Team:Potsdam Bioware/Lab/Labjournal/October

From 2012.igem.org

(Difference between revisions)
(2012-10-24)
(2012-10-20)
 
(8 intermediate revisions not shown)
Line 270: Line 270:
* 120V
* 120V
<b>Results:</b><br>
<b>Results:</b><br>
 +
[[File:UP12_2012-10-20-preprgel_eyfp_mcherry.jpg|350px]]
* amplified eYFP and mcherry showed sufficient bp-size after PCR<br>
* amplified eYFP and mcherry showed sufficient bp-size after PCR<br>
<b>Further Tasks:</b><br>
<b>Further Tasks:</b><br>
Line 285: Line 286:
* extension PCR of scFv and nanobody
* extension PCR of scFv and nanobody
<br>
<br>
-
 
===<p style="background-color: rgb(240, 20, 70);"> 2012-10-20</p>===
===<p style="background-color: rgb(240, 20, 70);"> 2012-10-20</p>===
Line 395: Line 395:
* 120V
* 120V
<b>Results:</b><br>
<b>Results:</b><br>
 +
[[File:UP12_2012-10-20-nanoassemlby.jpg|300px]]
* amplified nanobody/Fc showed sufficient bp-size @ 1252bp <br>
* amplified nanobody/Fc showed sufficient bp-size @ 1252bp <br>
<b>Further Tasks:</b><br>
<b>Further Tasks:</b><br>
Line 526: Line 527:
<tr>
<tr>
</table>
</table>
-
<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: analytical gelelectrophoresis of amplified nanobody/Fc with RAGE-TMD overhangs</p>
+
<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: analytical gelelectrophoresis of amplified assembled nanobody/Fc with RAGE-TMD overhangs</p>
<b>Investigator:</b> Sascha<br>
<b>Investigator:</b> Sascha<br>
<b>Materials:</b><br>
<b>Materials:</b><br>
Line 536: Line 537:
* 120V
* 120V
<b>Results:</b><br>
<b>Results:</b><br>
 +
[[File:UP12_2012-10-21-amplified_assembled nano.jpg|100px ]]
* assembled nanobody/Fc-RAGE-TMD-mcherry showed sufficient bp-size: 2,1kb<br>
* assembled nanobody/Fc-RAGE-TMD-mcherry showed sufficient bp-size: 2,1kb<br>
<b>Further Tasks:</b><br>
<b>Further Tasks:</b><br>
Line 789: Line 791:
* 120V
* 120V
<b>Results:</b><br>
<b>Results:</b><br>
 +
[[File:UP12_2012-10-22-scFVRAGEoverhang.jpg|300px ]]
* amplified scFv showed sufficient bp-size @ 9102bp <br>
* amplified scFv showed sufficient bp-size @ 9102bp <br>
<b>Further Tasks:</b><br>
<b>Further Tasks:</b><br>
Line 918: Line 921:
<tr>
<tr>
</table>
</table>
-
<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: analytical gelelectrophoresis of amplified nanobody/Fc with RAGE-TMD overhangs</p>
+
<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Topic: analytical gelelectrophoresis of assembled scFv-RAGE-eYFP construct</p>
<b>Investigator:</b> Sascha<br>
<b>Investigator:</b> Sascha<br>
<b>Materials:</b><br>
<b>Materials:</b><br>
Line 928: Line 931:
* 120V
* 120V
<b>Results:</b><br>
<b>Results:</b><br>
-
* assembled nanobody/Fc-RAGE-TMD-mcherry showed sufficient bp-size: 2,1kb<br>
+
[[File:UP12_2012-10-23-assembled RAGEscfv.jpg|300px]]
 +
* assembled scFv-RAGE-eYFP construct showed sufficient bp-size: 1,7kb<br>
<b>Further Tasks:</b><br>
<b>Further Tasks:</b><br>
* PCR-Clean up of 60°C-assembling PCR-mix  
* PCR-Clean up of 60°C-assembling PCR-mix  
-
* amplification of assembeled nanobody/Fc-RAGE-TMD-mcherry
+
* amplification of assembeled scFv-RAGE-eYFP construct
===<p style="background-color: rgb(240, 20, 70);">2012-10-23</p>===
===<p style="background-color: rgb(240, 20, 70);">2012-10-23</p>===
Line 944: Line 948:
* seeding of CHO and HeLa in Ibidi Dishes for transfection with new Nanobody RAGE construct
* seeding of CHO and HeLa in Ibidi Dishes for transfection with new Nanobody RAGE construct
* infection with Virus (CFP on surface and YFP as GOI, AAV with Sortase motif)
* infection with Virus (CFP on surface and YFP as GOI, AAV with Sortase motif)
-
===<p style="background-color: rgb(240, 20, 70);">2012-10-23</p>===
+
<br>
<p style="background-color: rgb(238, 221, 130); font-weight:bold;"> gelextracton of scFv-RAGE-TMD-EYFP in Flp-In vector construct out of 1% agarosegel </p>
<p style="background-color: rgb(238, 221, 130); font-weight:bold;"> gelextracton of scFv-RAGE-TMD-EYFP in Flp-In vector construct out of 1% agarosegel </p>
<b>Investigators:</b>Maria<br>
<b>Investigators:</b>Maria<br>
Line 1,071: Line 1,075:
* purification of Nanobody from supernatant of Cre recombinase transfected cells with magnetic beads
* purification of Nanobody from supernatant of Cre recombinase transfected cells with magnetic beads
* Western Blot of purified Nanobody
* Western Blot of purified Nanobody
 +
<br>
 +
<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Mini Prep of scFv-Flp-In vector clones </p>
 +
<br>
 +
<b>Investigator:</b>Maria<br>
 +
<br>
 +
<b>Materials: </b>overnight cultures scFv-Flp-In clones, Mini prep kit <br>
 +
<br>
 +
<b>Methods: </b>according to manual <br>
 +
<br>
 +
<b>Results: </b>
 +
Clon I: 514,8 ng/µl<br>
 +
Clon II: 673 ng/µl<br>
 +
Clon III: 639,7 ng/µl<br>
 +
Clon VI: 499 ng/µl<br>
 +
<br>
 +
<b>Further tasks: </b>analytical digestion, analytical gelelectrophoresis<br>
 +
<br>
 +
<p style="background-color: rgb(238, 221, 130); font-weight:bold;">analytical digestion of ligated scFv-Flp-In construct</p>
 +
<b>Investigators:</b>Maria<br>
 +
<br>
 +
<b>Materials:</b>
 +
* all 4 prepared scFv-Flp-In clones
 +
* FastDigest StuI, SpeI and PstI
 +
* 10x FD Green Buffer
 +
* sterile water
 +
<b>Method:</b>
 +
I:<br>
 +
* 10µl mix: 1µl StuI, 1µl 10x FD Green Buffer, 1µl of each clone respectively (approximately 250 ng DNA), sterile water add to 10µl
 +
II:<br>
 +
* 10µl mix: 1µl StuI, 1µl 10x FD Green Buffer, 1µl of each clone respectively (approximately 250 ng DNA), sterile water add to 10µl
 +
* incubation at 37°C for 30 min
 +
<b>further tasks:</b>
 +
* analytical gelelectrophoresis
 +
<p style="background-color: rgb(238, 221, 130); font-weight: bold;">Gelelectrophoresis of analytical digested scFv-Flp-In construct </p>
 +
<b>Investigators:</b>Maria<br>
 +
 +
<b>Aim:</b> checking plasmid-size after ligation of Flp-In vector with scFv-RAGE-TMD in 1% agarosegel<br>
 +
<b>Materials:</b><br>
 +
* agarose
 +
* 1xTAE-buffer
 +
* 10xFD Green Buffer
 +
<br>
 +
<b>Method:</b><br>
 +
* 1% agarosegel, 100ml
 +
* 120 V
 +
<b>Results:</b><br>
 +
* ligation successful <br>
 +
<b>Further Tasks:</b><br>
 +
* endotoxin free of clone
 +
<p style="background-color: rgb(238, 221, 130); font-weight:bold;">Endotoxin free preparation of scFv-RAGE-TMD</p>
 +
<br>
 +
<b>Investigator:</b>Maria<br>
 +
<br>
 +
<b>Materials: </b>endotoxin free Mediprep kit, overnight culture<br>
 +
<br>
 +
<b>Methods: </b>according to manual <br>
 +
<br>
 +
<b>Results: </b><b/>
 +
clone 1: 2349,7 ng/µl<br>
 +
<br>
 +
<b>Further tasks: </b>transient and stable transfection of CHO cells<br>
 +
<br>
==Virus==
==Virus==

