</partinfo>, <partinfo>BBa_B0034</partinfo> and <partinfo>BBa_K112808</partinfo>), VGB+RBS+lysis (<partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo> and <partinfo>BBa_K112808</partinfo>), pllD+lysis (lactate promoter and <partinfo>BBa_K112808</partinfo>) and three parallels of pBad+YFP (<partinfo>Bba_K206000</partinfo> and <partinfo>BBa_E0030</partinfo>)
Miniprepped VHB+RBS+lysis (<partinfo>BBa_K258005</partinfo>, <partinfo>BBa_B0034</partinfo> and <partinfo>BBa_K112808</partinfo>), VGB+RBS+lysis (<partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo> and <partinfo>BBa_K112808</partinfo>), pllD+lysis (lactate promoter and <partinfo>BBa_K112808</partinfo>) and three parallels of pBad+YFP (<partinfo>Bba_K206000</partinfo> and <partinfo>BBa_E0030</partinfo>)
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Sample
!Sample
!Concentration [ng/µl]
!Concentration [ng/µl]
Line 572: Line 803:
The constructs containing plld ligated with the lysis device(<partinfo>BBa_K112808</partinfo>), and plld in plasmid <partinfo>PSB1C3</partinfo> were miniprepped. The concentration were measured using nano drop.
The constructs containing plld ligated with the lysis device(<partinfo>BBa_K112808</partinfo>), and plld in plasmid <partinfo>PSB1C3</partinfo> were miniprepped. The concentration were measured using nano drop.
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Sample
!Sample
!Concentration [ng/µl]
!Concentration [ng/µl]
Line 602: Line 833:
PCR was performed on pBad (<partinfo>Bba_K206000</partinfo>) and DTT (<partinfo>BBa_B0015</partinfo>), the primers used, PCR-mix and programmed times are listed below.
PCR was performed on pBad (<partinfo>Bba_K206000</partinfo>) and DTT (<partinfo>BBa_B0015</partinfo>), the primers used, PCR-mix and programmed times are listed below.
-
{| class="wikitable" style="text-align:center;margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
!Primer
!Primer
!Type
!Type
Line 652: Line 883:
{|
{|
| style="padding-right:7px;" |
| style="padding-right:7px;" |
-
{|class="wikitable" style="margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
|+pBAD
|+pBAD
! Step
! Step
Line 713: Line 944:
| style="padding-left:7px;" |
| style="padding-left:7px;" |
-
{|class="wikitable" style="margin: 1em auto 1em auto;"
+
{|class="table table-bordered table-hover" style="margin: 1em auto 1em auto; width: auto;"
|+ DTT
|+ DTT
! Step
! Step
Line 770: Line 1,001:
|4°C
|4°C
|∞
|∞
 +
|}
|}
|}
|}
|}
-
</div>
+
 
 +
{{:Team:NTNU_Trondheim/Templates/Sponsors}}
 +
<html>
 +
</div></div></div></html>
 +
{{:Team:NTNU_Trondheim/Templates/Footer}}

Latest revision as of 22:03, 26 September 2012

NTNU IS B.A.C.K.
Bacterial Anti-Cancer-Kamikaze

Notebook August


February
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 25
27 28 29
March
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29 30
April
Mon Tue Wed Thu Fri Sat Sun
1
2 3 4 5 6 7 8
9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29
30
May
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4 5 6
7 8 9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30 31
June
Mon Tue Wed Thu Fri Sat Sun
1 2 3
4 5 6 7 8 9 10
11 12 13 14 15 16 17
18 19 20 21 22 23 24
25 26 27 28 29 30 31
July
Mon Tue Wed Thu Fri Sat Sun
1
2 3 4 5 6 7 8
9 10 11 12 13 14 15
16 17 18 19 20 21 22
23 24 25 26 27 28 29
30 31
August
Mon Tue Wed Thu Fri Sat Sun
1 2 3 4 5
6 7 8 9 10 11 12
13 14 15 16 17 18 19
20 21 22 23 24 25 26
27 28 29 30 31
September
Mon Tue Wed Thu Fri Sat Sun
1 2
3 4 5 6 7 8 9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30

Monday 27.08.12


Colicin expressed from the K+RBS+Colicin+DTT plasmid was tested on E.coli DH5α cells.

Also, Plld w/ RBS from E.coli was cut with S+P, Plld w/RBS from C.glutamicum was cut with E+P, and linearized plasmid backbone pSB1A3 was cut with E+P. The samples will be purified and ligated tomorrow.


