Team:BAU-Indonesia/Modeling

From 2012.igem.org

(Difference between revisions)
(Prototype team page)
 
(8 intermediate revisions not shown)
Line 1: Line 1:
-
<!-- *** What falls between these lines is the Alert Box!  You can remove it from your pages once you have read and understood the alert *** -->
+
{{Team:BAU-Indonesia/css}}
 +
{{Team:BAU-Indonesia/nivo-slider}}
 +
{{Team:BAU-Indonesia/css_gone}}
-
<html>
+
 
-
<div id="box" style="width: 700px; margin-left: 137px; padding: 5px; border: 3px solid #000; background-color: #fe2b33;">
+
<html xmlns="http://www.w3.org/1999/xhtml">
-
<div id="template" style="text-align: center; font-weight: bold; font-size: large; color: #f6f6f6; padding: 5px;">
+
    <head>
-
This is a template page. READ THESE INSTRUCTIONS.
+
   
-
</div>
+
        <meta http-equiv="content-type" content="text/html; charset=utf-8" />
-
<div id="instructions" style="text-align: center; font-weight: normal; font-size: small; color: #f6f6f6; padding: 5px;">
+
        <title>Metamorphosis Design Free Css Templates</title>
-
You are provided with this team page template with which to start the iGEM season.  You may choose to personalize it to fit your team but keep the same "look." Or you may choose to take your team wiki to a different level and design your own wiki.  You can find some examples <a href="https://2008.igem.org/Help:Template/Examples">HERE</a>.
+
        <meta name="keywords" content="" />
 +
        <meta name="description" content="" />
 +
        <link href="styles.css" rel="stylesheet" type="text/css" media="screen" />
 +
<link rel="stylesheet" href="nivo-slider.css" type="text/css" media="screen" />
 +
       
 +
    </head>
 +
   
 +
    <script type="text/javascript" src="https://sites.google.com/site/mariozoner/gb-mario/jquery-1.3.2.js"></script>
 +
 
 +
<script type="text/javascript">
 +
$(function() {
 +
var d=300;
 +
$('#navigation a').each(function(){
 +
$(this).stop().animate({
 +
'marginTop':'-80px'
 +
},d+=150);
 +
});
 +
 
 +
$('#navigation > li').hover(
 +
function () {
 +
$('a',$(this)).stop().animate({
 +
'marginTop':'-2px'
 +
},200);
 +
},
 +
function () {
 +
$('a',$(this)).stop().animate({
 +
'marginTop':'-80px'
 +
},200);
 +
}
 +
);
 +
});
 +
</script>
 +
 
 +
<style>
 +
*Navigasi*/
 +
ul#navigation { position:fixed; margin:0px; padding:0px; top:-20px; left:370px; list-style:none; z-index:999999; width:675px; font:normal 16px Electrolize,Sans-Serif bold; -webkit-animation:2s fxhompinav ease-in-out; -moz-animation:2s fxhompinav ease-in-out; -ms-animation:2s fxhompinav ease-in-out; animation:2s fxhompinav ease-in-out; }
 +
 
 +
ul#navigation li { width:95px; display:inline; float:left; margin:0 0 0 2px; }
 +
ul#navigation li a { display:block; float:left; margin-top:-74px; width:95px; height:28px; background-color: rgba(0, 0, 0, 0.6);
 +
background: rgba(0, 0, 0, 0.6);
 +
color: rgba(0, 0, 0, 0.6); background-repeat:no-repeat; background-position:50% 150px; border:2px solid #b9b9b9; -webkit-box-shadow:0 1px 2px rgba(0, 0, 0, 0.5); -moz-box-shadow:0 1px 2px rgba(0, 0, 0, 0.5); box-shadow:0 1px 2px rgba(0, 0, 0, 0.5); -moz-border-radius:0px 0px 10px 10px; -webkit-border-bottom-right-radius:10px; -webkit-border-bottom-left-radius:10px; -khtml-border-bottom-right-radius:10px; -khtml-border-bottom-left-radius:10px; border-radius:0px 0px 10px 10px; color:#333333; text-decoration:none; text-align:center;color:#f1f1f1; text-shadow:0 1px 1px #000; padding-top:95px; -webkit-transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; -moz-transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; -o-transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; transition:margin-top 0.3s ease-in-out,background-position 0.4s ease-out; }
 +
 
