Team:WHU-China/Project

From 2012.igem.org

(Difference between revisions)
 
(74 intermediate revisions not shown)
Line 11: Line 11:
}
}
//*************************自定义数据部分*************************
//*************************自定义数据部分*************************
-
//定义菜单及侧边栏数据
+
//定义菜单及侧边栏数据
-
var menuObj = {
+
var menuObj = {
-
Home: [{
+
Home : [
-
title: "<strong>What's New</strong>",
+
-
picArray: [new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"), new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5"), new picObj("http://imgsrc.baidu.com/forum/pic/item/d25e8bd4b31c87011d9cdb7c277f9e2f0708ff34.jpg", "one piece", "yi zhang haizeiwang de tu", "http://tieba.baidu.com/f?kw=%BA%A3%D4%F4%CD%F5")]
+
-
},
+
{
{
-
title: "<strong>Pathway Introduction</strong>",
+
title : "<strong>What's New</strong>",
-
picArray: [new picObj("2.png", "title 2", "pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1pathway introduction 1production 1", "#"), new picObj("2.png", "title 2", "pathway introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2 introduction 2", "#"), new picObj("2.png", "title 2", "pathway introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3way introduction 3", "#")]
+
picArray : [
 +
new picObj("https://static.igem.org/mediawiki/2012/e/e3/What%27s_new_first.png","Overall Project", "Compared with traditional methods of losing weight, our probiotic-- E.coslim has three advantages: monitoring, high efficiency and long term efficiency.", "https://2012.igem.org/Team:WHU-China/Project?catalog=0"),
 +
new picObj("https://static.igem.org/mediawiki/2012/f/ff/Promoter_design.png", "Monitoring", "With two novel synthetic promoters, Pcar and PfadR, our E.coslim is able to sense and respond to the high calorie molecules.", "https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar"),
 +
new picObj("http://partsregistry.org/wiki/images/f/ff/%E5%85%A8%E6%99%AF%E5%8A%A0%E6%AD%BB%E4%BA%A11.png", "Becoming highly efficient-- Panorama of the All Devices", "Four novel devices-- Fatty Acid Degradation, Cellulose Synthesis, Colonization and Death were designed to ensure high efficiency respond to high- calorie molecule, making people slim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),
 +
          new picObj("https://static.igem.org/mediawiki/2012/0/09/%E8%83%96%E5%AD%90%E7%98%A6%E5%AD%90.png", "Long term efficiency of the E.coslim", "By mathematical model, we showed that when viewed at a macroscopic level, the E. coslim may achieve long term efficiency by modulating the composition of gut microbiota.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=2")
 +
 +
]
},
},
{
{
-
title: "<strong>Future Perspective</strong>",
+
title : "<strong>Pathway Introduction</strong>",
-
picArray: [new picObj("3.png", "title 3", "future prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1uture prospective 1utureive 1", "#"), new picObj("3.png", "title 3", "future prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospective 2e prospecpective 2", "#"), new picObj("3.png", "title 3", "future prospective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3pective 3", "#")]
+
picArray : [
 +
new picObj("https://static.igem.org/mediawiki/igem.org/8/82/Pathway_FattyAcid.png", "Fatty Acid Degradation", "Feel free to eat meat since the fat is all degraded by our E.coslim!", "https://2012.igem.org/Team:WHU-China/Project?catalog=3"),
 +
new picObj("https://static.igem.org/mediawiki/igem.org/1/18/Pathway_Cellulose.png", "Cellulose Synthesis", "Transforming glucose into cellulose, the high-sugar food you eat will be turned into vegetables!", "https://2012.igem.org/Team:WHU-China/Project?catalog=4"),
 +
new picObj("https://static.igem.org/mediawiki/2012/e/ea/Device_three.png", "Colonization", "The magic molecule c-di-GMP enables E.coslim colonizing in the gut to better fulfill its magic function!", "https://2012.igem.org/Team:WHU-China/Project?catalog=5")
 +
]
},
},
 +
{
{
-
title: "<strong>About Us</strong>",
+
title : "<strong>Future Perspective</strong>",
-
picArray: [new picObj("4.png", "title 4", "about us 1", "#"), new picObj("4.png", "title 4", "about us 2", "#"), new picObj("4.png", "title 4", "about us 3", "#")]
+
picArray : [
-
}],
+
new picObj("https://static.igem.org/mediawiki/2012/a/ab/%E5%8F%8C%E8%83%B6%E5%9B%8A2.jpg", "Two Capsule Design", "Capsule I, the E.coslim, makes you slim, while Capsule II, xylose, terminates the effects of the former.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),
-
Team: [{
+
new picObj("https://static.igem.org/mediawiki/2012/d/d2/Fpbody2.jpg", "In vitro experiment in a simulated intestine", "The gut microbiota and E.coslim will be inoculated in a simulated intestine, then the concentration measurement of each component will tell us whether E.coslim works as desired.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0"),
-
title: '<strong>Members</strong>',
+
new picObj("https://static.igem.org/mediawiki/2012/8/85/%E5%B0%8F%E9%BC%A0%E5%AE%9E%E9%AA%8C02.jpg", "In vivo experiment in mice", "E.coslim will also be inoculated into mice and the culture-independent microbiome analysis will tell us the real situation in vivo.", "https://2012.igem.org/Team:WHU-China/Modeling?catalog=0")
-
dir: [{
+
]
-
title: 'aaaa',
+
},
-
href: '#aaaa'
+
 
-
}]
+
 
 +
 
 +
{
 +
title : "<strong>Achievements</strong>",
 +
picArray : [
 +
new picObj("https://static.igem.org/mediawiki/2012/d/d1/Achievements_device_xia.png", "Devices", "This year, our project has focused on some of the hotspot issues, such as c-di-CMP, gut microbiota. In all we submitted 66 new biobricks and 39 of them have been proved to be effective.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),
 +
 
 +
new picObj("https://static.igem.org/mediawiki/2012/c/ca/Achievements_1.png", "Biobicks we have improved", "In our project, we have improved the function of some biobricks,such as BBa_J54222, BBa_K188011 and BBa_R0051. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),
 +
 
 +
new picObj("https://static.igem.org/mediawiki/2012/f/f5/Achievements_2.png", "Novel promoter we designed", "As the existing promoter can not meet our demand, we designed two novel promoters Pcar and Pfad to achieve the goal. In addition, we also have set up a standard for promoter design.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),
 +
 
 +
new picObj("https://static.igem.org/mediawiki/2012/2/27/Methods_we_improve.png", "Methods we improved", "In our project,we improved some traditional methods to measure the comsumption of fatty acids and production of cellulose, and also we developed a software named FANCY to detect the fluorescence intensity of single cell. ", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),
 +
 
 +
new picObj("https://static.igem.org/mediawiki/2012/7/79/Human_practice_xia.png", "Human Practice", "We have helped HUST iGEM team debug their project and mathematical model. We also did a survey on GMOs and publicized iGEM to the public.", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=0"),
 +
 +
]
},
},
{
{
-
title: '<strong>Instructors</strong>',
+
title : "<strong>About Us</strong>",
-
dir: [{
+
picArray : [
-
title: 'bbbb',
+
new picObj("https://static.igem.org/mediawiki/2012/a/a7/Whu-2012-1.jpg", "WHU-China 2012, I was there", "The Entrance of State Wuhan University", "https://2012.igem.org/Team:WHU-China/Team?catalog=1"),
-
href: '#bbbb'
+
new picObj("https://static.igem.org/mediawiki/2012/2/23/Whu2012heying.jpg", "MIT, we're coming!", "Collge of Life Sciences of WHU", "https://2012.igem.org/Team:WHU-China/Team?catalog=4"),
-
}]
+
new picObj("https://static.igem.org/mediawiki/2012/4/43/Whu2012-2.jpg", "WHU-China, Hooray!", "Yuntai Mountain, Henan Province", "https://2012.igem.org/Team:WHU-China/Notebooks?catalog=5")
 +
]
 +
}
 +
],
 +
Team : [
 +
{
 +
title : '<strong>Team Introduction</strong>',
 +
dir : []
 +
},
 +
                {
 +
title : '<strong>Members</strong>',
 +
dir : [
 +
{
 +
title : 'Jiawei Huang',
 +
href : '#Jiawei Huang'
 +
},
 +
{
 +
title : 'Kuanwei Sheng',
 +
href : '#Kuanwei Sheng'
 +
},
 +
{
 +
title : 'Xian Xia',
 +
href : '#Xian Xia'
 +
},
 +
{
 +
title : 'Long Mei',
 +
href : '#Long Mei'
 +
},
 +
{
 +
title : 'Fan Cheng',
 +
href : '#Fan Cheng'
 +
},
 +
{
 +
title : 'Wenxiong Zhou',
 +
href : '#Wenxiong Zhou'
 +
},
 +
{
 +
title : 'Boxiang Wang',
 +
href : '#Boxiang Wang'
 +
},
 +
{
 +
title : 'Tong Wang',
 +
href : '#Tong Wang'
 +
},
 +
{
 +
title : 'Jiani Hu',
 +
href : '#Jiani Hu'
 +
},
 +
{
 +
title : 'Shiwei Gao',
 +
href : '#Shiwei Gao'
 +
},
 +
{
 +
title : 'Jing Zhang',
 +
href : '#Jing Zhang'
 +
},
 +
                        {
 +
title : 'Yuan Feng',
 +
href : '#Yuan Feng'
 +
},
 +
 
 +
{
 +
title : 'Pengcheng Zhou',
 +
href : '#PengchengZhou'
 +
},
 +
{
 +
title : 'Chang Liu',
 +
href : '#Chang Liu'
 +
},
 +
{
 +
title : 'Min Ye',
 +
href : '#Min Ye'
 +
},
 +
{
 +
title : 'Xuepeng Huang',
 +
href : '#Xuepeng Huang'
 +
},
 +
{
 +
title : 'Yancheng Liu',
 +
href : '#Yancheng Liu'
 +
},
 +
{
 +
title : 'Cheng Zhao',
 +
href : '#Cheng Zhao'
 +
},
 +
{
 +
title : 'Chao Huang',
 +
href : '#Chao Huang'
 +
},
 +
                        {
 +
title : 'Yutian Zhang',
 +
href : '#Yutian Zhang'
 +
},
 +
 
 +
{
 +
title : 'Wei Hong',
 +
href : '#Wei Hong'
 +
},
 +
{
 +
title : 'Liuyi Hu',
 +
href : '#Liuyi Hu'
 +
                                                },
 +
{
 +
title : 'Jin Liu',
 +
href : '#Jin Liu'
 +
}
 +
      ]
},
},
{
{
-
title: '<strong>Team History</strong>',
+
title : '<strong>Instructors</strong>',
-
dir: []
+
dir : [
 +
{
 +
title : 'Jianbo Wang',
 +
href : '#Jianbo Wang'
 +
},
 +
                                                {
 +
                                                        title : 'Zhixiong Xie',
 +
                                                        href : '#Zhixiong Xie'
 +
                                                },
 +
                                                {
 +
                                                        title : 'Yu Chen',
 +
                                                        href : '#Yu Chen'
 +
                                                }
 +
]
},
},
{
{
-
title: '<strong>About WHU</strong>',
+
title : '<strong>Team History</strong>',
-
dir: []
+
dir : []
},
},
{
{
-
title: '<strong>About Our Lab</strong>',
+
title : '<strong>About WHU</strong>',
-
dir: []
+
dir : []
},
},
{
{
-
title: '<strong>Acknol-</br>edgements</strong>',
+
title : '<strong>About Our Lab</strong>',
-
dir: []
+
dir : []
},
},
 +
{
 +
title : '<strong>Acknow-</br>ledgements & Attributions</strong>',
 +
dir : [
 +
    {
 +
title : 'Acknowledgements',
 +
href : '#Acknowledgements'
 +
},
 +
                        {
 +
                            title : 'Attributions',
 +
                            href : '#Attributions'
 +
                        },
 +
]
 +
}
-
],
+
],
Project: [{
Project: [{
title: '<strong>Description</strong>',
title: '<strong>Description</strong>',
Line 85: Line 240:
},
},
{
{
-
title: 'Pcar',
+
title: '<i>Pcar</i>',
href: '#Pcar'
href: '#Pcar'
},
},
{
{
-
title: 'PfadR',
+
title: '<i>PfadR</i>',
href: '#PfadR'
href: '#PfadR'
},
},
Line 124: Line 279:
{
{
title: '<strong>Device II: Cellulose Synthesis</strong>',
title: '<strong>Device II: Cellulose Synthesis</strong>',
-
dir: []
+
dir: [{
 +
    title: 'Outline',
 +
href: '#Outline1'
 +
},
 +
{
 +
    title: 'Design',
 +
href: '#Design1'
 +
},
 +
{
 +
    title: 'Progress',
 +
href: '#Progress1'
 +
},
 +
{
 +
    title: 'Results',
 +
href: '#Results1'
 +
},{
 +
    title: 'Discussion',
 +
href: '#Discussion1'
 +
},]
},
},
{
{
Line 149: Line 322:
{
{
title: '<strong>Device IV: Death</strong>',
title: '<strong>Device IV: Death</strong>',
-
dir: []
+
dir: [{
 +
    title: 'Outline',
 +
    href: '#Outline4'
 +
},
 +
{
 +
    title: 'Description',
 +
    href: '#Description'
 +
},
 +
 +
{
 +
    title: 'Prevention of HGT',
 +
    href: '#Prevention of HGT'
 +
}]
},
},
],
],
-
Modeling: [{
+
Modeling : [
-
title: '<strong>Future Perspectives</strong>',
+
{
-
dir: []
+
title : '<strong>Future Perspective</strong>',
 +
dir : []
},
},
{
{
-
title: '<strong>Model I: Fatty Acid Degradation</strong>',
+
title : '<strong>Model I: Fatty Acid Degradation</strong>',
-
dir: [{
+
dir : [
-
title: 'aaaa',
+
{
-
href: '#aaaa'
+
title : 'The Ordinary Differential Equations of the Model',
-
}]
+
href : '#The Ordinary Differential Equations of the Model'
 +
},
 +
{
 +
title : 'Analysis on the Steady State of the ODE',
 +
href : '#Analysis on the Steady State of the ODE'
 +
},
 +
{
 +
title : 'Parameter Screening',
 +
href : '#Parameter Screening'
 +
},
 +
{
 +
title : 'Conclusion',
 +
href : '#Conclusion'
 +
}
 +
]
},
},
{
{
-
title: '<strong>Model II: Microbiota Regulation</strong>',
+
title : '<strong>Model II: Microbiota Regulation</strong>',
-
dir: [{
+
dir : [
-
title: 'bbbb',
+
{
-
href: '#bbbb'
+
title : 'Gut Microbiota Regulation',
-
}]
+
href : '#Gut Microbiota Regulation'
 +
},
 +
{
 +
title : 'Situation Before the Establishment of <i>E. coslim</i> Flora',
 +
href : '#Situation Before the Establishment of <i>E. coslim</i> Flora'
 +
},
 +
{
 +
title : 'Situation After the Establishment of <i>E. coslim</i> Flora',
 +
href : '#Situation After the Establishment of <i>E. coslim</i> Flora'
 +
},
 +
{
 +
    title : 'Conclusion',
 +
href : '#Conclusion1'
 +
}
 +
]
 +
 