Latest revision as of 18:24, 26 October 2012


Contents

AID

2012-10-10

Inoculation of plasmid samples of the 48h retransformation plates (after FACS)

Investigators: Tom


Time: 2012-10-10


Materials:

  • LB medium
  • Amp stock solution
  • plate with cultures:

EGFR-C-AID without NES, with NLS+Kozak sequence+eGFP

(after FACS selection)

Method:

Inoculation of:

5 cultures per plate in 5 ml LB medium + 5µL Amp.

(--> 5 cultures)

Further tasks:

  • Miniprep


2012-10-11

Purification of Retrafo plasmids


Investigators: Rico


Results: inoculation was not successful

2012-10-26

Purification of transfected wt AID, modified AID, TAL-AID plasmids cotransfected with small antibody construct and transformation


Investigators: Rico, Stefan, Tom


Method: transfected cells were lysed, plasmids purified and transformed into E. coli cells

Antibody

2012-10-12

cell culture


Investigator:Kerstin

Topic: cell-culture

  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa


Topic: planning new primer for integration of new RAGE-transmembrane domain and RAGE-signalpeptide

Investigator: Sascha

Materials and Methods: Geneious



Topic: Primer design and ordering for integration of RAGE-transmembrane domain into scFVconstruct and nanobody-geneart construct

Investigator: Sascha

Materials and Methods: Geneious

Results:

  • scFv:startprimer-fw
    • GCCTCTAGAGCTAGCATGGCAGC
  • rvp:scfv+overhang to TEV/TMD
    • CGCCCAAGATTCCCAGGGCCAGGGCGAGGGTGCCGCTTCCGCCGCCACCGCTTCCCCCTTGAAAATATAAATTCTCTCCAGATCCCCGTTT

GATCTCCAGTTCTGTCC

  • fwp:nterm. of yfp to TMD
    • CCCTGGGAATCTTGGGCGGCCTGGGGACCGCTGCCCTCTTGATCGGCGTGATCCTGTGGCAGAGAAGGTCTGGAGTGAGCAAGGGCGAG

GAGC

  • scFv:endprimer-rv
    • GAGCTGCAGCGGCCG
  • rage:startprimer-fw_nano/Fc
    • CTTGAATTCGCGGCCG
  • rage-rv:Fc to rageTMD
    • CGCCCAAGATTCCCAGGGCCAGGGCGAGGGTGCCGCTTCCTAATAACTTCGTATAATGTATGCTATACGAAGTTATCCC
  • rage-fwp:mcherry/rageTMD
    • CCCTGGGAATCTTGGGCGGCCTGGGGACCGCTGCCCTCTTGATCGGCGTGATCCTGTGGCAGAGAAGGGGCTCCATGGTGTCCAAGG
  • rage:endprimer in mcherry/loxp
    • AAGTCACTGCAGCGGCC


2012-10-15

cell culture


Investigator:Kerstin

Topic: cell-culture

  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa


2012-10-17

cell culture


Investigator:Kerstin

Topic: cell-culture

  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa
  • passaging of stably transfected Clones 4.1, 4.2, 4.3, 4,4, 29.1, 29.2, 29.3 with 550µg/ml Hygromycin

2012-10-19

cell culture


Investigator:Stefan/Kerstin

Topic: cell-culture

  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa


PCR: amplification of EYFP and mcherry with overhang of new RAGE-TMD

Investigators: Sascha
Materials:

  • Template: EYFP_Bba_E0030 and nano body-geneart-construct
  • Phusion-polymerase
  • 10x Phusion buffer HF
  • dNTPs (10mM)
  • eYFP: fwp:nterm. of yfp to TMD; primerVI: c-terminus of eyfp w
  • mcherry: rage-fwp:mcherry/rageTMD; rage:endprimer in mcherry/loxp
  • Thermocycler

Methods: 2x master mix of each: eYFP and mcherry

reagent volume [µL]
10x Phusion HF buffer 20
dNTPs 2
fwp:nterm. of yfp to TMD; rage-fwp:mcherry/rageTMD 5
primerVI: c-terminus of eyfp w; rage:endprimer in mcherry/loxp 5
template EYFP (10ng/µl); template nanobody-geneart-construct (10ng/µl) 2
Phusion Polymerase 1,0
water 66


Program

step Temperature [°C] duration [s] cycles
initial denaturation 98 30 1
denaturation 98 8 30
annealing gradient: 64,7°C/71°C for eYFP; 62,0°C/66,1°C for nanobody-geneart-construct 10 30
elongation 72 15 30
final elongation 72 600 1
cooling 8 1

Topic: preparative gelelectrophoresis of amplified EYFP and mcherry with RAGE-TMD and RAGE-signalpeptide overhangs

Investigator: Sascha
Materials:

  • agarose
  • 1xTAE-buffer
  • 10xFD Green Buffer

Method:

  • 1% agarosegel, 55ml
  • 120V

Results:
UP12 2012-10-20-preprgel eyfp mcherry.jpg

  • amplified eYFP and mcherry showed sufficient bp-size after PCR

Further Tasks:

  • gel extraction and concentration measurement
  • amplification of scFv-fragment and nanobody/Fc


gel extraction of amplified eYFP and mcherry out of 1% agarosegel

Investigators:Sascha
Results:
[eYFP] =
[mcherry] =
Further Taks:

  • extension PCR of scFv and nanobody


2012-10-20

PCR: amplification of nanobody/Fc with overhang of new RAGE-TMD

Investigators: Sascha
Materials:

  • Template: nanobody-geneart-construct
  • Phusion-polymerase
  • 10x Phusion buffer GC
  • dNTPs (10mM)
  • nanobody-geneart-construct: rage:startprimer-fw_nano/Fc; rage-rv:Fc to rageTMD
  • Thermocycler

Methods: 2x master mix of each: eYFP and mcherry

reagent volume [µL]
10x Phusion BC buffer 20
dNTPs 2
rage:startprimer-fw_nano/Fc 5
rage-rv:Fc to rageTMD 5
template nanobody-geneart-construct (10ng/µl) 6
Phusion Polymerase 1,0
water 92


Program

step Temperature [°C] duration [s] cycles
initial denaturation 98 30 1
denaturation 98 8 30
annealing 520°C/62°C/65,5°C 10 30
elongation 72 15 30
final elongation 72 600 1
cooling 8 1

Topic: preparative gelelectrophoresis of amplified nanobody/Fc with RAGE-TMD overhangs

Investigator: Sascha
Materials:

  • agarose
  • 1xTAE-buffer
  • 10xFD Green Buffer

Method:

  • 1% agarosegel, 55ml
  • 120V

Results:
UP12 2012-10-20-nanoassemlby.jpg

  • amplified nanobody/Fc showed sufficient bp-size @ 1252bp

Further Tasks:

  • gel extraction and concentrations measurement

gel extraction of amplified eYFP and mcherry out of 1% agarosegel

Investigators:Sascha
Results: [nanobody/FC] = 2,5ng/µl</b> Further Taks:

  • extension PCR of scFv and nanobody
  • assembly-PCR of nanobody/Fc with mherry via RAGE-transmembrane domain



PCR: assembly-PCR of nanobody/Fc with mcherry over RAGE-TMD

Investigators: Sascha
Materials:

  • Template: nanobody/FC and mcherry with TMD-overhangs
  • Phusion-polymerase
  • 10x Phusion buffer GC
  • dNTPs (10mM)
  • Thermocycler