Results from the miniprep:


Gene Concentration [ng/µl]
PlldCGr+YFP+DTT in pSB1A3 #1 29,5
PlldCGr+YFP+DTT in pSB1A3 #2 23,7
PlldCGr+YFP+DTT in pSB1A3 #3 47,7
PlldCGr+YFP+DTT in pSB1A3 #4 25,2
PlldCGr+YFP+DTT in pSB13 #1 18,8
PlldCGr+YFP+DTT in pSB1C3 #2 21,0
PlldCGr in pSB1C3 2.1 24,8
PlldCGr in pSB1C3 2.2 20,7
PlldCGr in pSB1C3 3.1 21,3
PlldCGr in pSB1C3 3.2 18,4

Sunday 26.08.12


RNA was isolated from the RBS(<partinfo>BBa_B0030</partinfo>)+LacI(<partinfo>BBa_C0061</partinfo>)+DTT(<partinfo>BBa_B0014</partinfo>) and E.coli DH5α cells inoculated friday. RNA was isolated, and the DNAse reaction and the cDNA reaction were performed according to the protocol on the procedures page. The cDNA was frozen down to -80 °C.


Friday 24.08.12


Inoculated one cell culture of E.coli DH5α containing a plasmid consisting of RBS (<partinfo>BBa_B0030</partinfo>) + LacI (<partinfo>BBa_C0061</partinfo>) + DTT (<partinfo>BBa_B0014</partinfo>), and one cell culture consisting of E.coli DH5α cells without plasmid. These colonies will be used for real time PCR.

Thursday 23.08.12


BBa_K822001 in pSB1A3 was cut with Spe1 and Pst1, BBa_E0030 + terminator was cut with Xba1 and PSt1.

BBa_E0030 + terminator was run on gel, and got the consentration 4,5 ng/uL.

BBa_K822001 in pSB1A3 was purified using a PCR purifying kit, and an concentration of 1,2 ng/uL was obtained.

Wednesday 22.08.12


Plld in pSB1A3 and pSB1C3 were miniprepped as described in the protocol. The concentrations are listed below.

Gene Concentration [ng/µl]
Plld in pSB1A3 25,7
Plld in pSB1C3 39,5


Tuesday 21.08.12


The primers ordered came today, so PCR was performed on plld with RBS (from Corynebacterium glutamicum), lldR from E. coli and C. glutamicum, and His-tagged lld from C. glutamicum.

The PCR mix and program are given below.

Substance Volume [µl]
dH2O 32,5
5x-buffer 10,0
dNTPs 1,0
fwd primer 2,5
rev primer 2,5
template 1,0
Phusion polymerase 0,5

The addition of the Phusion polymerase is done immediately before starting the PCR program.

Step Action Temperature [°C] Duration
1 Heated lid 103
2 Initial denaturation 98 30 sek
3 Denaturation 98 10 sek
4 Annealing x1 30 sek
5 Elongation 72 x2
6 Go to step 3, repeat 10 x
7 Denaturation 98 10 sek
8 Elongation 72 x2
9 Go to step 7, repeat 15 x, with 5 s extra each time
10 Final Elongation 72 5 min
11 Hold 4
Amplicon x1 [°C] x2 [s]
His tagged lld, C. glutamicum 62 60
Plld, C. glutamicum 63 5
lldR, E. coli - 26
lldR, C. glutamicum 66 21

Monday 20.08.12


Plld in pSB1A3 was transformed into DH5α cells an plated out. Incubated at 37 °C. The cells inoculated to liquid medium on saturday were miniprepped. The concentrations are given below, together with the volume necessary for obtaining 1000 ng of plasmid

Biobrick Concentration [ng/µl] Volume required to obtain 1000 ng plasmid
Vgb+RBS+YFP+DTT 27.1 36.9
Vgb+RBS+LuxR+DTT 32.1 31.2
K+RBS+colicin 28.4 35.2
<partinfo>BBa_K292006</partinfo> 26.0 38.5
Colicin in pSB1C3 35.3 28.3
YFP+DTT 39.6 25.3
RBS*+LacI+DTT* 33.0 30.3

The required volume for obtaining 1000 ng of plasmid were then pipetted out for each sample, and dried on a heat block prewarmed to 50 °C, to obtain an approximate volume of 15 µl. The samples were then sent to sequencing.