},
},
{
{
-
title: '<strong>Software Tool: FANCY</strong>',
+
title : '<strong>Software Tool: FANCY</strong>',
-
dir: []
+
dir : [
-
}],
+
{
-
Notebooks: [
+
title : 'Abstract',
 +
href : '#Abstract'
 +
},
 +
{
 +
title : 'Protocol',
 +
href : '#Protocol'
 +
},
 +
{
 +
title : 'Performance Evaluation',
 +
href : '#Performance Evaluation'
 +
},
 +
{
 +
title : 'Source Code',
 +
href : '#Source Code'
 +
}
 +
                                              ]
 +
}
 +
],
 +
Notebooks : [
 +
                {
 +
title : '<strong>Achievements</strong>',
 +
dir : []
 +
},
{
{
title : '<strong>Parts</strong>',
title : '<strong>Parts</strong>',
dir : []
dir : []
-
},
 
-
                                {
 
-
title: '<strong>Safety</strong>',
 
-
dir: [{
 
-
title: 'aaaa',
 
-
href: '#aaaa'
 
-
}]
 
},
},
{
{
-
title: '<strong>Protocols</strong>',
+
title : '<strong>Safety</strong>',
-
dir: [{
+
dir : [
-
title: 'bbbb',
+
{
-
href: '#bbbb'
+
title : 'Brief Answers to Safety Questions',
-
}]
+
href : '#Brief Answers to Safety Questions'
 +
},
 +
{
 +
    title : 'General Safety Issues',
 +
href : '#General Safety Issues'
 +
},
 +
{
 +
    title : 'Safety Considerations of Our Biobrick parts and Our Project',
 +
href : '#Safety Considerations of Our Biobrick parts and Our Project'
 +
},
 +
{
 +
    title : 'Safety Management and Practice',
 +
href : '#Safety Management and Practice'
 +
},
 +
{
 +
    title : 'Biosafety and Publicity',
 +
href : '#Biosafety and Publicity'
 +
}
 +
]
},
},
{
{
-
title: '<strong>Events</strong>',
+
title : '<strong>Protocols</strong>',
-
dir: []
+
dir : [
 +
{
 +
title : 'Protocol for Fluorescence Measurement',
 +
href : '#Protocol for fluorescence measurement'
 +
},
 +
{
 +
title : 'Protocol of Cupric-Soap Reaction',
 +
href : '#Protocols of Cupric-Soap Reaction'
 +
},
 +
{
 +
title : 'Krebs-Ringer Phosphate(KRPD Buffer Solution)',
 +
href : '#Krebs-Ringer Phosphate(KRPD Buffer Solution)'
 +
},
 +
                        {
 +
title : 'Cellulose Detection',
 +
href : '#Cellulose Detection'
 +
},
 +
 +
{
 +
title : '<i>In vitro</i> Experiment',
 +
href : '#In vitro Experiment'
 +
},
 +
                        {
 +
title : 'Plate Assay',
 +
href : '#Plate Assay'
 +
},
 +
{
 +
title : 'Materials and Methods of SDS-PAGE',
 +
href : '#Materials and Methods of SDS-PAGE'
 +
}
 +
]
},
},
{
{
-
title: '<strong>Brain-</br>storming</strong>',
+
title : '<strong>Events</strong>',
-
dir: []
+
dir : []
},
},
 +
                                {
 +
                                        title : '<strong>Brainstorming</strong>',
 +
                                        dir : []
 +
                                },
{
{
-
title: '<strong>Gallery</strong>',
+
title : '<strong>Gallery</strong>',
-
dir: []
+
dir : [
-
}],
+
    {
-
HumanPractice: [{
+
title : 'Team',
-
title: '<strong>Outline</strong>',
+
href : '#team'
-
dir: [{
+
},
-
title: 'aaaa',
+
{
-
href: '#aaaa'
+
title : 'Presentation',
-
}]
+
href : '#presentation'
 +
},
 +
{
 +
title : 'Human Practice',
 +
href : '#human practice'
 +
},
 +
{
 +
title : 'Doodle',
 +
href : '#doodle'
 +
},
 +
{
 +
title : 'Funny Pictures',
 +
href : '#funny pictures'
 +
}]},
 +
                {
 +
title : '<strong>A Letter from Fancy</strong>',
 +
dir : []
 +
 +
 +
}
 +
],
 +
HumanPractice : [
 +
{
 +
title : '<strong>Outline</strong>',
 +
                                    dir : []
 +
},
},
{
{
-
title: '<strong>Questionaire Survey</strong>',
+
title : '<strong>Questionaire Survey</strong>',
-
dir: [{
+
    dir : [{
-
title: 'bbbb',
+
title : 'Background',
-
href: '#bbbb'
+
href : '#Background'
-
}]
+
},{
 +
title : 'Methods',
 +
href : '#Methods'
 +
},{
 +
title : 'Results',
 +
href : '#Results'
 +
},{
 +
title : 'Discussion',
 +
href : '#Discussion'
 +
}]
},
},
{
{
-
title: '<strong>Publicity</strong>',
+
title : '<strong>Publicity</strong>',
-
dir: []
+
    dir : []
-
}]
+
}
-
};
+
] };
//*************************自定义数据部分*************************
//*************************自定义数据部分*************************
Line 366: Line 682:
<p><i> The above figure is the overview of our design</i></p>
<p><i> The above figure is the overview of our design</i></p>
<p align="justify">
<p align="justify">
-
The utmost purpose of our project is to emancipate people from obesity.
+
Utilizing human microbiota to tackle diseases has long been the keen desire of scientists. This year, we WHU-China team engineered a kind of probiotics "<i>E. coslim</i>" from <i>Escherichia coli</i>, hoping to provide a new approach for treating obesity. Specifically, three genetic devices were designed to help people lose weight. The first two devices were assembled to metabolize the excessive energy in human intesinte. To achieve this goal, promoters activated by high concentration of glucose and fatty acids were devised and synthesized respectively. When functional genes were placed downstream of these promoters appropriately, the first two devices were supposed to degrade fatty acids and convert glucose into cellulose respectively, thus preventing excessive calorie intake as well as producing prebiotics. Meanwhile, the third device was designed to regulate human gut microbiota. Also, xylose inducing death device was planned to terminate the effects of "<i>E.coslim</i>" at will to prevent horizontal gene transfer and control the density of "<i>E. coslim</i>" in future applications. As a whole, we are developing "<i>E. coslim</i>" to metabolize the excessive energy and regulate the microbiome composition in intestine to control obesity.
-
It can be achieved by genetically modifying a resident intestinal microbe,
+
-
such as E.coli, to create a novel beneficial bacterial which is competent
+
-
to eliminate the excessive absorption of calorie.
+
-
</p>
+
-
<p align="justify">
+
-
Fatty acids are our primary targets. To prevent the over in-take and accumulation
+
-
of fatty acids, we will try to engineer microbes that can metabolize the
+
-
excessive fatty acids in diet efficiently and effectively before they are
+
-
absorbed by the host. To achieve this, we will overexpress the enzymes
+
-
responsible for fatty acid degradation under the control of a natural
+
-
sensor for concentration of fatty acids-- FadR, a repressor for the genes
+
-
involved in fatty acid degradation. A constitutive promoter will be fused
+
-
to the original binding site of FadR. If such a promoter is placed upstream
+
-
of the target genes, they can only express when the FadR senses the high
+
-
concentration of fatty acids and slides off the site on DNA. The gene expression
+
-
will solely respond to concentration of fatty acids.
+
-
</p>
+
-
<p align="justify">
+
-
Also, since the glucose can be transformed into fatty acids in our body,
+
-
we will try to transform the glucose into polymers, such as cellulose,
+
-
which cannot further be degraded and absorbed by the host. Instead of contributing
+
-
to the formation of fatty acids, the glucose is turned into a healthier
+
-
substance. The polymers made from the glucose may facilitate the growth
+
-
of other intestinal microbes which have been proved to be beneficial for
+
-
maintaining a normal weight. Enzymes responsible for cellulose synthesis
+
-
are accessible from other species of bacteria and can be implanted into
+
-
E.coli. To sense the glucose concentration and respond exclusively to it,
+
-
we choose CRP as a regulator. Specifically, we will change this activator
+
-
into a repressor by overlapping its binding site downstream the constitutive
+
-
promoter instead of in front of it. Then the relative gene can only be
+
-
activated when the CRP cannot bind the site on DNA at high glucose concentration.
+
-
This synthetic promoter may have broad applications. For example, it can
+
-
be used in gene therapy for diabetes.
+
-
</p>
+
-
<p align="justify">
+
-
Another problem we will try to tackle is the survival and the colonization
+
-
of the bacteria in intestine. It is commonly accepted that a species
+
-
introduced to a new enviornment gets the chance of surviving and even being
+
-
dominant if it can utilize an energy resource that cannot be used by any
+
-
other species. According to the theory, the unmatchable ability of the
+
-
E.coli to utilize the fatty acids as its carbon sources can already partially
+
-
fulfill the goal. The adhesion to intestinal cells is another factor for
+
-
its survival other than the energy requirement. We will try to increase
+
-
the adhesion ability of the E.coli by enhancing its production of c-di-GMP,
+
-
a second massager which has been reported to increase adhesion of bacteria.
+
-
</p>
+
-
<p align="justify">
+
-
Biological safety should be paid equal attention in the progress of designing
+
-
novel probiotic. To prevent the uncontrolled reproduction of the modified
+
-
E.coli in the intestine, we have designed a death system to wipe out the
+
-
GMOs at will. It is designed to exploit the natural sensor for the signal
+
-
molecule xylose to regulate its target, the endonuclease responsible for
+
-
killing the cell quietly without setting off any immunological reaction.
+
-
Also, Horizontal gene transfer will also trigger the death of the recipient.
+
-
</p>
+
-
<p align="justify">
+
-
To sum up, we not only propose a novel and interesting way to tackle the
+
-
obese problems but also create the biological sensors for fatty acids and
+
-
glucose which have broad applications in detection and therapy of related
+
-
diseases.
+
</p>
</p>
</div>
</div>
<div class="passage divcell1">
<div class="passage divcell1">
<p>
<p>
-
  <h4>
+
  <h3>
-
Obesity: a serve global problem
+
Obesity: a severe global problem
-
  </h4>
+
  </h3>
<p align="justify">
<p align="justify">
Obesity refers to a health condition that body fat is accumulated to some
Obesity refers to a health condition that body fat is accumulated to some
Line 448: Line 704:
<p align="justify">
<p align="justify">
As it is shown in figure 1 and 2, a large amount of people from all over
As it is shown in figure 1 and 2, a large amount of people from all over
-
the world are overweight in both developed countries and developing contries
+
the world are overweight in both developed and developing countries
-
and it is and will become more and more serve.
+
and it is and will become more and more severe.
</p>
</p>
<br />
<br />
Line 475: Line 731:
  </h4>
  </h4>
<p align="justify">
<p align="justify">
-
Obesity is most commonly caused by a combination of excessive food energy
+
Obesity is most commonly caused by a combination of different factors such as excessive food energy
intake, lack of physical activity, and genetic susceptibility, although
intake, lack of physical activity, and genetic susceptibility, although
a few cases are caused primarily by genes, endocrine disorders, medications
a few cases are caused primarily by genes, endocrine disorders, medications
Line 486: Line 742:
For most individuals, controlling food intake and doing physical activity
For most individuals, controlling food intake and doing physical activity
in a proper way are effective strategies to lose weight. But for some people
in a proper way are effective strategies to lose weight. But for some people
-
whose health condition or current life pace keeps them away from systemic
+
whose health condition or current life pace keep them away from systemic
-
and regular exercise and dieting, modulate the composition of microorganisms
+
and regular exercise and diet, modulating the composition of microorganisms
-
in intestine might act as an alternative.
+
in intestine might act as an alternative. </p>
-
</p>
+
<p align="justify">
<p align="justify">
Reports by Gordon have shown that, apart from human genome, the collective
Reports by Gordon have shown that, apart from human genome, the collective
Line 498: Line 753:
<p align="justify">
<p align="justify">
Two groups of beneficial bacteria are dominant in the human gut, the Bacteroidetes
Two groups of beneficial bacteria are dominant in the human gut, the Bacteroidetes
-
and the Firmicutes. The relative proportion of Firmicutes is increased
+
and the Firmicutes. The relative proportion of Firmicutes increases
-
in obese people by comparison with lean people [2].
+
in obese people by comparison with lean people [2]. </p>
-
</p>
+
<img src="https://static.igem.org/mediawiki/2012/f/fe/Background-3.jpg" width="500"
<img src="https://static.igem.org/mediawiki/2012/f/fe/Background-3.jpg" width="500"
height="120" hspace="2" vspace="1" border="2" align="top" />
height="120" hspace="2" vspace="1" border="2" align="top" />
Line 526: Line 780:
  </h4>
  </h4>
<p align="justify">
<p align="justify">
-
Dieting, excercise, Drugs and surgery and major ways to lose weight. However,
+
Diet, exercise, drug and surgery are major ways to lose weight. However,
-
they all have many drawbacks. Dieting may cause nutritional imbalance and
+
they all have many drawbacks. Diet may cause nutritional imbalance and
-
can be a heavy mental burden since the person may not be able to enjoy
+
can be a heavy mental burden since the people may not be able to enjoy
-
the food he want. Excercise requires regular time and is ineffective in
+
the food they want. Exercise requires regular time and is ineffective in
many cases. Drugs and surgery may have many side effects and are many times
many cases. Drugs and surgery may have many side effects and are many times
-
costly.
+
more costly.
</p>
</p>
<h4>
<h4>
Line 538: Line 792:
<p align="justify">
<p align="justify">
Previous situations and insights construct our theoretical fundament.
Previous situations and insights construct our theoretical fundament.
-
We try to utilize synthetic biology to provide a cheap, convient, effective
+
We tried to utilize synthetic biology to provide a cheap, convenient, effective
and safe approach for treating obesity. Instead of passive alternation
and safe approach for treating obesity. Instead of passive alternation
-
of microbiota, we are trying to construct an engineered E.coli----- E.coslim
+
of microbiota, we tried to construct an engineered E.coli----- E.coslim
to positively change microbiota in intestine. As Figure 3 shown, we place
to positively change microbiota in intestine. As Figure 3 shown, we place
-
E.coslim in the role of sensing and consuming excessive energy, thus leads
+
E.coslim in the role of sensing and consuming excessive energy, which thus leads
to the double effects: lowering the proportion of Firmicutes and increasing
to the double effects: lowering the proportion of Firmicutes and increasing
that of Bacteroidetes, and decreasing the energy available in one’s intestine.
that of Bacteroidetes, and decreasing the energy available in one’s intestine.
Line 579: Line 833:
</h3>
</h3>
</a>
</a>
-
                                     <p align="justify">  Fatty acids and sugar should be the primary targets for genetically engineered probiotics that can help people lose weight.  
+
                                     <p align="justify">  To metabolize the excessive energy, fatty acids and sugar should be the primary targets for our E.coslim to help people lose weight.  
-
For probiotics to degrade fatty acids and to convert glucose into cellulose, they must be able to sense and be regulated by exsitence of those substrates.
+
For E.coslim to degrade fatty acids and convert glucose into cellulose, they must be able to sense and get regulated by high concentration of glucose and fatty acids.
-
Otherwise, the system may not only be not efficient but also may cause serious problem. However, there is no promoter exist in nature
+
Otherwise, the system may not only be inefficient but also may cause serious problems. However, there is no promoter available in nature
-
that can solely regulated by glucose or fatty acids.
+
that can be solely regulated by glucose or fatty acids.
Therefore, to achieve our goals, we designed an indirect pathway and a direct synthetic promoter
Therefore, to achieve our goals, we designed an indirect pathway and a direct synthetic promoter
to sense and be regulated by glucose concentration. Also another synthetic promoter was designed to sense and be regulated by fatty acids.
to sense and be regulated by glucose concentration. Also another synthetic promoter was designed to sense and be regulated by fatty acids.
</p>
</p>
-
  <a name="Indirect Pathway Design">
+
            <a name="Indirect Pathway Design">
<h3>
<h3>
Indirect Pathway Design
Indirect Pathway Design
</h3>
</h3>
  </a>
  </a>
-
<p align="justify">In a cell, the total amount of ATP, ADP and  AMP molecules remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.</p>
+
<p align="justify">In a cell, the total amount of ATP, ADP and  AMP molecules remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds to and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.</p>
-
<p align="justify">We embed  gene cI of lambda phage(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_P0451">BBa_P0451</a>) downstream promoter PcstA (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a>) activated by the binding of CRP, and genes of red fluorescence protein(RFP, <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I13507">BBa_I13507</a>)  respectively downstream the promoter BBa_R0051 repressed by protein cI. In this way we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as design, output of RFP will be increased following the elevation of glucose concentration, and vice versa.</p>
+
<p align="justify">We embeded gene cI of lambda phage(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_P0451">BBa_P0451</a>) downstream promoter PcstA (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a>), which can be activated by the binding of CRP, and genes of red fluorescence protein(RFP, <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I13507">BBa_I13507</a>)  respectively downstream the promoter BBa_R0051 repressed by protein cI. In this way we constructed an indirect regulation pathway with glucose sensors, transcription activator CRP and transcription repressor cI. If the device works as design, output of RFP will increase following the elevation of glucose concentration, and vice versa.</p>
<p align="center">   <img src="https://static.igem.org/mediawiki/2012/d/d5/Indirect_regulation.png" width="500"
<p align="center">   <img src="https://static.igem.org/mediawiki/2012/d/d5/Indirect_regulation.png" width="500"
height="250" hspace="2" vspace="1" align="middle" /></p>
height="250" hspace="2" vspace="1" align="middle" /></p>
-
<p align="center"> the indirect regulation pathway</p>
+
<p align="center"> The indirect regulatory pathway</p>
<p align="justify"><strong>Method</strong></p>
<p align="justify"><strong>Method</strong></p>
<p align="justify"><strong>Construction of plasmid for indirect  regulation pathway</strong></p>
<p align="justify"><strong>Construction of plasmid for indirect  regulation pathway</strong></p>
<p align="justify">In this experiment, RFP reported the  function of the indirect regulation pathway.</p>
<p align="justify">In this experiment, RFP reported the  function of the indirect regulation pathway.</p>
-
<p align="justify">K861173: BBa_I13507, an mRFP generator with RBS and terminator, was  embedded after CRP activated promoter K118011.</p>
+
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861173">BBa_K861173</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I13507">BBa_I13507</a>, an mRFP generator with RBS and terminator, was  embedded after CRP activated promoter <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a>.</p>
-
<p align="justify">K861172: BBa_P0451, a cI generator with RBS and terminator,  was embedded after promoter BBa_K118011 activated by CRP.</p>
+
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861172">BBa_K861172</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_P0451">BBa_P0451</a>, a cI generator with RBS and terminator,  was embedded after promoter <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a> activated by CRP.</p>
-
    <p align="justify">K861169:   K861172 and I763007, a cI repressed RFP generator, were assembled .</p>
+
    <p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861169">BBa_K861169</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861172">BBa_K861172</a> and <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I763007">BBa_I763007</a>, a cI repressed RFP generator, were assembled .</p>
-
    <p align="justify">K861174: BBa_K137115, constitutively  expressing cI generator with promoter, RBS and terminator, was assembled  to I763007.</p>
+
    <p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861174">BBa_K861174</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K137115">BBa_K137115</a>, constitutively  expressing cI generator with promoter, RBS and terminator, was assembled  to <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I763007">BBa_I763007</a>  
-
    <p align="justify">All new composite parts mentioned above  were transformed  to competent cells  of Escherichia coli str. DH5a. All positive clones are validated using PCR, restriction enzyme  digestion and DNA sequencing.</p>
+
    <p align="justify">All new composite parts mentioned above  were transformed  to competent cells  of Escherichia coli str. DH5a. All positive clones were validated using PCR, restriction enzyme  digestion and DNA sequencing.</p>
    <p align="justify"><strong>Cell culture fluorescence measurement</strong></p>
    <p align="justify"><strong>Cell culture fluorescence measurement</strong></p>
-
    <p align="justify">Minimal medium with different concentration of glucose(1mM, 4mM, 10 mM , 20 mM , 50 mM ,100 mM) were transferred into a 96-well plate, 200 μL for each well. Then each well was inoculated with 2 μL of seed liquor which was activated overnight in M9 minimal medium with 50mM  glucose at 37℃. The wells without inoculation were regarded as blank controls to revise the results. Under each condition, three parallel samples were setted. The plate was incubated at 37℃, 150rpm. Cell culture fluorescence was recorded on a SpectraMax M2 plate reader (Molecular Devices). Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm.</p>
+
    <p align="justify">Minimal medium with different concentrations of glucose(1mM, 4mM, 10 mM , 20 mM , 50 mM ,100 mM) was transferred into a 96-well plate, 200 μL for each well. Then each well was inoculated with 2 μL of seed liquor which was activated overnight in M9 minimal medium with 50mM  glucose at 37℃. The wells without inoculation were regarded as blank controls to revise the results. Under each condition, three parallel samples were set. The plate was incubated at 37℃, 150rpm. Cell culture fluorescence was recorded on a SpectraMax M2 plate reader (Molecular Devices). Excitation at 584 nm and emission at 607 nm were used. All fluorescence results were normalized with cell density by measuring the absorbance at 600 nm.</p>
   