 +
ul#navigation li a:hover { margin-top:-3px; background-position:100% -5px; color:#7b7b7b; position:relative; }
 +
 
 +
ul#navigation li a:hover:after { content:""; width:0px; height:0px; position:absolute; top:100%; left:45%; margin-top:2px; border-width:5px; border-style:solid; border-color:transparent transparent lime transparent; }
 +
 
 +
ul#navigation li:nth-child(1) a { background-image:url(https://static.igem.org/mediawiki/2012/c/cb/Asyu.png); }
 +
ul#navigation li:nth-child(2) a { background-image:url(https://static.igem.org/mediawiki/2012/b/be/Asyu2.png); }
 +
ul#navigation li:nth-child(3) a {background-image:url(https://static.igem.org/mediawiki/2012/1/18/Pr.jpg); }
 +
ul#navigation li:nth-child(4) a { background-image:url(https://static.igem.org/mediawiki/2012/d/da/Icon_dna.png); }
 +
ul#navigation li:nth-child(5) a { background-image:url(https://static.igem.org/mediawiki/2012/6/68/Edu-science-icon.png); }
 +
ul#navigation li:nth-child(6) a { background-image:url(https://static.igem.org/mediawiki/2012/0/00/Asyu5.png); }
 +
ul#navigation li:nth-child(7) a { background-image:url(https://static.igem.org/mediawiki/2012/1/19/Attributions2.png); }
 +
ul#navigation li:nth-child(8) a { background-image:url(https://static.igem.org/mediawiki/2012/0/0a/Medal-icon.png);
 +
  }
 +
 
 +
@-webkit-keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;} } @-moz-keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;} } @-ms-keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;} } @keyframes fxhompinav { from{margin-right:-1000px;} to {margin-right:0px;}
 +
/*Navigasi*/
 +
 
 +
</style>
 +
   
 +
<script language='javascript' src='https://sites.google.com/site/tutorialseoblogger/file/jquery_mini.js'></script>
 +
<script language='javascript' src='https://sites.google.com/site/tutorialseoblogger/file/jquery.dimensions.js'></script>
 +
   
 +
    <body>
 +
        <div id="bg_top">
 +
        <div id="wrap_bg">
 +
   
 +
              <div id='floatMenu'>
 +
<ul class='menu1'>
 +
<img src="https://static.igem.org/mediawiki/2012/1/19/Maskot_tim_iGEM_IPB.png"/>
 +
 
 +
<li><a href='#' onclick='MGJS.goTop();return false;'> Back to top </a></li>
 +
</ul>
 +
 
 +
<script language='javascript'>
 +
var name = "#floatMenu";
 +
var menuYloc = null;
 +
$(document).ready(function(){
 +
menuYloc = parseInt($(name).css("top").substring(0,$(name).css("top").indexOf("px")))
 +
$(window).scroll(function () {
 +
offset = menuYloc+$(document).scrollTop()+"px";
 +
$(name).animate({top:offset},{duration:500,queue:false});
 +
});
 +
});
 +
</script>
</div>
</div>
-
<div id="warning" style="text-align: center; font-weight: bold; font-size: small; color: #f6f6f6; padding: 5px;">
+
           
