|
|
(15 intermediate revisions not shown) |
Line 3: |
Line 3: |
| [[File:Bacillus BioBrick Box banner.resized WORDS.JPG|620px|link=]] | | [[File:Bacillus BioBrick Box banner.resized WORDS.JPG|620px|link=]] |
| | | |
- | [[Image:BacillusBioBrickBox.png|100px|right|link=Team:LMU-Munich/Team:LMU-Munich/Bacillus_BioBricks]]
| |
| | | |
| + | [[Image:BacillusBioBrickBox.png|100px|right|link=]] |
| | | |
- | =='''B<sup>4</sup>''' - 22 core parts for ''Bacillus subtilis''==
| |
| | | |
- | <p align="justify">A major goal of our iGEM project is to [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction introduce ''B. subtilis''] as a new chassis for BioBrick-based Synthetic Biology. For that purpose, we created a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry to make it accessible to many more future iGEM-Teams! This ''<b>Bacillus'' B</b>io<b>B</b>rick <b>B</b>ox ('''B<sup>4</sup>''') contains the following ''Bacillus'' specific parts:</p> | + | |
| + | =='''B<sup>4</sup>''' - 22 core parts for ''Bacillus subtilis''== |
| + | <br> |
| + | <p align="justify">A major goal of our iGEM project is to [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction introduce ''B. subtilis''] as a new chassis for BioBrick-based synthetic biology. For that purpose, we created a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry to make it accessible to many more future iGEM-teams and the entire public microbiology domain! This ''<b>Bacillus'' B</b>io<b>B</b>rick <b>B</b>ox ('''B<sup>4</sup>''') contains the following ''Bacillus'' specific parts:</p> |
| | | |
| | | |
Line 14: |
Line 16: |
| {| width="100%" | | {| width="100%" |
| | | |
- | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]''' | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Vectors|Vectors]]''' |
- | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Promoters|Promoters]]''' | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Promoters|Promoters]]''' |
- | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Reporters|Reporters]]''' | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Reporters|Reporters]]''' |
- | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Affinity_Tags|Affinity tags]] | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Tags|Affinity tags]] |
| |- | | |- |
| |[[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]] | | |[[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]] |
Line 51: |
Line 53: |
| </div> | | </div> |
| | | |
- | <p align="justify">Since ''Bacillus subtilis'' is not an organism commonly used in iGEM, please check out our [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction Introduction].</p> | + | |
| + | |
| + | [[File:NEXT.png|right|80px|link=Team:LMU-Munich/Germination_Stop]] [[File:BACK.png|left|80px|link=Team:LMU-Munich/Data/differentiation_tour]] |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | |
| + | <p align="justify">Since ''Bacillus subtilis'' is not an organism commonly used in iGEM, please check out our [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction Introduction] to learn more about it.</p> |
| | | |
| <div class="box"> | | <div class="box"> |
| ==''Bacillus'' Vectors [[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]== | | ==''Bacillus'' Vectors [[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]== |
| {| "width=100%" style="text-align:center;" style="align:right"| | | {| "width=100%" style="text-align:center;" style="align:right"| |
- | |<p align="justify">We have generated a suit of BioBrick-compatible vectors: three empty insertional backbones with different antibiotic resistances and integration loci, two reporter and two expression vectors. Here is a list of all the vectors we cloned and used.</p> | + | |<p align="justify">We have generated a suite of BioBrick-compatible vectors: three empty insertional backbones with different antibiotic resistances and integration loci, two reporter and two expression vectors.</p> |
| |[[File:LMU-Munich-PSBBs1C.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Vectors]] | | |[[File:LMU-Munich-PSBBs1C.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Vectors]] |
| |- | | |- |
Line 67: |
Line 81: |
| {| "width=100%" style="align:right"| | | {| "width=100%" style="align:right"| |
| | | | | |
- | <p align="justify">To provide a set of promoters of different strength we characterized several promoters in ''Bacillus subtilis''. They can be divided in three different groups:</p> | + | <p align="justify">To provide a set of promoters of different strength we characterized several promoters in ''Bacillus subtilis''. Both constitutive and inducible promoters are covered.</p> |
- | *the constitutive promoters from the Anderson collection from the Partsregistry
| + | |
- | *the constitutive promoters P<sub>''liaG''</sub>, P<sub>''veg''</sub> and P<sub>''lepA''</sub> from ''B. subtilis''
| + | |
- | *the inducible promoters P<sub>''liaI''</sub> and ''xylR''-P<sub>''xyl''</sub> from ''B. subtilis''
| + | |
| | | | | |
| [[File:Promoters overview.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Promoters]] | | [[File:Promoters overview.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Promoters]] |
Line 78: |
Line 89: |
| </div> | | </div> |
| | | |
- | | + | <div class="box"> |
| ==''Bacillus'' Reporters [[File:LMU Reporter.png|50px]]== | | ==''Bacillus'' Reporters [[File:LMU Reporter.png|50px]]== |
- | | + | {| "width=100%" style="align:right"| |
- | <p align="justify"> | + | | |
- | We designed and codon-optimized a set of reporters that are commonly used in ''B. subtilis''. All reporters have a modified iGEM Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RFC 25]) pre- and suffix for assembly of in-frame fusion proteins. Our prefix also includes the ''B. subitlis'' optimized ribosome binding site. </p> | + | <p align="justify">We designed and codon-optimized a set of reporters that are commonly used in ''B. subtilis''.</p> |
- | | + | | |
- | Find out more about the design of our [https://static.igem.org/mediawiki/2012/b/b9/LMU-Munich_2012_Our_Freiburg_standard_FusionPrefix.pdf prefix with ribosome binding site].