Methods: 2x master mix of each: eYFP and mcherry

reagent volume [µL]
10x Phusion BC buffer 20
dNTPs 2
rage:startprimer-fw_nano/Fc was added after 15 assembling cycles 5
rage:endprimer in mcherry/loxp was added after 15 assembling cycles 5
templates: nanobody/FC with TMD-overhangs ; mcherry with TMD-overhangs (10ng/µl) 2µl of mcherry and 8µl of nanobody/Fc
Phusion Polymerase 1,0
water 57


Program

step Temperature [°C] duration [s] cycles
initial denaturation 98 30 15
denaturation 98 10 15
annealing 60°C/70°C 12 15
elongation 72 38 15
initial denaturation 98 30 15
denaturation 98 10 15
annealing 60°C/70°C 12 15
elongation 72 38 15
final elongation 72 600 1
cooling 8 1

Topic: analytical gelelectrophoresis of amplified assembled nanobody/Fc with RAGE-TMD overhangs

Investigator: Sascha
Materials:

  • agarose
  • 1xTAE-buffer
  • 10xFD Green Buffer

Method:

  • 1% agarosegel, 55ml
  • 120V

Results:
100px

  • assembled nanobody/Fc-RAGE-TMD-mcherry showed sufficient bp-size: 2,1kb

Further Tasks:

  • PCR-Clean up of 60°C-assembling PCR-mix
  • amplification of assembeled nanobody/Fc-RAGE-TMD-mcherry


PCR-Clean up of preparative gel electrophoresis of assembled nanobody/Fc-RAGE-TMD-mcherry and concentration measurement

Investigator: Sascha
Materials:

  • NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel)

Methods:

  • according to CleanUp-protocol

Results: [assembled nanobody/Fc-RAGE-TMD-mcherry ] =
Further Taks:

  • preparative gel electrophoresis of assembled nanobody/Fc-RAGE-TMD-mcherry


2012-10-21

Topic: preaparative gel electrophoresis of assembled nanobody/Fc-RAGE-TMD-mcherry

Investigator: Stefan
Materials:

  • agarose
  • 1xTAE-buffer
  • 10xFD Green Buffer

Method:

  • 1% agarosegel, 55ml
  • 120V

Results:

  • assembled nanobody/Fc-RAGE-TMD-mcherry showed sufficient bp-size: 2,1kb

Further Tasks:

  • gel extraction
  • cloning into pcDNA5FRT


2012-10-22

cell culture


Investigator:Kerstin

Topic: cell-culture

  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa
  • transfection of stably transfected clone 29.1 with Cre Recombinase
  • seeding of HT1080 in Ibidi Dish for infection with virus


2012-10-22

gel extraction of assembled nanobody/Fc-RAGE-TMD-mcherry out of 1% agarosegel

Investigators:Sascha
Results: [assembled/amplified nanobody/Fc-RAGE-TMD-mcherry] = 60,4ng/µl
Further Taks:

  • cloning into pcDNA5FRT


preparative digestion of assembled/amplified nanobody/Fc-RAGE-TMD-mcherry with NheI and ApaI

Investigator: Sascha
Materials:

  • Fast Digest NheI
  • Fast Digest ApaI
  • 10x FD Green Buffer
  • assembled/amplified nanobody/Fc-RAGE-TMD-mcherry
  • sterile water


Method:
2x

  • 20µl pcdna5frt (60,4ng/µl)
  • 2µl NheI
  • 2µl ApaI
  • 3µl 10x FD Green Buffer
  • 4µl sterile water
  • digestion for 1h at 37°C

>Results:
Further Tasks:

  • PCR-Clean Up

PCR-Clean up of digested assembled/amplified nanobody/Fc-RAGE-TMD-mcherry and concentration measurement

Investigator: Sascha
Materials:

  • NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel)

Methods:

  • according to CleanUp-protocol

Results: [assembled/amplified nanobody/Fc-RAGE-TMD-mcherry] = 6ng/µl
Further Taks:

  • ligation with pcDNA5FRT (dephos +dig)




ligation of digested dephosporylated pcDNA5FRT (NheI+ApaI) and digested assembled/amplified nanobody/Fc-RAGE-TMD-mcherry (NheI+ApaI)