Saturday 18.08.12


Plld cut with E+P and <partinfo>pSB1A3</partinfo> cut with E+P was ligated together to see if the Plld promoter will be more functional in an ampicillin plasmid. In order to be able to send plasmids to sequencing on monday, Vgb+RBS+YFP+DTT, Vgb+RBS+LuxR+DTT, K+RBS+colicin, <partinfo>BBa_K292006</partinfo>, colicin in pSB1C3, YFP+DTT and RBS*+LacI+DTT* was inoculated to liquid medium


Thursday 16.08.12


Plld+lysis and pSB1A3 cut yesterday with E+P was investigated on gel. Two fragments were obtained for Plld+lysis, but the sizes of the fragments were not as expected. Since we are not sure which fragment is which, both of the fragments were cut out of the gel and purified using the QIAquick gel extraction kit. In case one of them is uncut plasmid, the unligated DNA from both bonds will be transformed tomorrow, and we will assume that if the cells transformed with DNA from one of the samples won't grow, that sample will contain digested plasmid. This sample will be ligated with pSB1A3, plated out on a ampicillin plate, and then, several cell cultures from this plate will be plated out on a chloramphenicol plate. The colonies that won't grow on chloramphenicol, is assumed to contain the correct plasmid.

Vgb+RBS religated, Vgb+RBS+LuxR+DTT #1, Vgb+RBS+LuxR+DTT #2, LuxI+DTT, K+RBS+LacI+DTT and his-tagged LldR was miniprepped using the Promega SV miniprep kit. The concentrations of isolated plasmid are given below:

Plasmid Concentration [ng/µl]
Vgb+RBS religated 27.3
Vgb+RBS+LuxR+DTT #1 26.2
Vgb+RBS+LuxR+DTT #2 31.7
LuxI+DTT 35.3
K+RBS+LacI+DTT 7.9
his-LldR 51.0

Also, Vgb and Vhb was tested again, and Ove named two of the agar plates Mark and Doggie:-)

Wednesday 15.08.12


The high expression plasmid containing his-tagged LldR was transferred to liquid medium.

K+RBS+Colicin and the negative colicin control, LuxR+DTT was transferred to new liquid medium in order to be tested. 50 µl of the old cultures was transferred to 10 ml of LB containing ampicillin.

Since we have read that chloramphenicol can be a problem for the lld promoter, we also decided to transfer this brick to a new backbone before further testing. Both Plld and Plld+RBS+lysis was cut with EcoRI and PstI. Linearized plasmid backbone pSB1A3 was also cut with EcoRI and PstI. Ligations will be performed tomorrow.


Tuesday 14.08.12


To check if the new restriction digest were ok, LuxI (<partinfo>Bba_C0061</partinfo>) and LuxR+term (<partinfo>BBa_C0062</partinfo>, <partinfo>BBa_B0015</partinfo>) were tested with gel electrophoresis.


Picture of gel electrophoresis. LuxI and LuxR+Term cut with NotI, and LuxI and LuxR+term cut with E+S and X+P, respectively.


Cut of the parts consisting the genes, LuxI (<partinfo>Bba_C0061</partinfo>) and LuxR+term (<partinfo>BBa_C0062</partinfo>, <partinfo>BBa_B0015</partinfo>), and extracted the DNA from the gel. Concentrations are listed below.

BioBrick Enzymes Concentration [ng/µl]
LuxI EcoRI+SpeI 4.2
LuxR+term XbaI+PstI 5.6

Ligation mixes were made according to protocol with the following ingredients, as well as religation of the backbones:

Backbone Insert Plasmid
K <partinfo>BBa_J23119</partinfo> RBS+LacI+term <partinfo>BBa_B0030</partinfo>, <partinfo>Bba_C0012</partinfo>, <partinfo>BBa_B0015</partinfo> <partinfo>psB1A2</partinfo>
Vgb+RBS <partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo> LuxR+term <partinfo>BBa_C0062</partinfo>, <partinfo>BBa_B0015</partinfo> <partinfo>psB1A2</partinfo>
term <partinfo>BBa_B0015</partinfo> LuxI <partinfo>BBa_C0061</partinfo> <partinfo>pSB1AK3</partinfo>

These were then transformed in competent DH5ɑ cells, as described in the protocol. The petri dishes (all with Ampicillin) were left in the incubator over night.

10 µl of the liquid cultures for K+RBS+colicin and LuxR+DTT was transferred to 5 ml of new liquid medium to be used in testing of the colicin biobrick. The rest of the samples were miniprepped using the Promega SV Miniprep kit. The concentrations of the samples are given below:

Biobrick Concentration [ng/µl]
K+RBS+colicin 31.1
LuxR+DTT 31.3

We also recieved the high expression plasmid for his-tagged LldR today. This was transformed to competent E.coli K-12 ER2566 cells, as E.coli Dh5α, which are the cells we normally use in transformation, are unsuited when working with expression of proteins.

Monday 13.08.12


Transferred K+RBS+Colisin (<partinfo>BBa_K081005</partinfo> and <partinfo>BBa_K150009</partinfo>), PLuxR+HSL+RBS+Lysis (<partinfo>BBa_R0062</partinfo>, <partinfo>BBa_B0034</partinfo> and <partinfo>BBa_K112808</partinfo>) to liquid media.