| + | [[File:LMU GFP.jpg|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Reporters]] |
- | | + | |
- | prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
| + | |
- | | + | |
- | suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
| + | |
- | | + | |
- | | + | |
- | *'''GFP''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823039 BioBrick:BBa_K823039])
| + | |
- | | + | |
- | | + | |
- | {| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;"
| + | |
- | | style="width: 70%;background-color: #EBFCE4;" | | + | |
- | {|
| + | |
- | |[[File:WT-B53 fluorescence.png|300px|center]]
| + | |
| |- | | |- |
- | | style="width: 70%;background-color: #EBFCE4;" |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Reporters]] |
- | {| style="color:black;" cellpadding="0" width="90%" cellspacing="0" border="0" align="center" style="text-align:center;"
| + | |
- | |style="width: 70%;background-color: #EBFCE4;" | | + | |
- | <font color="#000000"; size="2"><p align="justify">Fig. 5: Fluorescence of wild type spores and B53-'''Sporo'''beads (containing the P<sub>''cotYZ''</sub>-''cotZ''-''gfp''-terminator construct)</p></font>
| + | |
| |} | | |} |
- | |}
| + | </div> |
- | |}
| + | |
- | <p align="justify">We took a ''gfp'' derivate of the ''Bacillus subtilis'' plasmid pGFPamy and added the BioBrick compatible pre- and suffix of the Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RFC 25]). The functionality of this BioBrick verified by creat e.g. our [https://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins '''Sporo'''beads].</p> | + | |
| | | |
- | | + | <div class="box"> |
- | *'''mKate2''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029])
| + | ==Affinity Tags [[File:Proteinaffinitytagbutton.png|50px]]== |
- | | + | {| "width=100%" style="align:right"| |
- | | + | | |
- | {| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;" | + | <p align="justify">We synthesized 5 affinity tags for protein purification. They all are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags.</p> |
- | | style="width: 70%;background-color: #EBFCE4;" | | + | |
- | {|
| + | |
- | |[[File:MKate Pellet_ii.JPG|400px|center]]
| + | |
| |- | | |- |
- | | style="width: 70%;background-color: #EBFCE4;" |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Tags]] |
- | {| style="color:black;" cellpadding="0" width="95%" cellspacing="0" border="0" align="center" style="text-align:center;"
| + | |
- | |style="width: 70%;background-color: #EBFCE4;" | | + | |
- | <font color="#000000"; size="2"><p align="justify">'''''mKate2'' fused to the terminator B0014 under the control of the Anderson promoter J23101 (up), P<sub>''liaI''</sub> (middle) and P<sub>''lepA''</sub> (down) in pSB<sub>''Bs''</sub>1C.''' Pellets are ''Escherichia coli'' cells which contain the plasmid with the insert labelled to the right.</p></font>
| + | |
- | |}
| + | |
- | |}
| + | |
| |} | | |} |
| + | </div> |
| + | <br> |
| + | <br> |
| + | <br> |
| <br> | | <br> |
- |
| |
- | <p align="justify">We codon-optimized the sequence of this monomeric far-red fluorescence protein for the use in ''B. subtilis'' and synthesized it (by [http://de-de.invitrogen.com/site/de/de/home/Products-and-Services/Applications/Cloning/gene-synthesis.html GeneArt]) with pre- and suffix of the Freiburg standard. We cloned this reporter in front of the terminator B0014. For the evaluation, this reporter was successfully combined with the promoters P<sub>''liaI''</sub>, P<sub>''lepA''</sub> and the Anderson promoter J23101 in the empty ''Bacillus'' vector pSB<sub>''Bs''</sub>1C from our '''''Bacillus''B'''io'''B'''rick'''B'''ox. At the moment we already have the right construct integrated into the chromosome of ''B. subtilis''. Unfortunately, we have not yet measured this reporter.</p>
| |
- |
| |
- | Reference: [http://www.evrogen.com/products/mKate2/mKate2.shtml mkate2]
| |
- |
| |
- |
| |
- | *'''LacZ''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823019 BioBrick:BBa_K823019])
| |
- |
| |
- |
| |
- | {| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;"
| |
- | | style="width: 70%;background-color: #EBFCE4;" |
| |
- | {|
| |
- | |[[File:LacZ plate.png|center|400px]]
| |
- | |-
| |