   
-
    <p align="justify"><strong>Capturing  fluorescent image </strong></p>
+
    <p align="justify"><strong>Capturing  fluorescence image </strong></p>
-
    <p align="justify">Cell morphology was observed  through fluorescence microscope, and the image of bacteria  with of each glucose concentration were captured. To know more about these images, please  click on Here.</p>
+
    <p align="justify">Cell morphology was observed  through fluorescence microscope, and the images of bacteria  with different glucose concentrations were captured.</p>
      
      
-
    <p align="justify"><strong>Fluorescent analysis of cyto-imaging</strong></p>
+
    <p align="justify"><strong>Fluorescence analysis of cyto-imaging</strong></p>
-
    <p align="justify">A program named FANCY was  designed to recognize single cell and calculate the fluorescence strength according to the images.   For more information, please click  <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=3">Here</a>.</p>
+
    <p align="justify">A program named FANCY was  designed to recognize single cell and calculate the fluorescence strength according to the images. For more information, please click  <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=3">Here</a>.</p>
    <p align="justify"><strong>Results</strong></p>
    <p align="justify"><strong>Results</strong></p>
-
    <p align="justify">Purified  plasmids  constructed before were digested with XbaI and PstI for confirmation. The agarose gel electrophoresis showed that the lengths were   correct. At last, the plasmids were sent for sequencing. Results showed no mutation.</p>
+
    <p align="justify">Purified  plasmids  constructed before were digested with XbaI and PstI for confirmation. The agarose gel electrophoresis showed that the lengths were correct. At last, the plasmids were sent for sequencing. Results showed no mutation.</p>
-
  <p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/9/9c/Indirect_Fig_1.png" width="506" height="409" alt=""></p>
+
  <p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/d/d5/Fluorescence_1n.png" width="520" height="409" alt=""></p>
-
    <p align="justify">In the cell culture fluorescence measurement experiment, fluorescence of BBa_K861173 decreased  coordinating with glucose concentration, while BBa_K861169 was  reverse.The fluorescence of BBa_K861174 was too low to record, so we do not show it here. All of the results coincided with expected results indicating that we have successfully constructed the promoter which was activated by high concentration of glucose.</p>
+
<p align="center">The result for fluorescence measurement of indirect device</p>    
-
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/d/dc/Indirect_Fig_2.png" width="500" height="220" alt=""></p>
+
 
-
    <p align="justify">Fluorescent  images indicated that all cells were growing normally, because the size and morphology were both the same as cells in LB medium. The fluorescence of the cells in the images show the same discipline with  results from the fluorescence measurement experiments. <br>
+
<p align="justify">In the cell culture fluorescence measurement experiment, fluorescence of BBa_K861173 decreased  coordinating with glucose concentration, while BBa_K861169 increased. The fluorescence of BBa_K861174 was too low to record, so we do not show it here. All of the results coincided with expected results indicating that we have successfully constructed the promoter which was activated by high concentration of glucose.</p>
-
      The results of FANCY are showed as bellow, which conforms well the results that showed above.</p>
+
                            <p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/d/dc/Indirect_Fig_2.png" width="500" height="220" alt=""></p>
 +
<p align="center">The fluorescence image of indirect device in different concentration of glucose</p>
 +
    <p align="justify">Fluorescence images indicated that all cells were growing normally, because the size and morphology were both the same as that of the cells in LB medium. The fluorescence of the cells in the images showed the same discipline as results from the fluorescence measurement experiments. <br>
 +
      The results of FANCY are showed as bellow, fluorescence intensity of PcstA+cI+RFP increased with the glucose concentration, while that of the PcstA+RFP decreased with glucose concentration. It conformed well with the results that showed above.</p>
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/2/21/Indirect_Fig_3.png" width="506" height="189" alt=""></p>    
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/2/21/Indirect_Fig_3.png" width="506" height="189" alt=""></p>    
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/c/c3/Indirect_Fig_4.png" width="500" height="226" alt=""></p>
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/igem.org/c/c3/Indirect_Fig_4.png" width="500" height="226" alt=""></p>
-
+
<p align="center">The fluorescence intensity of indirect device from program FANCY</p>
   