Investigator: Sascha
Materials:

  • ligation calculator: http://www.insilico.uni-duesseldorf.de/Lig_Input.html
  • T4 DNA ligase
  • ligase buffer
  • digested geneart-nanobody-construct
  • digested and dephosporylated pcDNA5FRT


Method: ligation-ratio--> 1:3
:

  • 1µl T4 DNA ligase
  • 2µl T4 DNA-ligase buffer
  • 15 ng dig. pcDNA5FRT
  • 15 ng insert (assembled/amplified nanobody/Fc-RAGE-TMD-mcherry)
  • sterile water ad 20µl
  • 1:0 religation; same mix without insert

Further Tasks:

  • transformation of ligation mix into XL1-blue competent E. coli cells


  • incubation for 60min at RT

Further Tasks:

  • transformation of ligation mix into XL1-blue competent E. coli cells


Transformation of ligated pcDNA5FRT- assembled/amplified nanobody/Fc-RAGE-TMD-mcherry into new XL1-blue competent E. coli cells

Investigator: Sascha
Materials:

  • Bunsen Burner, Agar Plate with Ampicillin, 37 °C thermo mixer, centrifuge,
  • 12 µl of each ligation mix
  • icebox
  • new competent E. coli cells (XL 1)


Method:

  • according to manual
  • 20µl of resuspended cell-suspension were plated on a LB-Amp-plate
  • incubation o.n. at 37°C


Further Tasks:

  • picking clones



PCR: amplification of scFv with overhang of new RAGE-TMD

Investigators: Sascha
Materials:

  • Template: scFv_Bba pks…bla
  • Phusion-polymerase
  • 10x Phusion buffer HF
  • dNTPs (10mM)
  • rvp:scfv+overhang to TEV/TMD; primerI-fw:rage-signal, xbaI,
  • Thermocycler

Methods: 3x master mix of each: scFv

reagent volume [µL]
10x Phusion HF buffer 30
dNTPs 3
scfv+overhang to TEV/TMD 5
primerI-fw:rage-signal, xbaI 5
template scFv_Bba pks…bla (10ng/µl) 3
Phusion Polymerase 1,5
water 195


Program

step Temperature [°C] duration [s] cycles
initial denaturation 98 30 1
denaturation 98 8 30
annealing 53°C/60°C/71°C 10 30
elongation 72 15 30
final elongation 72 600 1
cooling 8 1

Topic: preparative gel electrophoresis of amplified scFv with RAGE-TMD overhangs

Investigator: Sascha
Materials:

  • agarose
  • 1xTAE-buffer
  • 10xFD Green Buffer

Method:

  • 1% agarosegel, 55ml
  • 120V

Results:
UP12 2012-10-22-scFVRAGEoverhang.jpg

  • amplified scFv showed sufficient bp-size @ 9102bp

Further Tasks:

  • PCR-Clean Up of amplified scFv


gel extraction of amplified scFv-RAGE-TMD out of 1% agarosegel

Investigators:Sascha
Results: [amplified scFv-RAGE-TMD] = 60,4ng/µl
Further Taks:

  • assembling with eYFP-RAGE overhang


PCR: assembly-PCR of scFv with eYFP over RAGE-TMD

Investigators: Sascha
Materials:

  • Template: scFv with eYFP with TMD-overhangs
  • Phusion-polymerase
  • 10x Phusion buffer GC
  • dNTPs (10mM)
  • Thermocycler

Methods: 3x master mix of each: eYFP

reagent volume [µL]
10x Phusion GC buffer 30
dNTPs 3
scFv:startprimer-fw, was added after 15 assembling cycles 7,5
scFv:endprimer-rv was added after 15 assembling cycles 7,5
templates: scFv with TMD-overhangs and RAGTE-signalpeptide (10ng/µl); eYFP with TMD-overhangs (10ng/µl) 1µl of eYFP and 1µl of scFv
Phusion Polymerase 1,5
water 96,5