- | | style="width: 70%;background-color: #EBFCE4;" |
| |
- | {| style="color:black;" cellpadding="0" width="95%" cellspacing="0" border="0" align="center" style="text-align:center;"
| |
- | |style="width: 70%;background-color: #EBFCE4;" |
| |
- | <font color="#000000"; size="2"><p align="justify">''lacZ'' fused to the terminator B0014 under the control of P<sub>''spac''</sub> in the expression vector pSB<sub>Bs</sub>0K-P<sub>''spac''</sub>. P<sub>''spac''</sub> induced with IPTG</p></font>
| |
- | |}
| |
- | |}
| |
- | |}
| |
- |
| |
- |
| |
- | <p align="justify">This evaluated ''lacZ'' gene is derived from the ''Bacillus'' reporter vector pAC6. It is constructed in the Freiburg Standard ([http://partsregistry.org/Help:Assembly_standard_25 RFC 25]) for in-frame fusion proteins. It also includes a ribosome binding site optimized for ''Bacillus subtilis'' translation. This ''lacZ'' BioBrick was tested in the expression vector pSB<sub>''Bs''</sub>0K-P<sub>''spac''</sub>. This construct gave output, so the reporter gene is functional qualitatively. See [https://2012.igem.org/Team:LMU-Munich/Data/Vectors Data] in the vector evaluation section of pSB<sub>''Bs''</sub>0K-P<sub>''spac''</sub>. A more qualitatively measurement will follow soon.</p>
| |
- |
| |
- | Reference for the vector: [http://www.ncbi.nlm.nih.gov/pubmed/11902727 pAC6]
| |
- |
| |
- |
| |
- |
| |
- | *'''luc''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823028 BioBrick:BBa_K823028])
| |
- | <p align="justify">
| |
- | The <i>luc</i> gene encodes the monomeric firefly luciferase, which requires a special substrate to produce luminescence. We codon-optimized it for <i>Bacillus subtilis</i>, added a ribosome binding site and synthesized by [http://de-de.invitrogen.com/site/de/de/home/Products-and-Services/Applications/Cloning/gene-synthesis.html GeneArt].
| |
- | </p>
| |
- | <p align="justify">
| |
- | Firefly luciferase is by far the most commonly used bioluminescent reporter. This monomeric enzyme of 61kDa catalyzes a two-step oxidation reaction to yield light, usually in the green to yellow region, typically 550–570nm . The first step is activation of the luciferyl carboxylate by ATP to yield a reactive mixed anhydride. In the second step, this activated intermediate reacts with oxygen to create a transient dioxetane that breaks down to the oxidized products, oxyluciferin and CO<sub>2</sub>. Upon mixing with substrates, firefly luciferase produces an initial burst of light that decays over about 15 seconds to a low level of sustained luminescence. This kinetic profile reflects the slow release of the enzymatic product, thus limiting catalytic turnover after the initial reaction.
| |
- | </p>
| |
- | <p align="justify">
| |
- | The popularity of native firefly luciferase as a genetic reporter is due to the sensitivity and convenience of the enzyme assay and tight coupling of protein synthesis with enzyme activity. Firefly luciferase, which is encoded by the ''luc'' gene, is a monomer that does not require any post-translational modifications; it is available as a mature enzyme directly upon translation of its mRNA. Catalytic competence is attained immediately after release from the ribosome. Also, luciferase has a very short half-life in cells (approximately 3 hours). Combined, these properties make luciferase an extremely responsive reporter, far more so than other commonly used reporters.
| |
- | </p>
| |
- |
| |
- | {| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;"
| |
- | | style="width: 70%;background-color: #EBFCE4;" |
| |
- | {|
| |
- | |[[File:Luciferin reaction mod.png|center|400px]]
| |
- | |-
| |
- | | style="width: 70%;background-color: #EBFCE4;" |
| |
- | {| style="color:black;" cellpadding="0" width="95%" cellspacing="0" border="0" align="center" style="text-align:center;"
| |
- | |style="width: 70%;background-color: #EBFCE4;" |
| |
- | <font color="#000000"; size="2">Reference:[http://www.promega.com/resources/product-guides-and-selectors/protocols-and-applications-guide/bioluminescent-reporters/ Promega]</font>
| |
- | |}
| |
- | |}
| |
- | |}
| |
- |
| |
- | <p align="justify">It was used in <i>B. subtilis</i> before ([http://www.ncbi.nlm.nih.gov/pubmed/21552330 Mirouze et al. 2011]).