Did a restriction digest on the following biobricks, as described in the protocol.

Biobricks BioBrick no. Enzymes
Vgb+RBS <partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo> SpeI+PstI, NotI
LuxR+term <partinfo>BBa_C0062</partinfo>, <partinfo>BBa_B0015</partinfo> XbaI+PstI, NotI
RBS+LacI+term <partinfo>BBa_B0030</partinfo>, <partinfo>Bba_C0012</partinfo>, <partinfo>BBa_B0015</partinfo> XbaI+PstI, NotI
LuxI <partinfo>Bba_C0061</partinfo> EcoRI+SpeI, NotI
K <partinfo>BBa_J23119</partinfo> SpeI+PstI

Did a gel electrophoresis on the mixes above (except for the konstitutive promoter <partinfo>BBa_J23119</partinfo>), but only two of them where as expected. Did a new restriction digest on the two that didn't give the correct bands: LuxI (<partinfo>Bba_C0061</partinfo>) and LuxR+term (<partinfo>BBa_C0062</partinfo> and <partinfo>BBa_B0015</partinfo>).

Picture of gel electrophoresis with test cutting with NotI (to the left) and regular cutting (to the right) of LuxI (EcoRI+SpeI), LuxR+term (X+P), RBS+lacI+term (XbaI+PstI) and Vgb+RBS (SpeI+PstI), respectively.

Extracted DNA from gel on the part RBS+LacI+term (<partinfo>BBa_B0030</partinfo>, <partinfo>Bba_C0012</partinfo> and <partinfo>BBa_B0015</partinfo>) and did a PCR purification on Vgb+RBS (<partinfo>BBa_K561001</partinfo> and <partinfo>BBa_B0034</partinfo>) and the konstitutive promoter (K <partinfo>BBa_J23119</partinfo>).

The concentrations on the purified parts are as follows:

Biobricks BioBrick no. Concentration [ng/µl]
K <partinfo>BBa_J23119</partinfo> 3.0
Vgb+RBS <partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo> 3.6
RBS+LacI+term <partinfo>BBa_B0030</partinfo>, <partinfo>Bba_C0012</partinfo>, <partinfo>BBa_B0015</partinfo> 4.7

Friday 10.08.12


Performed miniprep on the following constructs:

  1. VGB+RBS+YFP+term (<partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo>, <partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>)
  2. VHB+RBS+YFP+term (<partinfo>BBa_K258005</partinfo>, <partinfo>BBa_B0034</partinfo>, <partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>)
  3. LuxI+term (<partinfo>Bba_C0061</partinfo>, <partinfo>BBa_B0015</partinfo>)

The concentrations were as follows:

Biobrick Concentration ng/uL
VGB+RBS+YFP+term 35,2
VHB+RBS+YFP+term 38,9
LuxI+term 48,2

Transformed K+RBS+colicin.

Test constructs for Vgb and Vhb (Vgb+RBS+YFP+DTT and Vhb+RBS+YFP+DTT) were transferred to liquid medium for testing on monday.

It was attempted to make LldR by PCR one more time. The following PCR mix was used:

  • 32.5 µl dH2O
  • 10 µl 5x Phusion DNA polymerase buffer
  • 1 µl dNTPs
  • 2.5 µl fwd primer previously diluted 1:10
  • 2.5 µl rev primer previously diluted 1:10
  • 1 µl template DNA (E.coli K-12 genome)
  • 0.5 µl Phusion DNA polymerase

The following primers were used:

Primer Sequence
LldR fwd atgattgttttacccagacgcctgt
LldR rev tcatgcgtttttctccctcgaat

The PCR machine was programmed according to the following table:

Step Action Temperature Duration
1 Heated lid: 103°C
2 Initial denaturation; 98°C 30 s
3 Denaturation; 98°C 10 s
4 Annealing; 45°C 10 s
5 Elongation; 72°C 24 s
6 Go to step 3, repeat 25 x
7 Final elongation; 72°C 5 min
8 Hold 4°C

Thursday 09.08.12


Performed miniprep on RBS (<partinfo>BBa_B0030</partinfo>) and plld+RBS. The concentration were as follows:

Biobrick Concentration ng/uL
RBS 41,3
plld+RBS 43,7

Did a restriction digest as described in the protocol on the following parts. On the pieces to be used as inserts, the number of base pairs are also listed.