-
You <strong>MUST</strong> have all of the pages listed in the menu below with the names specified. PLEASE keep all of your pages within your teams namespace.
+
      <ul id="navigation" style="margin:40px 0 0 220px">
-
</div>
+
<li class="nav1"><a href="https://2012.igem.org/Team:BAU-Indonesia">Home</a></li>
-
</div>
+
<li class="nav2"><a href="https://2012.igem.org/Team:BAU-Indonesia/Team">Team</a></li>
-
</html>
+
<li class="nav3"><a href="https://2012.igem.org/Team:BAU-Indonesia/Project">Project</a></li>
 +
<li class="nav4"><a href="https://2012.igem.org/Team:BAU-Indonesia/Parts">Parts</a></li>
 +
<li class="nav5"><a href="https://2012.igem.org/Team:BAU-Indonesia/Modeling">Modeling</a></li>
 +
<li class="nav6"><a href="https://2012.igem.org/Team:BAU-Indonesia/Notebook">Notebook</a></li>
 +
<li class="nav7"><a href="https://2012.igem.org/Team:BAU-Indonesia/Attributions">Attributions</a></li>
 +
<li class="nav8"><a href="https://2012.igem.org/Team:BAU-Indonesia/Achievements">Achievement</a></li>
-
<!-- *** End of the alert box *** -->
+
</ul>
 +
            <img style="margin-left:-900px" src="https://static.igem.org/mediawiki/2012/archive/9/90/20120909091254%21BAU-Indonesia_logo.png" />
 +
            <div id="wrap">
 +
        <div id="header">
 +
 +
<div id="prew_box">
 +
<div id="wrapper">
 +
        <div id="slider-wrapper">       
 +
            <div id="slider" class="nivoSlider">
 +
<img src="https://static.igem.org/mediawiki/2012/b/bd/Header2projek_copy.jpg" alt="" />
 +
<img src="https://static.igem.org/mediawiki/2012/d/d4/Header1_tim.jpg" alt="" />
 +
                <img src=" https://static.igem.org/mediawiki/2012/e/e8/Header1.jpg" alt="" />
 +
                <img src="https://static.igem.org/mediawiki/2012/4/48/Header9.jpg" alt=""/>
 +
                <img src="https://static.igem.org/mediawiki/2012/e/e8/Header4.jpg" alt="" />
 +
<img src="https://static.igem.org/mediawiki/2012/8/8c/Header3.jpg" alt="" />
 +
                <img src="https://static.igem.org/mediawiki/2012/0/07/Header8.jpg" alt="" />
 +
            </div>       
 +
        </div>
 +
<script type="text/javascript" src="http://wiki-rian.googlecode.com/files/jquery-1.4.3.min.js"></script>
-
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"
+
    <script type="text/javascript" src="http://wiki-rian.googlecode.com/files/jquery.nivo.slider.pack.js"></script>
-
!align="center"|[[Team:BAU-Indonesia|Home]]
+
   
-
!align="center"|[[Team:BAU-Indonesia/Team|Team]]
+
    <script type="text/javascript">
-
!align="center"|[https://igem.org/Team.cgi?year=2012&team_name=BAU-Indonesia Official Team Profile]
+
    $(window).load(function() {
-
!align="center"|[[Team:BAU-Indonesia/Project|Project]]
+
        $('#slider').nivoSlider();
-
!align="center"|[[Team:BAU-Indonesia/Parts|Parts Submitted to the Registry]]
+
    });
-
!align="center"|[[Team:BAU-Indonesia/Modeling|Modeling]]
+
    </script>
-
!align="center"|[[Team:BAU-Indonesia/Notebook|Notebook]]
+
</div>
-
!align="center"|[[Team:BAU-Indonesia/Safety|Safety]]
+
-
!align="center"|[[Team:BAU-Indonesia/Attributions|Attributions]]
+
-
|}
+
 +
</div>
 +
 +
</div> <div style="clear: both"></div>
 +
<div id="content" style="background:url(https://static.igem.org/mediawiki/2012/6/67/A.jpg)">
-
If you choose to include a '''Modeling''' page, please write about your modeling adventures here. This is not necessary but it may be a nice list to include.
+
<!--                   
 +
<div class="verticalaccordion">
 +
<ul>
 +
    <li>
 +
      <h3>Daftar isi</h3>
 +
        <div id="isinya">isi konten di sini bisa juga dengan java script atau yang lainnya</div>
 +
    </li>
 +
    <li>
 +
      <h3>F1</h3>
 +
        <div id="isinya">pokonya apa saja isi di sini terserah mau di isi apa</div>
 +
    </li>
 +
    <li>
 +
      <h3>Free Dfloaf</h3>
 +
        <div id="isinya">isi apa saja terserah sobat</div>
 +
    </li>
 +
    <li>
 +
      <h3>Free Dosfs</h3>
 +
        <div id="isinya">isi konten  di sini bisa dengan gambar atau yang lainnya</div>
 +
    </li>
 +
</ul>
 +
</div>
 +
      --> 
 +
<div id="left_column" style="width:auto">
 +
<!-- Start left news box -->
 +
<div class="left_news_box">
 +
<div class="left_news_top"></div>
 +
<div class="left_news_bg">
 +
<h2><b>Modeling</b></h2>
 +
<br> <div class="text">
 +
 