Program

step Temperature [°C] duration [s] cycles
initial denaturation 98 30 15
denaturation 98 10 15
annealing 60°C/70°C 12 15
elongation 72 38 15
initial denaturation 98 30 15
denaturation 98 10 15
annealing 60°C/70°C 12 15
elongation 72 38 15
final elongation 72 600 1
cooling 8 1

Topic: analytical gelelectrophoresis of assembled scFv-RAGE-eYFP construct

Investigator: Sascha
Materials:

  • agarose
  • 1xTAE-buffer
  • 10xFD Green Buffer

Method:

  • 1% agarosegel, 55ml
  • 120V

Results:
UP12 2012-10-23-assembled RAGEscfv.jpg

  • assembled scFv-RAGE-eYFP construct showed sufficient bp-size: 1,7kb

Further Tasks:

  • PCR-Clean up of 60°C-assembling PCR-mix
  • amplification of assembeled scFv-RAGE-eYFP construct

2012-10-23

cell culture


Investigator:Stefan

Topic: cell-culture

  • seeding of CHO and HeLa in Ibidi Dishes for transfection with new Nanobody RAGE construct
  • infection with Virus (CFP on surface and YFP as GOI, AAV with Sortase motif)


gelextracton of scFv-RAGE-TMD-EYFP in Flp-In vector construct out of 1% agarosegel

Investigators:Maria
Aim: gelextraction and preparation of cleaned scFv-RAGE-TMD construct
Materials:

  • Gel-Clean-Up Kit


Method:

  • according to manual


Results:

  • 32,6 ng/µl


Further tasks:

  • digestion with NheI and ApaI

preparative digestion of scFv-RAGE-TMD construct with NheI and ApaI

Investigator: Maria
Aim: digestion of scFv-RAGE-TMD construct with NheI and ApaI for ligation into Flp-in vector
Materials:

  • Fast Digest NheI
  • Fast Digest ApaI
  • 10x FD Green Buffer
  • scFv construct
  • sterile water


Method:

  • 18,4µl scFv construct
  • 2µl NheI
  • 2µl ApaI
  • 3µl 10x FD Green Buffer
  • 4,6µl sterile water
  • digestion for 2,5h at 37°C


Further Tasks:

  • PCR clean-up
  • ligation into

PCR clean-up of scFv-RAGE-TMD construct

Investigator:Maria
Aim: cleaning of scFv-RAGE-TMD
Materials:

  • PCR-Clean-Up Kit

Method:

  • according to manual

Results:

  • concentration of cleaned scFv-RAGE-TMD = 19,7 ng/µl


ligation of digested scFv-RAGE-TMD construct and dephosporylated Flp-In vector

Investigator: Maria
Aim: ligation of digested scFv construct with Flp-In vector

Materials:

  • ligation calculator: http://www.insilico.uni-duesseldorf.de/Lig_Input.html
  • T4 DNA ligae
  • ligase buffer
  • digested scFv construct
  • digested and dephosporylated Flp-In vector


Method: ligation-ratio--> 1:3

  • 1µl T4 DNA ligase
  • 2,5µl T4 DNA-ligase buffer
  • 3,3µl digested scFv (19,7ng/µl)
  • 1µl digested Flp-In vector (60,4ng/µl)
  • 12,2µl sterile water


  • incubation for 1h at RT

Further Tasks:

  • transformation of ligation mix into XL1-blue competent E. coli cells


Transformation of ligated scFv-Flp-In vector into new XL1-blue competent E. coli cells

Investigator: Sascha
Materials:

  • Bunsen Burner, Agar Plate with Ampicillin, 37 °C thermo mixer, centrifuge,
  • 10 µl of cFv-Flp-In vector
  • icebox
  • competent E. coli cells (XL 1)


Method:

  • according to manual
  • 20µl of resuspended cell-suspension were plated on a LB-Cm-plate
  • incubation o.n. at 37°C


Further Tasks:

  • picking clones

2012-10-24

cell culture


Investigator:Stefan/Kerstin

Topic: cell-culture

  • Transfection of new Nanobody RAGE construct in CHO and HeLa
  • seeding of CHO and HeLa in Ibidi Dishes for transfection with new scFv RAGE construct
  • passaging of CHO w Zeocin
  • passaging of HT1080
  • passaging of HEK AAV 293
  • passaging of HeLa