   
    <p align="justify">&nbsp;</p>
    <p align="justify">&nbsp;</p>
    <p align="justify"><strong>Discussion </strong><br>
    <p align="justify"><strong>Discussion </strong><br>
-
      All results of the three experiments  indicate the device works as expected. Next, RFP will be replaced with genes of  cellulose synthesis. So the exceeded glucose can  be transformed into cellulose. <br>
+
      All results of the three experiments  indicated the device worked as expected. Next, RFP will be replaced with genes of  cellulose synthesis. So the excess glucose can  be transformed into cellulose. <br>
-
      Although the indirect regulation pathway was tested effective,it  works through a intermediate product, protein cI. This determines that the  device will be less sensitive to glucose than a direct regulation pathway  without intermediate.</p>
+
      Although the indirect regulation pathway was tested effective,it  worked through an intermediate product, protein cI. This determines that the  device will be less sensitive to glucose than a direct regulation pathway  without intermediate.</p>
    <p align="left">&nbsp;</p>
    <p align="left">&nbsp;</p>
    <a name="Direct Regulatory Promoter Design">
    <a name="Direct Regulatory Promoter Design">
Line 634: Line 891:
</a>
</a>
    <p><strong> </strong></p>
    <p><strong> </strong></p>
-
    <p align="justify"><strong>1 Glucose sensor</strong></p>
+
    <p align="justify"><strong>1. Glucose sensor</strong></p>
-
    <p align="justify">To turn CRP into a repressor, I firstly consulted papers about CRP binding site and find out that 22-bp palindromic consensus site of the sequence AAATGTGATCT*AGATCACATTT. Unfortunately, this consensus sequence contain XbaI restriction site. I then designed the binding site by changing the most frequent bases in the binding site into second most frequent bases. Specifically, two binding sites were designed: AAATGTGATTTAAATCACATTT, AAATGTGATTATAATCACATTT.</p>
+
    <p align="justify">To turn CRP into a repressor, we firstly consulted papers about CRP binding site and found out that 22-bp palindromic consensus site of the sequence AAATGTGATCT*AGATCACATTT. Unfortunately, this consensus sequence contained XbaI restriction site. We then designed the binding site by changing the most frequent bases in the binding site into second most frequent bases. Specifically, two binding sites were designed: AAATGTGATTTAAATCACATTT, AAATGTGATTATAATCACATTT.</p>
-
    <p align="justify">Firstly, to construct promoter that can be directly repressed by CRP, I put modified CRP binding site between -35 and -10 region of promoter BBa_ J23110 (TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGC). However, it did not work out as we suppose to. In our reporter assay, this promoter failed to express higher level of RFP when bacteria were grown in M9 medium with higher glucose concentration.</p>
+
    <p align="justify">Firstly, to construct a promoter that can be directly repressed by CRP, we inserted modified CRP binding site between -35 and -10 region of promoter BBa_ J23110 (TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGC). However, it did not work out as we expected. In our reporter assay, this promoter failed to express higher level of RFP when bacteria grew in M9 medium with higher glucose concentration.</p>
-
    <p align="justify">Then, I tried a different strategy. I designed another promoter overlapped with CRP binding site to satisfy the sequence of -10 region of the promoter (TTGACAGCTAGCTCAAATGTGATTTAAATCACATTT). The promoter also failed to show the desired function, the expression of RFP showed that the promoter is unstable.</p>
+
    <p align="justify">Then, we tried a different strategy. We designed another promoter overlapping with CRP binding site to satisfy the sequence of -10 region of the promoter (TTGACAGCTAGCTCAAATGTGATTTAAATCACATTT). The promoter also failed to show the desired function, the expression of RFP showed that the promoter was unstable.</p>
-
    <p align="justify">Finally, I designed promoter with modified CRP binding site overlapped with the -10 region of the promoter. To satisfy better CRP binding, I firstly changed the sequence in -10 region to meet the CRP consensus sequence (TTGACAGCTAGCTCAAATGTGATTATAATCACATTT). We name it “PII”. This time, PII show exciting property as we expected.</p>
+
    <p align="justify">Finally, we designed a promoter with modified CRP binding site overlapping with the -10 region of the promoter. To satisfy better CRP binding, we firstly changed the sequence in -10 region to meet the CRP consensus sequence (TTGACAGCTAGCTCAAATGTGATTATAATCACATTT). We named it <i>Pcar</i>, which was short for <i>Promoter of CRP As a Repressor</i> . This time, Pcar showed exciting properties as we expected.</p>
-
    <p align="justify"><strong>2 Fatty acid sensor</strong></p>
+
<img src="https://static.igem.org/mediawiki/2012/8/88/Pcar1.jpg" width="500" height="260" hspace="2" vspace="1" border="2" align="top" />
-
    <p align="justify">In fact, fatty acid sensor has already been tried by iGEM2006_Tokyo_Alliance (BBa_J54220.)Yet their design failed to give desirable function.<br>
+
<p> The above figure shows the design of the Pcar</p>
-
      To design promoter that can under the sole regulation of fatty acid concentration. Double FadR binding sites in promoter of FadL are place and overlap downstream of constitutive promoter J23110 (TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCTATACTCTCGCCACTGGTCTGATTTCTAAGA). Also, FadR was overexpressed to prevent leaky expression of the promoter.</p>
+
    <p align="justify"><strong>2. Fatty acids sensor</strong></p>
 +
    <p align="justify">In fact, fatty acids sensor had already been tried by iGEM2006_Tokyo_Alliance (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J54220">BBa_J54220</a>).Yet their design failed to give desirable function.<br>
 +
      To design a promoter that is under the sole regulation of fatty acids concentration, double FadR binding sites in promoter of FadL were placed and overlapping with the downstream of constitutive promoter J23110 (TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCTATACTCTCGCC ACTGGTCTGATTTCTAAGA). We named the promoter PfadR. Also, we planned to overexpress FadR to prevent leaky expression of the promoter.</p>
 +
<img src="https://static.igem.org/mediawiki/2012/4/4d/Pfadr1.jpg" width="500" height="260" hspace="2" vspace="1" border="2" align="top" />
 +
<p> The above figure shows the design of the PfadR</p>
    <a name="Pcar">
    <a name="Pcar">
-
    <h3>Pcar</h3>
+
    <h3><i>Pcar</i></h3>
    </a>
    </a>
-
      <p align="justify">Although the indirect regulation pathway was tested  effective, we went on attempting a more compact and widely useful direct  regulation design. Hence we altered a  constitutive promoter (BBa_J23119) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on Standard),  but we shall focus on the design itself now.</p>
+
      <p align="justify">Although the indirect regulation pathway was tested  effective, we went on attempting a more compact and widely useful direct  regulation design. Hence we altered a  constitutive promoter (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">BBa_J23119</a>) into a CRP repressible one. We also established a new technical standard for our strategy of repressible promoter design (for more information, click on <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Standard">Standard</a>),  but we shall focus on the design itself now.</p>
-
      <p align="justify">We designed promoter Pcar based on promoter  BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region. Since steric hindrance of CRP dimer blocks the function of -10 region, gene downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly,  we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results show, promoter Pcar works as we expect.   </p>
+
      <p align="justify">We designed promoter Pcar based on promoter  BBa_J23119, inserting CRP-binding site and overlaping it with six base pairs in the -10 region of promoter. Since steric hindrance of CRP dimer blocks the function of -10 region, gene downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly,  we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results showed, promoter Pcar worked as we expected.   </p>
-
      <p align="justify">&nbsp;</p>
+
<p align="justify">&nbsp;</p>
-
<center>
+
<center>
-
<p>
+
<p><img src="https://static.igem.org/mediawiki/2012/1/1a/Direct_regulation.png" width="500" height="260" hspace="2" vspace="1" border="2" align="top" /></p>
-
<img src="https://static.igem.org/mediawiki/2012/1/1a/Direct_regulation.png" width="500"
+
</center>
-
height="260" hspace="2" vspace="1" border="2" align="top" />
+
<p align="center">The direct regulatory pathway</p>
-
</p>
+
-
</center>
+
  <p align="justify"><strong>Methods</strong></p>
  <p align="justify"><strong>Methods</strong></p>
<p align="justify"><strong>Design of the promoter Pcar which is  activated by glucose </strong></p>
<p align="justify"><strong>Design of the promoter Pcar which is  activated by glucose </strong></p>
-
<p align="justify">Promoter Pcar , glucose biosensor plasmid, is derived from constitutive promoter (BBa_J23119) by adding a CRP binding site upstream the promoter which has several base pairs overlapping with polymerase binding site. The sequence was synthesized with restriction  enzyme cutting site for EcoRI and XbaI at the 5' terminal and SpeI at 3'  terminal. The sequence of promoter Pcar has cohesive terminus at both ends, so it is very convenient for us to construct the plasmid for functional  detection.The sequence of Pcar is as followed:</p>
+
<p align="justify">Promoter Pcar, glucose biosensor plasmid, is derived from a constitutive promoter (BBa_J23119) by adding a CRP binding site upstream the promoter where has several base pairs overlapping with RNA polymerase binding site. The sequence was synthesized with restriction  enzyme cutting site for EcoRI and XbaI at the 5' terminal and SpeI at 3'  terminal. The sequence of promoter Pcar had cohesive terminus at both ends, so it was very convenient for us to construct the plasmid for functional  detection.The sequence of Pcar is as followed:</p>
-
<p align="justify"><img src="https://static.igem.org/mediawiki/igem.org/6/6b/Direct_Fig_1.png" width="500" height="94" alt=""></p>
+
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/b/b5/Pcar_sequence.png" width="500" height="94" alt=""></p>
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/4/4f/Crp_regulation.jpg" width="500" height="210" alt=""></p>
<p align="justify"><img src="https://static.igem.org/mediawiki/2012/4/4f/Crp_regulation.jpg" width="500" height="210" alt=""></p>
 +
<p align="center">The design concept of promoter <i>Pcar</i></p>
<p align="justify"><strong>Construction of plasmid for direct  regulation pathway</strong></p>
<p align="justify"><strong>Construction of plasmid for direct  regulation pathway</strong></p>
<p align="justify">In this experiment, RFP reported the  function of the indirect regulation pathway.</p>
<p align="justify">In this experiment, RFP reported the  function of the indirect regulation pathway.</p>
-
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861179">BBa_K861179</a>: BBa_I13507, an mRFP generator with RBS and terminator was embedded downstream the constitutive promoter BBa_J23119</p>
+
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861179">BBa_K861179</a>: <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I13507">BBa_I13507</a>, an mRFP generator with RBS and terminator was embedded downstream the constitutive promoter BBa_J23119</p>
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861176">BBa_K861176</a>: BBa_I13507 was embedded downstream the artificial promoter Pcar.</p>
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861176">BBa_K861176</a>: BBa_I13507 was embedded downstream the artificial promoter Pcar.</p>
-
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861178">BBa_K861178</a>: a constitutive expressed CRP(J23116+K861161) was assembled with K861176.</p>
+
<p align="justify"><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861178">BBa_K861178</a>: a constitutive expressed CRP(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23116">BBa_J23116</a>+<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861161">BBa_K861161</a>) was assembled with K861176.</p>
-
<p align="justify">All new composite parts mentioned above  were transformed to competent cells of Escherichia coli str. DH5a. All positive  clones are validated using PCR, restriction enzyme digestion and DNA  sequencing.</p>
+
<p align="justify">All new composite parts mentioned above  were transformed to competent cells of <i>Escherichia coli</i> str. DH5a. All positive  clones were validated using PCR, restriction enzyme digestion and DNA  sequencing.</p>
<p align="justify"><strong>Functional detection</strong></p>
<p align="justify"><strong>Functional detection</strong></p>
<p align="justify">The same methods with that of the indirect regulation pathway were used  to confirm that the promoter worked as expected. For details, please click <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Indirect Pathway Design">Here</a>.</p>
<p align="justify">The same methods with that of the indirect regulation pathway were used  to confirm that the promoter worked as expected. For details, please click <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Indirect Pathway Design">Here</a>.</p>
  <p align="justify"><strong>Results</strong></p>
  <p align="justify"><strong>Results</strong></p>
<p align="justify"><strong>Construction  of the plasmid for functional detection</strong></p>
<p align="justify"><strong>Construction  of the plasmid for functional detection</strong></p>
-
<p align="justify">The sizes of the Promoter Pcar and J23119  were less than 100 bp and  proved to be  correct by the agarose gel electrophoresis . Restriction Digestion of the  plasmid BBa_I13507 only have one lad on the agarose gel, it told that the  plasmid was digested well. After transformation, competent cells were cultured on agar plate with 50 μg/L  of ampicillin. Both red and white bacterial colonies emerged on one plate. The red ones were  the correct clones revealing promoter embedded  successfully, while the white ones were negative . The red clones were picked out and cultured in LB medium for plasmid extraction.  Purified plasmids were digested with XbaI and PstI for confirmation. The bands  of 2000bp and 1000bp showed that the promoter had been embedded successfully.  At last, the plasmids we acquired were sent for sequencing, results show no mutation exist. </p>
+
<p align="justify">The sizes of the Promoters Pcar and J23119  are less than 100 bp.  And they were proved to be  correct by agarose gel electrophoresis. Restriction Digestion of the  plasmid BBa_I13507 only have one lad on the agarose gel, it told that the  plasmid was digested well. After transformation, competent cells were cultured on agar plate with 50 μg/L  of ampicillin. Both red and white bacterial colonies emerged on one plate. The red ones were  the correct clones revealing promoter embedded  successfully, while the white ones were negative. The red clones were picked out and cultured in LB medium for plasmid extraction.  Purified plasmids were digested with XbaI and PstI for confirmation. The bands  of 2000bp and 1000bp showed that the promoter had been embedded successfully.  At last, the plasmids we acquired were sent for sequencing, and the result showed no mutation existed. </p>
-
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/6/6d/Pii_%E8%83%B6%E5%9B%BE.jpg" width="520" height="584" alt=""></p>
+
                            <p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/6/6d/Pii_%E8%83%B6%E5%9B%BE.jpg" width="520" height="584" alt=""></p>
 +
<p align="center">The agarose gel for digestion comfirmation</p>
<p align="justify"><strong>Cell culture fluorescence measurement. </strong></p>
<p align="justify"><strong>Cell culture fluorescence measurement. </strong></p>
-
<p align="justify">The  correct clones were cultured in 96-well plate at 37℃ for 24 hours,then the fluorescence  and absorbance at 600 nm were recorded on a SpectraMax M2 plate reader. All fluorescence was normalized with absorbance at 600 nm.The results represented  the fluorescence of every cell.<br>
+
<p align="justify">The  correct clones were cultured in 96-well plate at 37℃ for 24 hours, then the fluorescence  and absorbance at 600 nm were recorded on a SpectraMax M2 plate reader. All fluorescence results were normalized with absorbance at 600 nm. The results represented  the fluorescence of every well.<br>
  The fluorescence  of K861179 was about 10000 Relative Light Units. It did not vary with  concentrations of glucose. However we found a positive correlation between the  fluorescence of K861176 and concentration of glucose. At a glucose concentration  lower than 4mM, the fluorescence was very low, but at high concentration of  glucose like 100mM, the fluorescence was much less than that of K861179. </p>
  The fluorescence  of K861179 was about 10000 Relative Light Units. It did not vary with  concentrations of glucose. However we found a positive correlation between the  fluorescence of K861176 and concentration of glucose. At a glucose concentration  lower than 4mM, the fluorescence was very low, but at high concentration of  glucose like 100mM, the fluorescence was much less than that of K861179. </p>
-
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/0/02/PII%E8%8D%A7%E5%85%89.png" width="520" height="413" alt=""></p>
+
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/0/00/Fluorescence_PCAR.png" width="520" height="413" alt=""></p>
-
 
+
<p align="center">The result of promoter Pcar from fluorescence measurement</p>
-
  <p align="justify"><strong>Capturing of the fluorescent image </strong></p>
+
  <p align="justify"><strong>Capturing of the fluorescence image </strong></p>
-
  <p align="justify">Fluorescent  images indicated that all the cells were growing normally, because the size and  morphology were both the same with cells in LB medium.the fluorescence of the  cells in the images show the same discipline with results from the fluorescence  measurement experiments. Fluorescence of K861179 was very strong but it didn't  change with the glucose concentration. On the contrary, fluorescence of K861176  was relatively weak but increased with  concentration of glucose.</p>
+
  <p align="justify">Fluorescence images indicated that all the cells were growing normally, because the size and  morphology were both the same with cells in LB medium. The fluorescence of the  cells in the images showed the same discipline with results from the fluorescence  measurement experiments. Fluorescence of K861179 was very strong but it didn't  change with the glucose concentration. On the contrary, fluorescence of K861176  was relatively weak but increased with  concentration of glucose.</p>
-
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/d/d2/PII_%E8%8D%A7%E5%85%89%E7%85%A7%E7%89%87.png" width="510" height="210" alt=""></p>
+
                          <p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/d/d2/PII_%E8%8D%A7%E5%85%89%E7%85%A7%E7%89%87.png" width="510" height="210" alt=""></p>
-
 