Biobrick/Construct BioBrick Enzymes Buffer bp insert
LuxI+term <partinfo>Bba_C0061</partinfo>, <partinfo>BBa_B0015</partinfo> XbaI+PstI 3 747
YFP+term <partinfo>BBa_E0030</partinfo>, <partinfo>BBa_B0015</partinfo> XbaI+PstI 3 852
Lysis <partinfo>BBa_K112808</partinfo> XbaI+PstI 3 1785
LuxI <partinfo>Bba_C0061</partinfo> XbaI+PstI 3 618
RBS* <partinfo>BBa_B0030</partinfo> SpeI+PstI 1 -
PluxR+HSL <partinfo>BBa_R0062</partinfo> SpeI+PstI 1 -
RBS <partinfo>BBa_B0034</partinfo> SpeI+PstI 1 -
pSB1A3 <partinfo>pSB1A3</partinfo> EcoRI+PstI+DpnI 3 -
plld - EcoRI+SpeI 4 344

The parts lysis <partinfo>BBa_K112808</partinfo>, YFP+term (<partinfo>BBa_E0030</partinfo>, <partinfo>BBa_B0015</partinfo>), <partinfo>pSB1A3</partinfo> and plld will be assembled using the 3A assembly, so made double cutting mix with these parts.

Gel electrophoresis was done with luxI+term (<partinfo>Bba_C0061</partinfo>, <partinfo>BBa_B0015</partinfo>), lysis <partinfo>BBa_K112808</partinfo>, YFP+term (<partinfo>BBa_E0030</partinfo>, <partinfo>BBa_B0015</partinfo>), LuxI <partinfo>Bba_C0061</partinfo> and plld. The gel did not show either LuxI or LuxI+term, but cut out lysis, YFP+term and plld. Will do a gel extraction on those, and a PCR purification on <partinfo>pSB1A3</partinfo>, RBS <partinfo>BBa_B0034</partinfo>, RBS* <partinfo>BBa_B0030</partinfo> and PLuxR+HSL <partinfo>BBa_R0062</partinfo>. This will be done as described in protocols.

Ligated together the following, as described in protocols:

Ligation # Backbone Insert
1 RBS* <partinfo>BBa_B0030</partinfo> LacI+term <partinfo>Bba_C0012</partinfo>, <partinfo>BBa_B0015</partinfo>
2 RBS <partinfo>BBa_B0034</partinfo> LuxR+term <partinfo>BBa_C0062</partinfo>, <partinfo>BBa_B0015</partinfo>
3 pLuxR+HSL<partinfo>BBa_R0062</partinfo> Lysis <partinfo>BBa_K112808</partinfo>

3A assembly was used on the following parts, as described in the Protocol, by Northwestern University:

Ligation # Backbone Insert 1 Insert 2
1 <partinfo>pSB1A3</partinfo> plld YFP+term<partinfo>BBa_E0030</partinfo>, <partinfo>BBa_B0015</partinfo>
2 <partinfo>pSB1A3</partinfo> plld Lysis <partinfo>BBa_K112808</partinfo>

Since the restriction digest didn't give anything for LuxI <partinfo>Bba_C0061</partinfo> and LuxI+term (<partinfo>Bba_C0061</partinfo>, <partinfo>BBa_B0015</partinfo>), will a colony from LuxI+term (<partinfo>Bba_C0061</partinfo>, <partinfo>BBa_B0015</partinfo>) be transferred to liquid media and LuxI <partinfo>Bba_C0061</partinfo> will be transformed again.

The following was also transformed: RBS*+LacI+term (<partinfo>BBa_B0030</partinfo>, <partinfo>Bba_C0012</partinfo> and0 <partinfo>BBa_B0015</partinfo>), RBS+LuxR+term (<partinfo>BBa_B0034</partinfo>, <partinfo>BBa_C0062</partinfo> and <partinfo>BBa_B0015</partinfo>), pLuxR+HSL+Lysis (<partinfo>BBa_R0062</partinfo> and <partinfo>BBa_K112808</partinfo>), <partinfo>pSB1A3</partinfo>+plld+YFP+term (<partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>) and <partinfo>pSB1A3</partinfo>+plld+Lysis (<partinfo>BBa_K112808</partinfo>). Did religations of the backbones for all of the above. Transferred 200 µl to petri dishes and inoculated in 37C over night.

Wednesday 08.08.12


Tranformed Vgb+RBS+YFP+term (<partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo>, <partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>) and Vhb+RBS+YFP+term (<partinfo>BBa_K258005</partinfo>, <partinfo>BBa_B0034</partinfo>, <partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>) in competent DH5ɑ cells as described in the protocol. The plasmid in both of the constructs is <partinfo>psB1A2</partinfo>. They were left in the incubator over night.

Inspected the petri dishes with plld+RBS (lactate induced promoter and <partinfo>BBa_B0030</partinfo>) and the religation of RBS <partinfo>BBa_B0030</partinfo>, had many more colonies on the plld+RBS than the religation, which is good. Transferred a colony of the plld+RBS (lactate promoter and <partinfo>BBa_B0030</partinfo>) and a colony of RBS <partinfo>BBa_B0030</partinfo> to liquid media, with ampicillin resistance.