Endotoxin free preparation of nanobody/Fc-RAGE-TMD-mcherry


Investigator:Maria

Materials: endotoxin free Mediprep kit, overnight culture

Methods: according to manual

Results: <b/> clone 2: 880,3 ng/µl

Further tasks: transient and stable transfection of CHO cells

2012-10-25

cell culture


Investigator:Stefan/Kerstin

Topic: cell-culture

  • transfection of new scFv RAGE construct
  • transfection of TAL-AID from cooperation with Freiburg iGEM Team in CHO cells (co-transfection with clone 4)
  • purification of Nanobody from supernatant of Cre recombinase transfected cells with magnetic beads
  • Western Blot of purified Nanobody


Mini Prep of scFv-Flp-In vector clones


Investigator:Maria

Materials: overnight cultures scFv-Flp-In clones, Mini prep kit

Methods: according to manual

Results: Clon I: 514,8 ng/µl
Clon II: 673 ng/µl
Clon III: 639,7 ng/µl
Clon VI: 499 ng/µl

Further tasks: analytical digestion, analytical gelelectrophoresis

analytical digestion of ligated scFv-Flp-In construct

Investigators:Maria

Materials:

  • all 4 prepared scFv-Flp-In clones
  • FastDigest StuI, SpeI and PstI
  • 10x FD Green Buffer
  • sterile water

Method: I:

  • 10µl mix: 1µl StuI, 1µl 10x FD Green Buffer, 1µl of each clone respectively (approximately 250 ng DNA), sterile water add to 10µl

II:

  • 10µl mix: 1µl StuI, 1µl 10x FD Green Buffer, 1µl of each clone respectively (approximately 250 ng DNA), sterile water add to 10µl
  • incubation at 37°C for 30 min

further tasks:

  • analytical gelelectrophoresis

Gelelectrophoresis of analytical digested scFv-Flp-In construct

Investigators:Maria

Aim: checking plasmid-size after ligation of Flp-In vector with scFv-RAGE-TMD in 1% agarosegel
Materials:

  • agarose
  • 1xTAE-buffer
  • 10xFD Green Buffer


Method:

  • 1% agarosegel, 100ml
  • 120 V

Results:

  • ligation successful

Further Tasks:

  • endotoxin free of clone

Endotoxin free preparation of scFv-RAGE-TMD


Investigator:Maria

Materials: endotoxin free Mediprep kit, overnight culture

Methods: according to manual

Results: <b/> clone 1: 2349,7 ng/µl

Further tasks: transient and stable transfection of CHO cells

Virus

2012-10-19

EGFRd3 purification

Investigator: Tobias/Xenia

Aim: Periplasma-Extract

Materials:

  • E. coli with expressed EGFR
  • Extraction buffer (50 mM Tris, 150 mM NaCl, 500 mM sucrose)
  • loading buffer (50 mM Tris, 150 mM NaCl, 30 mM imidazol)

Method:

  • resuspend E. coli with extraction buffer
  • incubate 2 hours at 4°C
  • centrifuge and take supernatant
  • dialyze against loading buffer over night

Further tasks:

  • purification with Ni-NTA

2012-10-20

EGFRd3 purification

Investigator: Tobias

Aim: Purification with Ni-NTA

Materials:

  • protein extract in loading buffer (50 mM Tris, 150 mM NaCl, 30 mM imidazol)
  • wash buffer (50 mM Tris, 150 mM NaCl, 30 mM imidazol)
  • elution buffer (50 mM Tris, 150 mM NaCl, 250 mM imidazol)
  • Ni-NTA column (1 mL volume)

Method:

  • loading Ni-NTA column with protein extract
  • wash column with wash buffer (10fold column volume)
  • elution with elution buffer and seperate ca. every 1 ml
  • control purity with SDS-PAGE

Results:

UP12 SDA-PAGE-2012-10-20.png

Further tasks:

  • concentrate purified EGFR and ligate with sortase