+
<p align="center">Fluorescence images of Pcar and J23119 in different glucose concentration</p>
  <p align="justify"><strong>Fluorescent analysis of cyto-imaging</strong></p>
  <p align="justify"><strong>Fluorescent analysis of cyto-imaging</strong></p>
-
  <p align="justify">The results of FANCY is showed as bellow, single cell was recognized from fluorescence images and fluorescence intensity was caculated.In the table, datas show that RFP expression was activated in high glucose concentration, which conforms well with results above.For more information about FANCY,click <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=3">Here</a>.</p>
+
  <p align="justify">The results of FANCY are showed as bellow, single cell was recognized from fluorescence images and fluorescence intensity was calculated. In the table, data showed that RFP expression was activated in high glucose concentration, which conformed well with results above.For more information about FANCY,click <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=3">Here</a>.</p>
-
<p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/d/d4/%E8%A1%A81.png" width="500" height="140" alt=""></p>
+
                          <p align="justify"><img name="" src="https://static.igem.org/mediawiki/2012/d/d4/%E8%A1%A81.png" width="500" height="140" alt=""></p>
-
 
+
<p align="center">Fluorescent intensity of Pcar from program FANCY</p>
  <p align="justify"><strong>&nbsp;</strong></p>
  <p align="justify"><strong>&nbsp;</strong></p>
<p align="justify"><strong>Discussion</strong></p>
<p align="justify"><strong>Discussion</strong></p>
-
      <p align="justify">The promoter  Pcar is a promoter designed for the <em>Eschaerichia coli</em> which is derived from a constitutive promoter BBa_J23119. Pcar includes the CRP-binding site and the RNA polymerase-binding site which overlap several base pairs. Therefore, because of the steric hindrance between CRP and RNA polymerase, gene downstream of the promoter will be repressed at high concentration of CRP. In the cells, low glucose concentration results in increasing activity by adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound form, is able to bind tightly to the specific DNA site in the promoter and repress the  gene downstream. On the contrary, high  glucose concentration will result in the expression of the promoter.</p>
+
      <p align="justify">The promoter  Pcar is a promoter designed for the <em>Escherichia coli</em> and it is derived from a constitutive promoter BBa_J23119. Pcar includes the CRP-binding site and the RNA polymerase-binding site which overlap each other several base pairs. Therefore, because of the steric hindrance between CRP and RNA polymerase, gene downstream of the promoter will be repressed at high concentration of CRP. In the cells, low glucose concentration results in increasing activity by adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound form, is able to bind tightly to the specific DNA site in the promoter and to repress the  gene downstream. On the contrary, high  glucose concentration will result in the activation of the promoter.</p>
      <p align="justify">&nbsp;</p>
      <p align="justify">&nbsp;</p>
<a name="PfadR">
<a name="PfadR">
<h3>
<h3>
-
PfadR
+
<i>PfadR</i>
</h3>
</h3>
  </a>
  </a>
<h4>Outline</h4>
<h4>Outline</h4>
<p align="justify"> The design of  
<p align="justify"> The design of  
-
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861071"> Pcar</a> had sparkled the design of <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">PfadR</a>. In nature, beta oxidation needs these five genes, and is regulated by many factors besides fatty acids concentration. Therefore, there is no promoter that can meet our demand to be solely regulated by fatty acids. Therefore, we tried to develop a synthetic promoter that will be regulated by fatty acids. We found that the last 3 base pair of constitutive promoter BBa_J23110 is the same to the first three base pairs of FadR binding site of FadL. Therefore, we thought that maybe by prevent the initiation of transcription, we can achieve our goal. </p>
+
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861071"> Pcar</a> had sparkled the design of <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">PfadR</a>. In nature, beta oxidation needs these five genes, and is regulated by many factors besides fatty acids concentration. Therefore, there is no promoter that can meet our demand to be solely regulated by fatty acids. Therefore, we tried to develop a synthetic promoter that would be regulated solely by fatty acids. We found that the last 3 base pairs of constitutive promoter BBa_J23110 are the same as the first three base pairs of FadR binding site of FadL. Therefore, we thought that maybe by preventing the initiation of transcription, we can achieve our goal. </p>
<h4>Design of the Promoter PfadR Repressed by Fatty Acids</h4>
<h4>Design of the Promoter PfadR Repressed by Fatty Acids</h4>
-
<p align="justify"> Promoter PfadR, is derived from BBa_J23110. Specifically, FadR binding site of FadL gene was placed overlapping with the last 3 base pairs of BBa_J23110 The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. We use overlapping PCR to get the double strand DNA. The sequence design of PfadR is as followed: </p>
+
<p align="justify"> Promoter PfadR, is derived from BBa_J23110. Specifically, FadR binding site of FadL gene was placed overlapping with the last 3 base pairs of BBa_J23110. The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. We used overlapping PCR to get the double strand DNA. The sequence design of PfadR is as followed: </p>
-
<p align="justify"> Forward: GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT</p></br>
+
<p align="justify"> Forward: GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT</p>
<p align="justify"> Reverse: GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT</p></br>
<p align="justify"> Reverse: GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT</p></br>
<h4>Procedures</h4>
<h4>Procedures</h4>
-
<p align="justify"> For M9 medium using oleic acid as sole carbon source, oleic acid was first emulsified 10% Triton X-100. M9 medium was then slowly added with constant vortex. M9 medium with high concentration of oleic acid was diluted by M9 medium with triton to form various concentrations. </p>
+
<p align="justify"> For M9 medium using oleic acids as sole carbon source, oleic acids was first emulsified 10% Triton X-100. M9 medium was then slowly added with constant vortex. M9 medium with high concentration of oleic acids was diluted by M9 medium with triton to form various concentrations. </p>
<p align="justify">For M9 medium using glucose as sole carbon source, M9 medium with high concentration of glucose was diluted by M9 medium to form various concentrations. </p>
<p align="justify">For M9 medium using glucose as sole carbon source, M9 medium with high concentration of glucose was diluted by M9 medium to form various concentrations. </p>
<p align="justify"> After 24h of incubation in 24 well plates in 37°C, bacteria culture was centrifuged at 3000rmp for 5min, washed and resuspended in PBS. We detected the OD600 and fluorescence of using SpectraMax M2 plate reader (Molecular Devices) .Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm. </p>
<p align="justify"> After 24h of incubation in 24 well plates in 37°C, bacteria culture was centrifuged at 3000rmp for 5min, washed and resuspended in PBS. We detected the OD600 and fluorescence of using SpectraMax M2 plate reader (Molecular Devices) .Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm. </p>
Line 716: Line 977:
<p align="justify"> Fatty acid Concentration gradient: 0.025, 0.05, 0.1, 0.25, 0.5, 1, 1.5 mM</p>
<p align="justify"> Fatty acid Concentration gradient: 0.025, 0.05, 0.1, 0.25, 0.5, 1, 1.5 mM</p>
   
   
-
<p><img src="http://partsregistry.org/wiki/images/0/00/PfadR.png" width="500" height="400" hspace="2" vspace="1" border="2" align="top" /></p>
+
<p><img src="https://static.igem.org/mediawiki/2012/a/ae/PFADR.png" width="500" height="400" hspace="2" vspace="1" border="2" align="top" /></p>
<p><i> PfadR and BBa_J23110 promoter strength at different glucose and fatty acids concentration</i></p>
<p><i> PfadR and BBa_J23110 promoter strength at different glucose and fatty acids concentration</i></p>
-
<p align="justify"> As can be shown from the results, the promoter shows about 3 times induction from glucose to 1.5umol/L fatty acids medium and the fluorescence of PfadR is about one sixth of <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23110">BBa_J23110</a>. This may be result from the tandem FadR binding site has made it more difficult for Polymerase to start gene transcription. Also, in medium that use glucose as sole carbon source, PfadR seems to be leaky. However, since our bacteria is wild type <i>E.coli</i>, Fab genes was not mutated, meaning that bacteria can synthesis fatty acids. Therefore, there may be a basal level fatty acids concentration inside the cell, making the transcription not being totally repressed. </p>
+
<p align="justify"> As shown from the results, the promoter showed about 3 times induction from glucose to 1.5umol/L fatty acids medium and the fluorescence of PfadR was about one sixth of <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23110">BBa_J23110</a>. This may because the tandem FadR binding site had made it more difficult for Polymerase to start gene transcription. Also, in medium that used glucose as sole carbon source, PfadR seemed to be leaky. However, since our bacteria was wild type <i>E.coli</i>, Fab genes was not mutated, meaning that bacteria can synthesis fatty acids. Therefore, there may be a basal level fatty acids concentration inside the cell, making the transcription not being totally repressed. </p>
-
<p align="justify"> It should also be noticed that from fatty acids concentration 0.0251.5umol/L to 1.5umol/L, the induction is not very obvious. F0.25, 0.5 and 1 seemed to have similar fluorescence strength. The promoter is not sensitive enough. To further improve the function of PfadR, we are planning to modify the sequence of FadR binding sites to make FadR overlap more will promoter region. Also, we will try to overexpressed FadR protein to see its effects on PfadR.</p>
+
<p align="justify"> It should also be noticed that, from fatty acids concentration 0.025umol/L to 1.5umol/L, the induction was not very obvious. For fatty acids concentration F0.25, 0.5 and 1, it seemed to have similar fluorescence strength. The promoter was not sensitive enough. To further improve the function of PfadR, we are planning to modify the sequence of FadR binding sites to make FadR overlap more willing promoter region. Also, we will try to overexpressed FadR protein to see its effects on PfadR.</p>
<p align="justify">&nbsp;</p>
<p align="justify">&nbsp;</p>
-
<a name="Standard"><h3 align="justify">Standard</h3></a>
+
<a name="Standard"><h3>Standard</h3></a>
<p align="justify">To address the problem of sensing substrates in our metabolic devices, we have developed a few promoters following the strategy of modifying unconserved regions to protein binding sites. As steric hindrance can stop RNA polymerase as well as other transcription factors from correctly binding and functioning, the binding protein become the repressor of our synthetic promoters.</p>
<p align="justify">To address the problem of sensing substrates in our metabolic devices, we have developed a few promoters following the strategy of modifying unconserved regions to protein binding sites. As steric hindrance can stop RNA polymerase as well as other transcription factors from correctly binding and functioning, the binding protein become the repressor of our synthetic promoters.</p>
-
<p align="justify">To different promoters, the detail of modification comes in different ways. For instance, the PfadR (BBa_J861060) is modified downstream -10 region, while Pcar (BBa_J861171) is modified between -35 and -10 region. Indeed we have tried some other modifications (for more information, click on design of promoters) without desirable functions and we still do not know why. However, all modifications aimed at the same goal, to introduce overlapping sequences between binding site of the designed repressor and the promoter.</p>
+
<p align="justify">For different promoters, the details of modification come in different ways. For instance, the PfadR (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J861060">BBa_J861060</a>) was modified downstream -10 region, while Pcar (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J861171">BBa_J861171</a>) was modified between -35 and -10 region. Indeed we have tried some other modifications (for more information, click on design of promoters) but without desirable functions and we still do not know why. However, all modifications aimed at the same goal, to introduce overlapping sequences between binding site of the designed repressor and the promoter.</p>
-
<p align="justify">To test the function of these promoters, we used the method of fluorescence measurements. First, both the modified promoter and the unmodified one (as control) were assembled with mRFP genes as reporter. Hence, after culturing and testing fluorescence intensities using different methods (see direct regulation and FANCY), we can learn if the synthetic promoter is regulated as expected.</p>
+
<p align="justify">To test the function of these promoters, we used fluorescence measurements. First, both the modified promoter and the unmodified one (as control) were assembled with mRFP gene as a reporter. Hence, after culturing and testing fluorescence intensities using different methods (see <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Indirect Pathway Design">indirect regulation</a> and <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=3">FANCY</a>), we can learn if the synthetic promoter is regulated as expected.</p>
<p align="justify">After a few successes, we are endeavoring setting up a new technical standard on design, construction and functional test of promoters. </p>
<p align="justify">After a few successes, we are endeavoring setting up a new technical standard on design, construction and functional test of promoters. </p>
<p align="justify">&nbsp;</p>
<p align="justify">&nbsp;</p>
</div>
</div>
<div class="passage divcell3">
<div class="passage divcell3">
-
<h3>Fatty Acid Degradation Device</h3></a>
 
<p>
<p>
<iframe width="420" height="315" src="http://www.youtube.com/embed/bauWVfxu_nA" frameborder="0" allowfullscreen></iframe>
<iframe width="420" height="315" src="http://www.youtube.com/embed/bauWVfxu_nA" frameborder="0" allowfullscreen></iframe>
</p>
</p>
 +
<p>The above is the video introduction of fatty acid degradation device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTM3Mjc2.html">here</a> for the video</p>
             <a name="Purpose"><h3>Purpose</h3></a>
             <a name="Purpose"><h3>Purpose</h3></a>
</p>
</p>
Line 738: Line 999:
             To help people lose weight without the need of food restriction, we designed a genetically modified  
             To help people lose weight without the need of food restriction, we designed a genetically modified  
-
<i>E.coli</i> that can sense and degrade excessive fatty acids intake by the host. We hope that, together with other two  
+
<i>E.coli</i> that can sense and degrade excessive fatty acid intake by the host. We hope that, together with other two  
-
devices we designed, we can introduce our <i>E.coslim</i> as resident in intestine to consume the excessive calories intake  
+
devices we designed, we can introduce our <i>E.coslim</i> as a resident in intestine to consume the excessive calories intake  
by the host and regulate intestinal microbiota.
by the host and regulate intestinal microbiota.
Line 752: Line 1,013:
Genes that are responsible for degradation and transportation of fatty acids (FAs) from <i>E.coli K12</i> and from  
Genes that are responsible for degradation and transportation of fatty acids (FAs) from <i>E.coli K12</i> and from  
-
<i>Salmonella enterica LT2</i> were cloned. Also, a promoter that can that can be regulated soley by fatty acids was also  
+
<i>Salmonella enterica LT2</i> were cloned. Also, a promoter named PfadR that can be regulated solely by fatty acids was also  
-
designed. By placing those fatty acid degradation genes downstream of the artificially designed promoter PfadR (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">BBa_K861060</a>) that can sense
+
designed. By placing those fatty acids degradation genes downstream of the artificially designed promoter PfadR (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861060">BBa_K861060</a>), we hope to create a device that degrades FAs only when the concentration of FAs is high.
-
 