LacI+term (<partinfo>BBa_C0012</partinfo>) + (<partinfo>BBa_B0014</partinfo>)was miniprepped and concentration was 216,1 ng/uL.

Cut LacI+term (<partinfo>BBa_C0012</partinfo>) and (<partinfo>BBa_B0014</partinfo>), LuxI+term (<partinfo>Bba_C0061</partinfo> and <partinfo>BBa_B0015</partinfo>) and LuxR+term (<partinfo>BBa_C0062</partinfo> and <partinfo>BBa_B0015</partinfo>) with XbaI and PstI, so that they can be used as inserts. RBS(<partinfo>BBa_B0034</partinfo>) was cut with Spe1 and Pst1 and will be used further as a backbone.Used the protocol with NEBuffer 2 and 3.

Did a gel electrophoresis with LuxI+term (<partinfo>Bba_C0061</partinfo> and <partinfo>BBa_B0015</partinfo>) and LuxR+term (<partinfo>BBa_C0062</partinfo> and <partinfo>BBa_B0015</partinfo>).

Purified RBS and LuxR+term. Resulting concentrations were 4.8 and 11.2 ng/µl, respectively. LacI+ term was also purified from gel using the gel extracion kit for Qiagen, and the concentration was 1,5 ng/uL.

Tuesday 07.08.12


Inspected the petri dishes from yesterday, LacI <partinfo>BBa_C0012</partinfo> + terminator <partinfo>BBa_B0015</partinfo> showed colonies, the religation of the terminator <partinfo>BBa_B0015</partinfo> did not. Transferred a LacI <partinfo>BBa_C0012</partinfo> + terminator <partinfo>BBa_B0015</partinfo> colony to LB with ampicillin and inoculated at 37C with shaking.

Did a gel electrophoresis on plld, cut it out and extracted it, according to protocols. The concentration after gel extraction was: cplld = 10,6 ng/µl.

Picture of gel electrophoresis with plld. It was found at approximately 340 bp, as expected (344 bp).

Ligation was performed with plld as insert and RBS <partinfo>BBa_B0034</partinfo> as backbone. That means that the construct has a <partinfo>psB1A2</partinfo> plasmid. Also did a religation of the RBS <partinfo>BBa_B0034</partinfo> without any insert.

Transformed plld and RBS <partinfo>BBa_B0034</partinfo> in competent DH5ɑ cells, as well as the religation of RBS <partinfo>BBa_B0034</partinfo>. They were transferred to petri dishes with ampicillin resistance and left in the incubator over night.

Miniprepped VHB+RBS+lysis (<partinfo>BBa_K258005</partinfo>, <partinfo>BBa_B0034</partinfo> and <partinfo>BBa_K112808</partinfo>), VGB+RBS+lysis (<partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo> and <partinfo>BBa_K112808</partinfo>), pllD+lysis (lactate promoter and <partinfo>BBa_K112808</partinfo>) and three parallels of pBad+YFP (<partinfo>Bba_K206000</partinfo> and <partinfo>BBa_E0030</partinfo>)

Sample Concentration [ng/µl]
VHB+RBS+lysis 38,2
VGB+RBS+lysis 50,5
pllD+lysis 40,2
pBad+YFP #1 46,6
pBad+YFP #2 40,5
pBad+YFP #3 38,9

Monday 06.08.12


In order to start making the construct for the biobrick we are going to improve, the parts needed for the construct were cut using the restriction digest protocol [1].

RBS <partinfo>BBa_B0030</partinfo> will be used as a backbone and was cut with EcoRI and XbaI. LacI <partinfo>BBa_C0012</partinfo> will be an insert, and was cut with EcoRI and SpeI. The terminator <partinfo>BBa_B0014</partinfo> will be used as a backbone and was cut with EcoRI and XbaI. In addition we will test the construct using a constitutive promoter <partinfo>BBa_J23119</partinfo> which was cut using EcoRI and SpeI.

The inserts LacI <partinfo>BBa_C0012</partinfo> and constitutive promoter <partinfo>BBa_J23119</partinfo> were run on gel after the restriction digest. The problem with the constitutive promoter is that it is only 35 b.p long, and is therefore difficult to use as an insert. We tried to stop the gel early to see if we could detect the constitutive promoter, but we could not see anything at all. We therefore ran the gel further and cut the LacI <partinfo>BBa_C0012</partinfo> out of the gel.

Gel picture of the two inserts ran on gel. Used two different ladders. To the left we used a 1kb ladder to identify the Lac I insert, and to the right we used a 50 kb ladder to identify the constitutive promoter. Expected the LacI band to be approximately 1100 bp which seems to be about right. The constitutive promoter was expected to be 35 bp, but was not detected on the gel at all.