| |
- | The non-optimized version of this reporter gene was already successfully used in B. subtilis. While we have not found the time to evaluate this BioBrick we expect that it will work at least as good.</p>
| |
- |
| |
- |
| |
- | ==Affinity Tags [[File:Proteinaffinitytagbutton.png|50px]]==
| |
- |
| |
- |
| |
- | <p align="justify">
| |
- | All our tags have been synthesized by [http://de-de.invitrogen.com/site/de/de/home/Products-and-Services/Applications/Cloning/gene-synthesis.html GeneArt]. They are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags. </p>
| |
- |
| |
- | Find out more about the design of our [https://static.igem.org/mediawiki/2012/b/b9/LMU-Munich_2012_Our_Freiburg_standard_FusionPrefix.pdf prefix with ribosome binding site].
| |
- |
| |
- | prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
| |
- |
| |
- | suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
| |
- |
| |
- |
| |
- | *'''3x Flag-tag''' [http://partsregistry.org/Part:BBa_K823034 (BioBrick:BBa_K823034)]
| |
- |
| |
- | <p align="justify">
| |
- | The Flag-tag was the first epitope tag to be published ([http://www.nature.com/nbt/journal/v6/n10/full/nbt1088-1204.html Hopp, Prickett et al. (1988)]). It consists of eight hydrophobic amino acids: DYKDDDDK. To enhence senstitivity in Western blots, it is routinely used as a 3x Flag tag in ''B. subtilis'' [http://www.ncbi.nlm.nih.gov/pubmed?term=wiegert%20flag (Kaltwasser ''et al.'', 2002)]. Its sequence is: <b>DYKDHDGDYKDHDIDYKDDDDK</b>. There are a variety of monoclonal antibodies against this tag, N-terminal as well as position insensitive.</p>
| |
- |
| |
- |
| |
- | *'''HA - tag''' [http://partsregistry.org/Part:BBa_K823035 (BioBrick:BBa_K823035)]
| |
- |
| |
- | <p align="justify">
| |
- | The HA-tag is an epitope derived from the HA-virus. There was first an antibody against it and then the epitope was characterized ([http://www.ncbi.nlm.nih.gov/pubmed/6204768 Wilson, I.A. et al. (1984)]). It was then furthermore used as a tag for protein purification and recognition ([http://www.ncbi.nlm.nih.gov/pubmed/2455217 Field et al. (1988)]). The amino acid sequence is: <b>YPYDVPDYA</b>.</p>
| |
- |
| |
- |
| |
- | *'''cMyc - tag''' [http://partsregistry.org/Part:BBa_K823036 (BioBrick:BBa_K823036)]
| |
- |
| |
- | <p align="justify">
| |
- | The cMyc-tag is derived from the cMyc gene product. Antibodies were generated from the immunization with synthetic peptides from the cMyc sequence ([http://mcb.asm.org/content/5/12/3610.short Evan, Bishop et al.(1985)]). The amino acid sequence is <b>EQKLISEEDL</b>.</p>
| |
- |
| |
- |
| |
- | *'''His - tag''' [http://partsregistry.org/Part:BBa_K823037 (BioBrick:BBa_K823037)]
| |
- |
| |
- | <p align="justify">
| |
- | The His-tag is a metal chelating peptide ([http://www.nature.com/nbt/journal/v6/n11/full/nbt1188-1321.html Hochul,Stüber et al. (1988)]) consisting of at least 6 histidin residues. It can be used for protein purification by metal<sup>2+</sup>ion-containing columns (nickel). There are also antibodies against this tag, or nickel/cobalt containing fluorescent probes can be used for detection. Moreover, an immobilization is possible in nickel/cobalt coated plastikware.
| |
- | The aminoacid sequence is:<b>HHHHHHHHHH</b></p>
| |
- |
| |
- |
| |
- | *'''Strep - tag''' [http://partsregistry.org/Part:BBa_K823038 (BioBrick:BBa_K823038)]
| |
- |
| |
- | <p align="justify">
| |
- | The Strep-tag is a mimicry peptide of biotin which binds to Streptavidin ([http://www.sciencedirect.com/science/article/pii/S1050386299000339 Skerra, Schmidt (1999)]). Its sequence is <b>WSHPQFEK</b>. It can be used for protein purification, immobilization with streptavidin or strep-tactin ([http://www.ncbi.nlm.nih.gov/pubmed/9415448 Voss, Skerra (1997)]) or detection with Strep-tactin or antibodies.</p>
| |
- |
| |
- |
| |
- |
| |
- | [[File:NEXT.png|right|80px|link=Team:LMU-Munich/Spore_Coat_Proteins]]
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
| <div class="box"> | | <div class="box"> |
| ====Project Navigation==== | | ====Project Navigation==== |