+
-
the concentration of FAs, we hope to create a device that to degrade FAs only when the concentration of FAs is high.
+
  </p>
  </p>
<p align="justify">
<p align="justify">
-
Long chain fatty acids are firstly being imported by the transmembrane protein <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861500">FadL</a>. After FAs get into cells, a CoA will  
+
Long chain fatty acids are firstly imported by the transmembrane protein <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861500">FadL</a>. After FAs get into cells, a CoA will  
be added by inner membrane-associated <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861010">FadD</a> (acyl-CoA synthase). β-oxidation is initiated by <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861020">FadE</a>(acyl-CoA dehydrogenase),  
be added by inner membrane-associated <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861010">FadD</a> (acyl-CoA synthase). β-oxidation is initiated by <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861020">FadE</a>(acyl-CoA dehydrogenase),  
Line 769: Line 1,028:
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861050">FadR</a> is a transcriptional regulator that, when not binds to acyl-CoA, can either serve as an activator for fatty acid  
<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861050">FadR</a> is a transcriptional regulator that, when not binds to acyl-CoA, can either serve as an activator for fatty acid  
-
synthesis gene like FabA, FabB and etc. or a repressor for fatty acid degradation gene like FadA, FadB, FadD FadE, FadL,  
+
synthesis genes like FabA, FabB and etc., or a repressor for fatty acid degradation genes like FadA, FadB, FadD FadE, FadL,  
FadI, FadJ and etc. After long chain fatty acids are converted to fatty acyl- CoA by FadD, it can bind to FadR. The binding  
FadI, FadJ and etc. After long chain fatty acids are converted to fatty acyl- CoA by FadD, it can bind to FadR. The binding  
Line 777: Line 1,036:
Therefore, FadR can no longer activate or repress the transcription of genes downstream FadR binding sites. However, to our  
Therefore, FadR can no longer activate or repress the transcription of genes downstream FadR binding sites. However, to our  
-
knowledge, there is no promoter exists in nature that can respond solely to FadR since those promoters are often regulated  
+
knowledge, there is no promoter available in nature that can respond solely to FadR since those promoters are often also regulated  
by glucose concentration or oxidative stress and many other factors.</br>
by glucose concentration or oxidative stress and many other factors.</br>
-
In our design, FadL, FadD, FadE, FadA, FadB FadI, FadJ and FadA from <i>Escherichia coli K12</i>, and <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861042">FadA</a>, <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861032">FadB</a> and <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861021">FadE</a>  
+
In our design, FadL, FadD, FadE, FadA, FadB, FadI and FadJ from <i>Escherichia coli K12</i>, and <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861042">FadA</a>, <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861032">FadB</a> and <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861021">FadE</a>  
-
from <i>Salmonella enterica LT2</i> are placed downstream a synthetic promoter PfadR to make them under the
+
from <i>Salmonella enterica LT2</i> were placed downstream a synthetic promoter PfadR to make them solely regulated by fatty acids concentration.</br>
-
 
+
-
sole regulation of fatty acids concentration.</br>
+
</br>
</br>
Line 795: Line 1,052:
</h4>
</h4>
<p align="justify">
<p align="justify">
-
First, the genome of <i>Escherichia coli K12 str. DH5ɑ</i> and <i>Salmonella enterica LT2</i> (symbolized as S-) were got
+
First, the genome of <i>Escherichia coli K12 str. DH5ɑ</i> and <i>Salmonella enterica LT2</i> (symbolized as S-) were extracted
-
and amplified in PCR using primers for each gene. The sequences of the primers used are as bellow (5’---3’).</br>
+
and amplified by PCR using primers for each gene. The sequences of the primers used are as bellow (5’---3’).</br>
-
FadR Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG</br>
+
<em>fadR</em> Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG</br>
       Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC</br>
       Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC</br>
-
FadA Forward: GGAATTCTCTAGAATGGAACAGGTTGTCATTGTCG</br>
+
      <em>fadA</em> Forward: GGAATTCTCTAGAATGGAACAGGTTGTCATTGTCG</br>
       Reverse: GACTAGTTTAAACCCGCTCAAACACCGT</br>
       Reverse: GACTAGTTTAAACCCGCTCAAACACCGT</br>
-
FadB Forward: GGAATTCTCTAGAATGCTTTACAAAGGCGACACC</br>
+
      <em>fadB</em> Forward: GGAATTCTCTAGAATGCTTTACAAAGGCGACACC</br>
       Reverse: GACTAGTTTAAGCCGTTTTCAGGTCGCC</br>
       Reverse: GACTAGTTTAAGCCGTTTTCAGGTCGCC</br>
-
FadD Forward: GGAATTC TCTAGATTGAAGAAGGTTTGGCTTAACCG</br>
+
      <em>fadD</em> Forward: GGAATTC TCTAGATTGAAGAAGGTTTGGCTTAACCG</br>
       Reverse: GACTAGTTCAGGCTTTATTGTCCACTTTGC</br>
       Reverse: GACTAGTTCAGGCTTTATTGTCCACTTTGC</br>
-
FadE Forward: GGAATTC TCTAGAATGATGATTTTGAGTATTCTCG</br>
+
      <em>fadE</em> Forward: GGAATTC TCTAGAATGATGATTTTGAGTATTCTCG</br>
       Reverse: GACTAGTTTACGCGGCTTCAACTTTCCG</br>
       Reverse: GACTAGTTTACGCGGCTTCAACTTTCCG</br>
-
FadL Forward: GGAATTC TCTAGAATGAGCCAGAAAACCCTG</br>
+
      <em>fadL</em> Forward: GGAATTC TCTAGAATGAGCCAGAAAACCCTG</br>
Reverse: GACTAGTTAGAACGCGTAGTTAAAGTTAG</br>
Reverse: GACTAGTTAGAACGCGTAGTTAAAGTTAG</br>
-
FadI Forward: GGAATTC TCTAGA ATGGGTCAGGTTTTACC</br>
+
    <em>fadI</em> Forward: GGAATTC TCTAGA ATGGGTCAGGTTTTACC</br>
     Reverse: GACTAGTTTATTCCGCCTCCAGAACCA</br>
     Reverse: GACTAGTTTATTCCGCCTCCAGAACCA</br>
-
FadJ Forward: GGAATTCTCTAGAATGGAAATGACATCAGC</br>
+
    <em>fadJ</em> Forward: GGAATTCTCTAGAATGGAAATGACATCAGC</br>
     Reverse: GACTAGTTTATTGCAGGTCAGTTGCAGTTG</br>
     Reverse: GACTAGTTTATTGCAGGTCAGTTGCAGTTG</br>
-
S-FadA Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG</br>
+
    <em>s-fadA</em> Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG</br>
       Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC</br>
       Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC</br>
-
S-FadB Forward: GGAATTCTCTAGAATGCTTTATAAAGGCGACACC</br>
+
      <em>s-fadB</em> Forward: GGAATTCTCTAGAATGCTTTATAAAGGCGACACC</br>
         Reverse: GACTAGTTAAGCCGTTTTCAGAGAACC</br>
         Reverse: GACTAGTTAAGCCGTTTTCAGAGAACC</br>
-
S-FadE Forward: GGAATTCTCTAGAATGATGATTTTGAGTATTATCG</br>
+
        <em>s-fadE</em> Forward: GGAATTCTCTAGAATGATGATTTTGAGTATTATCG</br>
Reverse: GACTAGTTATGCGGCTTCGACTTTACGC</br>
Reverse: GACTAGTTATGCGGCTTCGACTTTACGC</br>
-
 
</p>
</p>
<h4>
<h4>
Line 837: Line 1,093:
</h4>
</h4>
<p align="justify">
<p align="justify">
-
Promoter PfadR, is derived from <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23110">BBa_J23110</a>. Specifically, FadR binding site of FadL gene is placed overlapping with the last  
+
Promoter PfadR, was derived from <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23110">BBa_J23110</a>. Specifically, FadR binding site of <em>fadL</em> gene was placed overlapping with the last  
-
3 base pairs of BBa_J23110 The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at  
+
3 base pairs of BBa_J23110. The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at  
-
3' terminal. We used overlapping PCR to get the double strand DNA. The sequence design of PfadR is as followed:</br>
+
3' terminal. We used overlapping PCR to get the double strand DNA. The primer design of PfadR is as followed:</br>
Forward:
Forward:
GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT</br>
GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT</br>
Reverse:
Reverse:
-
GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT
+
GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT</p>
-
 
+
-
</p>
+
<h4>
<h4>
Line 853: Line 1,107:
</h4>
</h4>
<p align="justify">
<p align="justify">
-
Fatty acid degradation project is divided into two parts: Promoter, and gene function</br>
+
Fatty acid degradation project is divided into two parts: promoter, and gene function.</br>
-
To discover the optimal combination of those fatty acid genes, we:</br>
+
To discover the optimal combination of those fatty acid genes :</br>
-
1. PCR to clone those genes in <i>E.coli K12</i> and <i>Salmonella enterica LT2</i></br>
+
1. PCR was used to clone those genes in <i>E.coli K12</i> and <i>Salmonella enterica LT2</i></br>,
-
2. Restriction digest and ligate those gene into pSB1C3</br>
+
2. those genes were restriction digested and ligated into pSB1C3,</br>
-
3. Restriction digest and ligate those gene with RBS(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">B0030</a>)</br>
+
3. those genes were restriction digested and ligated with RBS(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">B0030</a>),</br>
-
4. RBS-FadA, RBS-FadI, and RBS-S- FadA is ligated with both <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_R0011">BBa_R0011</a> promoter and our PfadR</br>
+
4. RBS-FadA, RBS-FadI, and RBS-S-FadA was ligated with both <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_R0011">BBa_R0011</a> promoter and our PfadR</br>
-
   RBS-FadR, RBS-FadB, RBS-FadJ, RBS-FadE, RBS-FadD, RBS-FadL, RBS-S-FadB, and RBS-S-FadE are ligated with <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0034">B0034</a></br>
+
   RBS-FadR, RBS-FadB, RBS-FadJ, RBS-FadE, RBS-FadD, RBS-FadL, RBS-S-FadB, and RBS-S-FadE were ligated with <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0034">B0034</a>,</br>
-
5.PROMOTER-RBS-FadA is ligated with RBS-FadB-Terminator, PROMOTER-RBS-FadI is ligated with RBS-FadJ-Terminator and  
+
5. Promoter-RBS-FadA was ligated with RBS-FadB-Terminator, Promoter-RBS-FadI was ligated with RBS-FadJ-Terminator and  
-
PROMOTER-RBS-S-FadA is ligated with RBS-S-FadB-Terminator. RBS-FadE-Terminator, RBS-FadD-Terminator, RBS-FadL-Terminator,  
+
Promoter-RBS-S-FadA was ligated with RBS-S-FadB-Terminator. RBS-FadE-Terminator, RBS-FadD-Terminator, RBS-FadL-Terminator,  
-
and RBS-S-FadE-Terminator, are ligated with BBa_R0011 promoter, PfadR and various constitutive promoters.
+
and RBS-S-FadE-Terminator, were ligated with BBa_R0011 promoter, PfadR and various constitutive promoters.
For Promoter PfadR</br>
For Promoter PfadR</br>
-
1. promoter PfadR was synthesized using overlapping PCR</br>
+
(1) promoter PfadR was synthesized using overlapping PCR</br>
-
2. RFP reporter was ligated downstream the promoter and ligted into pSB6A1</br>
+
(2) RFP reporter was ligated downstream the promoter and ligted into pSB6A1</br>
-
3. J23116+ RBS+ FadR+ Terminator was ligated to PfadR+ RFP in pSB6A1</br>
+
(3) J23116+ RBS+ FadR+ Terminator was ligated to PfadR+ RFP in pSB6A1</br>
-
 