Used the PCR purification kit and protocol from www.qiagen.com [http://www.google.no/url?sa=t&rct=j&q=&esrc=s&source=web&cd=2&ved=0CFUQFjAB&url=http%3A%2F%2Fwww.qiagen.com%2FHB%2FQIAquickGelExtractionKit_EN&ei=RhYhUPiCA4iL4gS64oD4CA&usg=AFQjCNFwed-RxSRRgTFSJgtn7Fl5qisiWw&sig2=-pxyzkbLpVKt4DLlcSzQcw], on RBS <partinfo>BBa_B0030</partinfo>, pBad <partinfo>Bba_K206000</partinfo> and terminator <partinfo>BBa_B0014</partinfo>. Did a gel extraction using the Gel Extraction kit and Protocol on LacI <partinfo>BBa_C0012</partinfo>.

Did a ligation with LacI <partinfo>BBa_C0012</partinfo> and double terminator <partinfo>BBa_B0015</partinfo>, where the double terminator <partinfo>BBa_B0015</partinfo> was used as a backbone. That means, the construct has a <partinfo>psB1AK3</partinfo> backbone and resistance Ampicillin and Kanamycin. A religation of the backbone <partinfo>BBa_B0015</partinfo> was also performed.

The ligated LacI <partinfo>BBa_C0012</partinfo> and double terminator <partinfo>BBa_B0015</partinfo> was transformed in competent DH5ɑ cells, along with the religation of the backbone <partinfo>BBa_B0015</partinfo>. The petri dishes are left to inoculate through the night.

A new batch of LA-medium was made and used to make ampicillin petri dishes.

A restriction digest was done on the lld promoter, as described in the protocols. It was cut with EcoRI and SpeI, and will be an insert with RBS <partinfo>BBa_B0030</partinfo> as backbone. This will then make the plasmid <partinfo>pSB1A2</partinfo> the backbone.

Sunday 05.08.12


Plasmid DNA was isolated from pllD-1B and <partinfo>BBa_B0014</partinfo> cultures were isolated by miniprep. DNA concentrations were measured as 41,2/42,5 and 53,3/52,8 ng/uL respectively (two measurements per sample).

Inspected agar plates in incubator inoculated on 3/8: VGB+RBS religation: 1 colony VHB+RBS+lysis: Good growth VHB+RBS religation: ~ 20 colonies VHB+RBS + lysis: Good growth pBAD (w/ backbone), religated: 40+ colonies pBAD +YFP +DTT: 7 colonies

Comments: Judging from the growth on the religation plates, colonies with non-insert plasmids is a possibility on all plates. pBAD is especially worrisome, as the number of colonies is lower on the insert ligation plate than on the backbone religation plate. The lysis part used in the above constructs already has an RBS, so the RBS part is redundant.

Induced one 5 mL culture (induction culture) pllD + lysis (3/8) with 210 uL ~ 1M lactate and addded 210 uL dH2O to another (control culture). Sampled 200 uL from both before induction, for OD measurements.

Inoculated 5 5 mL LB + Amp cultures with colonies from the following agar plates: VGB+RBS+Lysis (3/8) VHB+RBS+Lysis (3/8) pBAD + YFP +DTT (3/8) (3 colonies)

Inoculated 3 5 mL LB + Cm cultures from pllD + lysis agar plate.

Friday 03.08.12


Isolated plasmid DNA from the cultures of RBS* (<partinfo>BBa_B0030</partinfo>) and LacI (<partinfo>BBa_C0012</partinfo>) inoculated yesterday.

Ligated pBad (<partinfo>Bba_K206000</partinfo>) together with YFP+DTT (<partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>), and VGB+RBS (<partinfo>BBa_K561001</partinfo> and <partinfo>BBa_B0034</partinfo>) and VHB+RBS (<partinfo>BBa_K258005</partinfo> and <partinfo>BBa_B0034</partinfo>) with Lysis (<partinfo>BBa_K124017</partinfo>). These were then transformed into competent E. coli DH5α cells and plated out on petri dishes with Ampicillin.

Terminator <partinfo>BBa_B0014</partinfo> and re-transformed pllD in <partinfo>pSB1C3</partinfo> ("pllD 1-B") were transferred to liquid culture.

Ran gel on the PCR-products from yesterday.

Inoculated 2 x 5 mL, 1 x 10 mL and 1 x 25 mL LB + Cm with plld + lysis.

Thursday 02.08.12


5 µl of the PCR product from yesterday was run on gel, but it did not give any results. We looked at the primers and thought we had done something wrong, but we did not. Will try to do the PCR one more time, but with a lower annealing temperature (55°C).