 +
                                   
 +
    <h4 style="text-align:center">
 +
                                        Biobrick parts that we have been using  is <b> Coming Soon </b> (in progress) because the Protein Coding Site (Cutinase gene) is in sequencing process. so we're not be able to post our parts.<br>
 +
We use cutinase gene (LC cutinase) which is homolog with Thermobifidafuscacutinase. We align some cutinase gene that we got from the gene bank, and create the DNA primer from it. Our forward primer is
 +
5' AACCCCTACGAGCGCGGCCCC 3' and our reverse primer is5' AGAACGGGCAGGTGGAGCGGT 3'.<br>
 +
We use strong constitutive promoter, and we cut it from PET 14 plasmids then we'll connect it to the plasmid vector pSB1C3. We use the strong constitutive promoter because we want the enzyme secreted continuously.<br>
 +
We just use one modul, <b>The Degradation Modul </b><br><br><br>
 +
<img src="https://static.igem.org/mediawiki/2012/0/0c/Biobrick_design_PAKE.png" />
 +
</h4><br>   
 +
 
 +
       
 +
       
 +
       
 +
              </div>
 +
<div class="clear"></div>
 +
</div>
 +
<div class="left_news_bot"></div>
 +
</div>
 +
<!-- End left news box -->
 +
 +
 +
</div>
 +
 +
<div class="clear"></div>
 +
</div>
 +
<div id="footer">
 +
<!--footer begins -->
 +
 
 +
<div class="row-top">
 +
<div class="row-padding">
 +
<div class="wrapper">
 +
 +
<div class="col-3">
 +
<h2><b>Follow Us: <b/></h2>
 +
<ul class="list-services">
 +
 +
<li class="item-2"><a href="https://twitter.com/BAU_INDONESIA" target="_blank">Twitter (BAU-INDOESIA)</a></li>
 +
 +
</ul>
 +
</div>
 +
 +
 +
</div>
 +
</div><div class="clear"></div>
 +
 +
  </div>
 +
</div>
 +
 +
  </div>
 +
        </div>
 +
        </div>
 +
    </body>
 +
</html>

Latest revision as of 22:37, 26 September 2012


Metamorphosis Design Free Css Templates

Modeling


Biobrick parts that we have been using is Coming Soon (in progress) because the Protein Coding Site (Cutinase gene) is in sequencing process. so we're not be able to post our parts.
We use cutinase gene (LC cutinase) which is homolog with Thermobifidafuscacutinase. We align some cutinase gene that we got from the gene bank, and create the DNA primer from it. Our forward primer is 5' AACCCCTACGAGCGCGGCCCC 3' and our reverse primer is5' AGAACGGGCAGGTGGAGCGGT 3'.
We use strong constitutive promoter, and we cut it from PET 14 plasmids then we'll connect it to the plasmid vector pSB1C3. We use the strong constitutive promoter because we want the enzyme secreted continuously.
We just use one modul, The Degradation Modul



Retrieved from "http://2012.igem.org/Team:BAU-Indonesia/Modeling"