+
</p>
</p>
Line 882: Line 1,135:
<img src="http://partsregistry.org/wiki/images/2/28/Cupric_acetate.png" width="500" height="250" hspace="2" vspace="1" border="2"  
<img src="http://partsregistry.org/wiki/images/2/28/Cupric_acetate.png" width="500" height="250" hspace="2" vspace="1" border="2"  
-
align="left" /><p><i>Cupric acetate-pyridine reaction</i></p>
+
align="left" />
-
We used cupric acetate-pyridine as a color developing reagent to determine fatty acid consumption of genetically modified bacteria. We had modified existing methods to extract free fatty acid in M9 medium. Also, we used IPTG induced promoter BBa_R0011 to see the expression of those proteins and extract proteins from cells. For more details, please see Protocol page.
+
<p align="center"><i>Cupric acetate-pyridine reaction</i></p>
 +
<p>
 +
We used cupric acetate-pyridine as a color developing reagent to determine fatty acids consumption of genetically modified bacteria. We have modified existing methods to extract free fatty acid in M9 medium. Also, we used IPTG induced promoter BBa_R0011 to see the expression of those proteins and extract proteins from cells. For more details, please see protocol: <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=3#Protocols of Cupric-Soap Reaction">Cupric-Soap Reaction</a> for more details.
</p>
</p>
 +
<p align="justify">We also conducted <em>in vitro</em> experienments in which we characterized fatty acid degradation capabilities of combination of enzymes using a cell free system. Please see protocol: <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=3#In vitro experiment"><i>In vitro</i> Experiment</a> for more details.
<a name="Results"><h3>Results</h3></a>
<a name="Results"><h3>Results</h3></a>
<h4>
<h4>
Line 890: Line 1,146:
</h4>
</h4>
<p align="justify">
<p align="justify">
-
In this experiment, we wanted to test whether the ability of degrading fatty acids of our genetically modified bacteria was enhanced as expected by transforming plasmids constitutively expressing related genes in the β- oxidation pathway. The effects of the genes we have tested is listed in the following chart I. The ability was reflected by the change of the concentration of the fatty acids in the medium. It was measured by cupric-acetate soap reaction as described Protocols section. Each time we inoculated 50mg bacteria into 30ml M9 medium using fatty acid as sole carbon source, collecting the sample at the time as shown in the picture. Then the analysis of the free fatty acids was performed.
+
In this experiment, we wanted to test whether the ability of degrading fatty acids of our genetically modified bacteria was enhanced as expected by transforming plasmids constitutively expressing related genes in the β-oxidation pathway. The effects of the genes we tested is listed in the following chart I. The ability was reflected by the change of the concentration of the fatty acids in the medium. It was measured by cupric-acetate soap reaction as described in Protocols section. Each time we inoculated 50mg bacteria into 30ml M9 medium using fatty acids as sole carbon source, collecting the sample at the time as shown in the picture. Then the analysis of the free fatty acids was performed.
</p>
</p>
<p align="justify">
<p align="justify">
-
The following figures shows the effects on degrading fatty acids by expressing different genes in β- oxidation pathway in E.coli. They are under the regulation of promoters with different kinds of strength. J23107 and J23114 are constitutive promoters provided by the commitee. pfadR is the promoter designed by ourselves. It consists of the sequence of a constitutive promoter and the binding sequence of the transcription factor, FadR, which is the sensor of the fatty acids. FadE is the acyl-CoA dehydrogenase,which had been proved as performing the rate limiting reaction in the pathway. S-FadE is the counterpart of FadE in the bacteria Samonella. FadD is the acyl-CoA synthase. FadL, a transmembrane protein, is responsible for transporting fatty acids into the bacteria. The control we use is the E.coli expressing galU, a gene responsible for synthesize cellulose, as the control .</p>
+
The following figures showed the effects on degrading fatty acids by expressing different genes in β-oxidation pathway in <em>E.coli</em>. They were under the regulation of promoters with different kinds of strength. J23107 and J23114 are constitutive promoters provided by the committee. PfadR is the promoter designed by ourselves. It consists of the sequence of a constitutive promoter and the binding sequence of the transcription factor, FadR, which is the sensor of the fatty acids. FadE is the acyl-CoA dehydrogenase, which have been proved as performing the rate limiting reaction in the pathway. S-FadE is the counterpart of FadE in the bacteria Samonella. FadD is the acyl-CoA synthase. FadL, a transmembrane protein, is responsible for transporting fatty acids into the bacteria. The control we used was the E.coli expressing galU, a gene responsible for synthesize cellulose.</p>
<img src="https://static.igem.org/mediawiki/2012/8/82/6h.png" width="500" height="400" hspace="2" vspace="1" border="2"  
<img src="https://static.igem.org/mediawiki/2012/8/82/6h.png" width="500" height="400" hspace="2" vspace="1" border="2"  
Line 908: Line 1,164:
<img src="http://partsregistry.org/wiki/images/b/bb/Degradation_according_to_time.jpg" width="500" height="450" hspace="2" vspace="1" border="2" align="left" /><p><i>Fatty acid degradation of bacteria overexpressing each gene in 24h</i></p>
<img src="http://partsregistry.org/wiki/images/b/bb/Degradation_according_to_time.jpg" width="500" height="450" hspace="2" vspace="1" border="2" align="left" /><p><i>Fatty acid degradation of bacteria overexpressing each gene in 24h</i></p>
-
<p align="justify">Based on the measurements of the consumption at given time, it concludes that overexpressing fadL increase the metabolizing ability no matter under the re regulation of J23114 (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861002">BBa_K861002</a>) or our designed promoter, pfadR(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861003">BBa_K861003</a>). The advantage is more obvious when the time expands ( consumption at 18h and 24h) . It’s plausible because more fadL may transport more fatty acids into the bacteria. The increased inner fatty acids concentration is quite favorable. We also notice that the later one’s consumption is lower. It may attributes to the fact that our promoter is weaker than the J23114. If the copy number of fadL is less, its metabolizing rate will be slower. And the fact that the pfadR needs to be induced may also make the time needed to synthesize protein longer, which may make it less competitive. These data opposes to our assumption that overexpressing the rate limiting enzyme fadE ((<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861025">BBa_K861025</a> and (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861026">BBa_K861026</a>) doesn’t have obvious effect. It may because the original level of fadE is enough, thus overexpression is not needed .The strength of the promoter doesn’t affects the rate much, which partially suggests the reason above.</p>
+
<p align="justify">Based on the measurements of the consumption at given time, we concluded that overexpressing FadL increased the metabolizing ability no matter under the regulation of J23114 (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861002">BBa_K861002</a>) or our designed promoter, PfadR(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861003">BBa_K861003</a>). The advantage was more obvious when the time expanded (consumption at 18h and 24h). It's plausible because more fadL may transport more fatty acids into the bacteria. The increased inner fatty acids concentration was quite favorable. We also noticed that the later one's consumption was lower. It may attribute to the fact that our promoter was weaker than the J23114. If the copy number of FadL was less, its metabolizing rate would be slower. And the fact that the PfadR needs to be induced may also make the time needed to synthesize protein longer, which may make it less competitive. These data opposed to our assumption that overexpressing the rate limiting enzyme FadE ((<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861025">BBa_K861025</a> and (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861026">BBa_K861026</a>) wouldn't have obvious effect. It may because the original level of FadE was enough, thus overexpression was not needed. The strength of the promoter didn't affects the rate much, which partially suggested the reason above.</p>
-
<p align="justify">We found that the slope between 12h and 18h and between 18 and 24h are less than the others. It may because the bacteria has entered static status, the amount of bacteria becomes consistent. Also, after the first death phase, they entered log phase again. Since our inoculation is relatively large and the oleate is excessive, the situation that the bacteria has experience two life cycle is possible. A growth curve in the future can test the theory.
+
<p align="justify">We found that the slope between 12h and 18h and between 18 and 24h were less than the others. It may because the bacteria have entered static status, the amount of bacteria became consistent. Also, after the first death phase, they entered logarithmic phase again. Since our inoculation was relatively large and the oleate was excessive, the situation that the bacteria has experience two life cycle was possible. A growth curve in the future can test the theory.
<h4>
<h4>
-
In vitro Experiment
+
<em>In vitro</em> Experiment</h4>
-
</h4>
+
<p align="justify">The <em>in vitro</em> experiment was designed to make up for the limitation of time to test the combination of expressing different genes together (We were short of time assembling the genes together). So we used the cell extracts to do the enzyme assay. The advantage was that we can easily mix the enzyme we want together. Since the purpose of this experiment was to test whether overexpressing multiple genes were superior to a single gene, we set the amount of every gene the same in the combination for simplicity. In the future, we can test more combinations to find the best ratio.</p>
-
<p align="justify">The in vitro experiment was designed to make up for the limitation of time to test the combination of expressing different genes together. (We are short of time assembling the genes together) . So we used the cell extracts to do the enzyme assay. The advantage is that we can easily mix the enzyme we want together. Since the purpose of this experiment is to test whether overexpressing multiple genes are superior to single gene, we set the amount of every gene as the same in the combination to simplify .In the future, we can test more combinations to find the best ratio.</p>
+
        
        
<img src="http://partsregistry.org/wiki/images/8/83/In_vitro.png" width="500" height="400" hspace="2" vspace="1" border="2"  
<img src="http://partsregistry.org/wiki/images/8/83/In_vitro.png" width="500" height="400" hspace="2" vspace="1" border="2"  
Line 919: Line 1,174:
align="left" /> <p><i>Fatty acids remaining after 6 hours of reaction</i></p>       
align="left" /> <p><i>Fatty acids remaining after 6 hours of reaction</i></p>       
-
<p align="justify">The result was that the cell extract of bacteria overexpressing FadE (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861024">BBa_K861024</a>), FadD (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861013">BBa_K861013</a>), S- FadA S- fadB(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861038">BBa_K861038</a>) (a regulon), fadI fadJ(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861037">BBa_K861037</a>) (a regulon) separately all degraded oleate obviously faster than the control. This may be somewhat contrasting to the result of our in vivo assay, in which overexpressing the fadD and fadE did not have obvious results. However, it can be explained. The promoter is not that strong in the in vivo assay, otherwise the growth of the bacteria would be inhibited. However, in the in vitro assay, this consideration was not necessary. Also, the concentration in the final reaction system was quite high by collecting 1L medium, which may improve the metabolizing rate. </p>
+
<p align="justify">The result was that the cell extract of bacteria overexpressing FadE (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861024">BBa_K861024</a>), FadD (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861013">BBa_K861013</a>), S- FadA S- FadB(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861038">BBa_K861038</a>) (a regulon), FadI FadJ(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861037">BBa_K861037</a>) (a regulon) separately all degraded oleate obviously faster than the control. This may be somewhat contrasting to the result of our <em>in vivo</em> assay, in which overexpressing the FadD and FadE did not have obvious results. However, it can be explained. The promoter was not that strong in the <em>in vivo</em> assay, otherwise the growth of the bacteria would be inhibited. However, in the <em>in vitro</em> assay, this consideration was not necessary. Also, the concentration in the final reaction system was quite high by collecting 1L medium, which may improve the metabolizing rate. </p>
-
<p align="justify">It also showed that simultaneously increase the concentration of FadE ,FadD, S- FadA and S- FadB significantly improved the degrading ability .Increasing the doze of the fadI and fadJ on the basis of above did not make any difference , while increasing fadA and fadB may be indispensible because only expressing fadD and fadE is worse than expressing the gene alone. </p>
+
<p align="justify">It also showed that simultaneously increasing the concentration of FadE, FadD, S- FadA and S- FadB significantly improved the degrading ability. Increasing the doze of the FadI and FadJ on the basis of above did not make any difference, while increasing FadA and FadB may be indispensible because only expressing FadD and FadE was worse than expressing the gene alone. </p>
</div>
</div>
<div class="passage divcell4">
<div class="passage divcell4">
-
<h3>Device II: Cellulose Synthesis</h3>
 
<p>
<p>
<iframe width="420" height="315" src="http://www.youtube.com/embed/Sm5NzacV7hA" frameborder="0" allowfullscreen></iframe>
<iframe width="420" height="315" src="http://www.youtube.com/embed/Sm5NzacV7hA" frameborder="0" allowfullscreen></iframe>
</p>
</p>
-
<h4 align="justify">Outline</h4>
+
<p>The above is the video introduction of cellulose synthesis degradation device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTQwNTI0.html">here</a> for the video.</p>
 +
<a name="Outline1"><h3>Outline</h3></a>
<p align="justify">
<p align="justify">
-
Cellulose is an essential material for keeping intestine peristalsis without producing energy, as prebiotics, feeding vegetarian bacteria flora (including Bacteroides, whose appropriate amount has proved important to prevent obesity) of intestine as well. Thus, cellulose help people keep slim and healthy.</p>
+
Cellulose is an essential material for keeping intestine peristalsis without producing energy, as prebiotics, feeding vegetarian bacteria flora (including Bacteroides, whose appropriate amount has proved important to prevent obesity) of intestine as well. Thus, cellulose helps people keep slim and healthy.</p>
<p align="justify">
<p align="justify">
-
The developing device aims at transforming glucose into cellulose, thus producing cellulose as well as reducing energy intake. To achieve this goal, we cloned genes of enzymes responding to cellulose synthesis from the <i>Escherichia coli</i> str. DH5&alpha;, constructing functional expressional elements with these genes respectively downstream of promoter activated by glucose. In this way, cellulose synthetase complex is built artificially under regulation of glucose, repressed under low concentration of glucose and activated under high concentration of glucose.</p>
+
The developing device aims at transforming glucose into cellulose, thus producing cellulose as well as reducing energy intake. To achieve this goal, we cloned genes of enzymes responding to cellulose synthesis from the <i>Escherichia coli</i> str. DH5&alpha;, constructing functional expressional elements with these genes respectively downstream of promoter activated by glucose. In this way, cellulose synthetase complex was built artificially under regulation of glucose, repressed under low concentration of glucose and activated under high concentration of glucose.</p>
<p align="justify">
<p align="justify">
-
In the future, this device can be integrated to the assembled “E. coslim”, activated when excess glucose is sensed in intestine, converting to cellulose.</p>
+
In the future, this device can be integrated to the assembled <em>E. coslim</em>, activated when excess glucose is sensed in intestine, converting it to cellulose.</p>
<p align="justify">
<p align="justify">
-
The same as device I (fatty acid metabolism), on one hand,we divide our work into two parallel sections. “Function” section includes a series of molecular biological manipulation on four genes of the cellulose synthetase complex and another two genes responding to producesubstrates for cellulose synthesis. On the other hand, the design, construction and function tests of glucose-activated promoter belong to “regulation” section.</p>
+
The same as device I (fatty acid degradation), on one hand, we divide our work into two parallel sections.<em> Function</em> section includes a series of molecular biological manipulation on four genes of the cellulose synthetase complex and another two genes responding to produce substrates for cellulose synthesis. On the other hand, the design, construction and function tests of glucose-activated promoter belong to <em>regulation</em> section.</p>
-
<h4 align="justify">
+
<a name="Design1"><h3>
-
Description</h4>
+
Design</h3></a>
<h5 align="justify">Genes to be Cloned</h5>
<h5 align="justify">Genes to be Cloned</h5>
<p align="justify">
<p align="justify">
-
4 genes, bcsA, bcsB, bcsZ and bcsC,from the rdar morphotype bacterium,are involved in cellulose biosynthesis.
+
<img src="http://partsregistry.org/wiki/images/1/14/Cellulose_synthesis_complex.png" width="250" height="400" hspace="2" vspace="1" border="2"
-
<p align="justify">   BcsA is considered to be the catalytic subunit
+
 
-
<p align="justify">  BcsB can be activated the soon it binds to c-di-GMP
+
align="right" />
-
<p align="justify">  BcsZ encodes endo-1,4-D-glucanase which belongs to glycosyl hydrolase family Ⅷ. Activation of BcsZ is required for optimal synthesis and membrane translocation of cellulose
+
4 genes, <em>bcsA</em>, <em>bcsB</em>, <em>bcsZ</em> and <em>bcsC</em>, from the rdar morphotype bacterium, are involved in cellulose biosynthesis.
-
<p align="justify">  Although bcsC is transcribed constitutively, cellulose synthesis occurs only in the circumstances of  AdrA
+
<p align="justify"> BcsA is considered to be the catalytic subunit.
-
<p align="justify">  AdrA ,a diguanylate cyclase (DGC), cyclizestwo GTPs into c-di-GMP. In turn, the activity of cellulose synthase can be increased when binds to c-di-GMP.
+
<p align="justify">BcsB can be activated the soon it binds to c-di-GMP.
-
<p align="justify">  GalU catalyzes the addition of UTP to α-D-glucose 1-phosphate to yield UDP-D-glucose, which is the substrate for cellulose synthase complex
+
<p align="justify">BcsZ encodes endo-1,4-D-glucanase which belongs to glycosyl hydrolase family Ⅷ. Activation of BcsZ is required for optimal synthesis and membrane translocation of cellulose.
-
<p align="justify">  GalF is a predicted subunit of a GalU/GalF protein complex involved in colanic acid building blocks biosynthesis
+
<p align="justify">Although <em>BcsC</em> is transcribed constitutively, cellulose synthesis occurs only in the circumstances of  AdrA.
 +
<p align="justify">AdrA ,a diguanylate cyclase (DGC), cyclizestwo GTPs into c-di-GMP. In turn, the activity of cellulose synthase can be increased when binds to c-di-GMP.
 +
<p align="justify">GalU catalyzes the addition of UTP to α-D-glucose 1-phosphate to yield UDP-D-glucose, which is the substrate for cellulose synthase complex
 +
<p align="justify">GalF is a predicted subunit of a GalU/GalF protein complex involved in colanic acid building blocks biosynthesis
</p>
</p>
-
 