The constructs containing plld ligated with the lysis device(<partinfo>BBa_K112808</partinfo>), and plld in plasmid <partinfo>PSB1C3</partinfo> were miniprepped. The concentration were measured using nano drop.

Sample Concentration [ng/µl]
pllD + lysis 45,5
pllD in PSB1C3 42,3

Inoculated 1 colony from each of three plates containing LacI (<partinfo>BBa_C0012</partinfo>), RBS* <partinfo>BBa_B0030</partinfo> and pllD + lysis (all inoculated 1/8), into 5 mL LB + Amp (BBa_B0030, LacI)/ LB + Cm (pllD + lysis).

Transformed the part <partinfo>BBa_B0014</partinfo> from the distribution kit, and re-transformed pllD in pSB1C3 with DNA taken from the sample shipped to the RHIT team yesterday.

Reviewed the data from the oxygen-promoter experiment on monday. In conclusion, it appears that oxygen levels in the induced (anaerobic) cultures were not as low as desired, as growth rates were very similar between the aerobic and anaerobic cultures, while one would expect anaerobic cultures to grow slower. After correcting for OD, the fluorescence in the cultures at the end of the experiment was lower than the fluorescence measured from a control culture with no expected production of fluorescent protein. For this reason, a full analysis of the rest of the data was not performed.

Wednesday 01.08.12


Gel purification was performed on the gel piece from yesterday, the lysis device cut with X+P. The concentration is 10,1 ng/µl. The lysis device and plld were ligated together, plld (with <partinfo>pSB1C3</partinfo>) as backbone.

The ligated lysis and plld were transformed into competent E.coli DH5α cells. This was also done for the biobricks lacI repressor from E. coli (<partinfo>BBa_C0012</partinfo>) and RBS (<partinfo>BBa_B0030</partinfo>).

The petri dishes from yesterday showed colonies on the dishes with the pSB1C3+Colisin construct (<partinfo>pSB1C3</partinfo> and <partinfo>BBa_K150009</partinfo>) and the K+RBS+Colisin construct (<partinfo>BBa_K081005</partinfo> and <partinfo>BBa_K150009</partinfo>). One colony from each petri dish were transferred to liquid medium.

Sent a sample of the E. coli pllD promoter in <partinfo>pSB1C3</partinfo> backbone to the iGEM team at RHIT.

PCR was performed on pBad (<partinfo>Bba_K206000</partinfo>) and DTT (<partinfo>BBa_B0015</partinfo>), the primers used, PCR-mix and programmed times are listed below.

Primer Type Sequence Tm [°C]
DTT fwd Forward CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAG 72
DTT rev Reverse CTCTAGAAGCGGCCGCGAATTCCAGAAATC 72
pBad scar fwd Forward TACTAGAGTACTAGTAGCGGCCGCTGCAGT 72
pBad fwd Forward TACTAGTAGCGGCCGCTGCAGTC 70
pBad rev Reverse GCTAGCCCAAAAAAACGGTATGGAGAAACAGTAGAGAG 72

Mix 1:

  • 1 µl dNTP
  • 2,5 µl 1:10 fwd primer
  • 2,5 µl 1:10 rev primer
  • 1 µl template DNA
  • 18 µl dH2O

Mix 2:

  • 19,25 µl d2O
  • 5 µl buffer with MgCl2
  • 0,75 µl Expand High Fidelity enzyme

This PCR mix was found here: http://francois.schweisguth.free.fr/protocols/High_fildelity_roche.pdf

Thermal timetables:

pBAD
Step Action Temperature Duration
1 Heated lid: 103°C
2 Initial denaturation; 94°C 2 min
3 Denaturation; 94°C 15 s
4 Annealing; 66°C 30 s
5 Elongation; 72°C 2 min
6 Go to step 3, repeat 10 x
7 Denaturation; 98°C 10 s
8 Elongation; 72°C 31 s
9 Go to step 7, repeat 15 x, with 5 s extra each time.
10 Final Elongation; 72°C 7 min
11 Hold 4°C
DTT
Step Action Temperature Duration
1 Heated lid: 103°C
2 Initial denaturation; 94°C 2 min
3 Denaturation; 94°C 15 s
4 Annealing; 66°C 30 s
5 Elongation; 72°C 3 min
6 Go to step 3, repeat 10 x
7 Denaturation; 98°C 10 s
8 Elongation; 72°C 31 s
9 Go to step 7, repeat 15 x, with 5 s extra each time.
10 Final Elongation; 72°C 7 min
11 Hold 4°C



Retrieved from "http://2012.igem.org/Team:NTNU_Trondheim/Notebook/August"