+
<h5 align="justify">Plasmid construct concept</h5>
-
 
+
-
<h5 align="justify">Indirect Regulation Pathway Design</h5>
+
<p align="justify">
<p align="justify">
-
In a cell,  total amount of ATP, ADP and AMP remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.</p>
+
After the indirect regulatory pathway and promoter Pcar being tested to be effective,we can embed the genes which are involved in cellulose synthesis downstream any one of them.So cellulase can only be expressed when glucose concentration is high, and also the expression will increase with glucose concentration. In this way, our E.coslim will have the ability to convert excess glucose into cellulose.
-
 
+
</p>
-
<p align="justify">
+
-
We embed gene <i>cI</i> of lambda phage downstream promoter PcstA (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K118011">BBa_K118011</a>) activated by the binding of CRP, and genes of cellulose synthesis respectively downstream the promoter <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_R0051">BBa_R0051</a> repressed by protein cI. In this way ,we construct an indirect regulation pathway with sensus glucose, transcription activator CRP and transcription repressor cI. If the device works as supposed, cellulose production will be increased following the elevation of glucose concentration, and vice versa. For more information, click <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Indirect Pathway Design">Here</a>.</p>
+
-
 
+
-
<P>
+
-
<img src="https://static.igem.org/mediawiki/2012/3/38/Cellulose_1.png" width="500" height="421" hspace="2" vspace="1" border="2" align="center" /></P>
+
-
 
+
-
<h5 align="justify">Direct Regulation Pathway Design</h5>
+
-
 
+
-
<p align="justify">
+
-
Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we modified a constitutive promoter (<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23119">BBa_J23119</a>) to CRP repressible ones. We have established a new technical standard for our strategy of repressible promoter design (for more information, click on <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Standard">Standard</a>), but we shall focus on the design itself now.</p>
+
-
<p align="justify">We designed promoter Pcar(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861171">BBa_K861171</a>) based on promoter BBa_J23119, inserting CRP-binding site to overlap on six base pairs with promoter -10 region. Since steric hindrance of CRP dimer blocks the function of -10 region, genes downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results show, promoter Pcar works as we expect. For more information, please click <a href="https://2012.igem.org/Team:WHU-China/Project?catalog=2#Pcar">Here</a>.</p>
+
<a name="Progress1"><h3>Progress</h3></a>
-
<p align="left"> <img src="https://static.igem.org/mediawiki/2012/9/9b/Cellulose_2.png" width="382" height="584" hspace="2" vspace="1" border="2" align="middle" /></p>
+
-
<h4 align="justify">Progress</h4>
+
<h5 align="justify">Clone of genes</h5>
<h5 align="justify">Clone of genes</h5>
<p align="justify">
<p align="justify">
-
As for the genes that we cloned, there is no difference between <i>E. Coli</i> str. K12 MG1655 and more available DH5&alpha;.we purified and amplified these genes from genome of <i>Escherichia coli</i> str. DH5&alpha;?using PCR. The primers contain standard restriction enzyme cutting sites. The sequences of the primers used are as below.
+
As for the genes that we cloned, there was no difference between <i>E. Coli</i> str. K12 MG1655 and more available DH5&alpha;. we purified and amplified these genes from genome of <i>Escherichia coli</i> str. DH5&alpha; using PCR. The primers contained standard restriction enzyme cutting sites. The sequences of the primers used are as below.
-
<p align="justify">   bcsA Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG <br/>
+
<p align="justify">   <em>bcsA</em> Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG <br/>
     Sense      CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG
     Sense      CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG
-
<p align="justify">   bcsB Antisense  CCTGCAGTACTAGTATTACTCGTTATCCGGGTTAAGAC <br/>
+
<p align="justify">   <em>bcsB</em> Antisense  CCTGCAGTACTAGTATTACTCGTTATCCGGGTTAAGAC <br/>
     Sense      CGAATTCTTCTAGAGATGAAAAGAAAACTATTCTGGATTTG
     Sense      CGAATTCTTCTAGAGATGAAAAGAAAACTATTCTGGATTTG
-
<p align="justify">   bcsZ Antisense  CCTGCAGTACTAGTATTAGTGTGAATTTGCGCATTCCTGG <br/>
+
<p align="justify">   <em>bcsZ</em> Antisense  CCTGCAGTACTAGTATTAGTGTGAATTTGCGCATTCCTGG <br/>
     Sense      CGAATTCTTCTAGAGATGAATGTGTTGCGTAGTGGAATCG
     Sense      CGAATTCTTCTAGAGATGAATGTGTTGCGTAGTGGAATCG
-
<p align="justify">   bcsC Antisense  CCTGCAGTACTAGTATTACCAGTCGGCGTAAGGTATCA <br/>
+
<p align="justify">   <em>bcsC</em> Antisense  CCTGCAGTACTAGTATTACCAGTCGGCGTAAGGTATCA <br/>
     Sense      CGAATTCTTCTAGAGATGCGCAAATTCACACTAAACATATTC
     Sense      CGAATTCTTCTAGAGATGCGCAAATTCACACTAAACATATTC
-
<p align="justify">   galF Antisense  CCTGCAGTACTAGTATTATTCGCTTAACAGCTTCTCG <br/>
+
<p align="justify">   <em>galF</em> Antisense  CCTGCAGTACTAGTATTATTCGCTTAACAGCTTCTCG <br/>
     Sense      CGAATTCTTCTAGAGATGACGAATTTAAAAGCAGTTATACC
     Sense      CGAATTCTTCTAGAGATGACGAATTTAAAAGCAGTTATACC
-
<p align="justify">   galU Antisense  CCTGCAGTACTAGTATTACTTCTTAATGCCCATCTCTTCT <br/>
+
<p align="justify">   <em>galU</em> Antisense  CCTGCAGTACTAGTATTACTTCTTAATGCCCATCTCTTCT <br/>
     Sense      CGAATTCTTCTAGAGATGGCTGCCATTAATACGAAAG
     Sense      CGAATTCTTCTAGAGATGGCTGCCATTAATACGAAAG
Line 1,019: Line 1,263:
<p align="justify">
<p align="justify">
-
All new composite parts mentioned above were transformed to competent cells of <i>Escherichia coli</i> str. DH5&alpha;. All positive clones are validated using PCR, restriction enzyme digestion and DNA sequencing.</p>
+
All new composite parts mentioned above were transformed to competent cells of <i>Escherichia coli</i> str. DH5&alpha;. All positive clones were validated using PCR, restriction enzyme digestion and DNA sequencing.</p>
<h5 align="justify">Detection of Cellulose Synthesis</h5>
<h5 align="justify">Detection of Cellulose Synthesis</h5>
<p align="justify">
<p align="justify">
-
To detect the cellulose synthesis, we used cellulase to degrade cellulose in the cell culture. Then total reducing sugar in the culture was measured. So the difference of total reducing sugar between culture before and after treated with cellulase represents the total cellulose synthetised by the cell. For detailed information, please click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=2">Here</a>.</p>
+
To detect the cellulose synthesis, we used cellulase to degrade cellulose in the cell culture. Then total reducing sugar in the culture was measured. So the difference of total reducing sugar between culture before and after treated with cellulase represented the total cellulose synthesized by the cell. For detailed information, please click <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=3#Cellulose Detection">Here</a>.</p>
-
<h4 align="justify">Results</h4>
+
<a name="Results1"><h3>Results</h3></a>
<h5 align="justify">
<h5 align="justify">
Clone of genes</h5>
Clone of genes</h5>
<p align="justify">
<p align="justify">
-
The gene <i>bcsA</i> is 2619bp, <i>bcsB</i> is 2340bp, <i>bcsZ</i> is 1107 bp, <i>bcsC</i> is 3474bp, <i>galU</i> is 909bp and <i>galF</i> is 894 bp. After PCR amplification, DNA fragments were examined by agarose gel electrophoresis.All genes proved correct. Then the genes were digested with restriction enzymes and embedded into plasmid backbone pSB1A2. To confirm the accuracy of sequences, positive clones were sent for sequencing after transformation. And the results showed that no mutation existed in genes.</p>
+
The gene <i>bcsA</i> is 2619bp, <i>bcsB</i> is 2340bp, <i>bcsZ</i> is 1107 bp, <i>bcsC</i> is 3474bp, <i>galU</i> is 909bp and <i>galF</i> is 894 bp. After PCR amplification, DNA fragments were examined by agarose gel electrophoresis. All genes proved to be correct. Then the genes were digested with restriction enzymes and embedded into plasmid backbone pSB1A2. To confirm the accuracy of sequences, positive clones were sent for sequencing after transformation. And the results showed that no mutation existed in genes.</p>
<P align="center">
<P align="center">
Line 1,037: Line 1,281:
<h5 align="justify">Detection of Cellulose Synthesis</h5>
<h5 align="justify">Detection of Cellulose Synthesis</h5>
-
<p align="justify">After treating with cellulase, total reducing sugar in supernatant and deposits was measured by methods described in our protocol. Color in the tubes <br />
+
<p align="justify">After treating with cellulase, total reducing sugar in supernatant and deposits were measured by methods described in our protocol. Colors in the tubes <br />
-
become darker  meaned that reducing sugar increased with time. Amount of reducing sugar was calculated according to standard curve of glucose.</p>
+
becoming darker  meant that reducing sugar increased with time. Amount of reducing sugar was calculated according to standard curve of glucose.</p>
<p align="justify">The formula of standard curve is as bellow:</p>
<p align="justify">The formula of standard curve is as bellow:</p>
<p align="justify"><i>y</i>=1.3795<i>x</i>+0.0373</p>
<p align="justify"><i>y</i>=1.3795<i>x</i>+0.0373</p>
-
<p align="justify">In our experiment, cells that expressed protein which was nothing to with cellulose synthesis was used as a control. Cellulose output in both supernatant and deposit were show in the following figure. The cellulose production in <em>AdrA</em>+<em>BcsA</em> is more than 0.6 mg/mL, which is almost two times higher than that of control.</p>
+
 
 +
<p align="justify">In our experiment, cells that expressed protein which has nothing to do with cellulose synthesis was used as a control.We transformed the seven genes involved in cellulose synthesis into <em>E.coli</em> and measured cellulose production with method mentioned above. In the step of measuring total cellulose production, excessive cellulase was appended and incubated at 50 ℃ for 1 hour, and results showed that some of the seven genes help increase the ability of cellulose synthesis.</p>
 +
<p align="center"><img src="https://static.igem.org/mediawiki/2012/a/a7/CELLULOSE_PRODUCTION.tif" alt="" name="CelluloseFig1" width="520" height="412" align="middle" id="CelluloseFig1" /></p>
 +
 
 +
<p align="justify">In addition,AdrA is responsible for the production of a small molecule,c-di-GMP, which is known as an activator of cellulase. So we co-overexpress adrA with bcsA. Cellulose output in both supernatant and deposit were showed in the following figure. The cellulose production in <em>adrA</em>+<em>bcsA</em> was more than 0.6 mg/mL, which was almost two times higher than that of control.</p>
 +
 
<p align="center"><img src="https://static.igem.org/mediawiki/igem.org/f/ff/Cellulose_Fig_1.jpg" alt="" name="CelluloseFig1" width="520" height="1247" align="middle" id="CelluloseFig1" /></p>
<p align="center"><img src="https://static.igem.org/mediawiki/igem.org/f/ff/Cellulose_Fig_1.jpg" alt="" name="CelluloseFig1" width="520" height="1247" align="middle" id="CelluloseFig1" /></p>
-
<p align="center">&nbsp;</p>
+
 
-
<p align="justify">The expression of <em>AdrA</em> and <em>BcsA</em> could improve the yield of cellulose. Then what is the effect of each gene on cellulose synthesis? We transformed the seven genes involved in cellulose synthesis into <em>E.coli</em> and meaaured cellulose production. In the step of measuring total cellulose production, exceed cellulase was appended and incubated at 50 ℃ for 1 hour, and results show that all these genes help increase the ability of cellulose synthesis.</p>
+
<p align="justify">&nbsp;</p>
<p align="justify">&nbsp;</p>
-
<p align="center"><img src="https://static.igem.org/mediawiki/igem.org/2/23/Cellulose_Fig_2.png" alt="" name="CelluloseFig2" width="506" height="440" align="middle" id="CelluloseFig2" /></p>
+
 
-
<h4 align="justify"><strong>Disscusion</strong></h4>
+
 
-
<p align="justify">In our expriment, results show that cellulose yield in <em>AdrA</em>+<em>BcsA</em> is much less than that of the single gene. It was because that cellulase amount and reaction time were both less than the latter one.</p>
+
<a name="Discussion1"><h3><strong>Disscusion</strong></h3></a>
-
<p align="justify">Actually, BcsB can be activated by c-di-GMP. But till now the deadline, we have not successfully assembled <em>Pcar</em> and <em>BcsB</em>. In the following work, we are going to assemble a plasmid including all of the seven genes. Maybe in this way, cellulose production will increase greatly.</p>
+
<p align="justify">In our experiment, results showed that cellulose yield in <em>adrA</em>+<em>bcsA</em> was higher than that of the single gene. So it indicated that the co-expression of some genes would increase cellulose production. In the next stage, we will try more combination of these genes and find the most efficient one</p>
-
<p align="justify">Other than application in the project of &quot;<em>E.coslim</em>&quot;, the cellulose device can also be used in many other fields, such as papermaking industry, biomedical materials, audio equipment and so on.</p>
+
<p align="justify">Actually, BcsB can be activated by c-di-GMP. But till the deadline, we have not successfully assembled Pcar and <em>bcsB</em>. In the following work, we are going to assemble a plasmid including all of the seven genes. Maybe in this way, cellulose production will increase greatly.</p>
 +
<p align="justify">Other than application in the project of <em>E.coslim</em>, the cellulose device can also be used in many other fields, such as papermaking industry, biomedical materials, audio equipment and so on.</p>
</div>
</div>
<div class="passage divcell5">
<div class="passage divcell5">
-
<h3>Colonization</h3></a>
 
<p>
<p>
<iframe width="420" height="315" src="http://www.youtube.com/embed/5GHyA3mUgaM" frameborder="0" allowfullscreen></iframe>
<iframe width="420" height="315" src="http://www.youtube.com/embed/5GHyA3mUgaM" frameborder="0" allowfullscreen></iframe>
</p>
</p>
 +
<p>The above is the video introduction of colonization device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTQwNDc2.html">here</a> for the video</p>
Line 1,076: Line 1,325:
</h3></a>
</h3></a>
<p align="justify">
<p align="justify">
-
We tested the function of AdrA gene by plate assay. Formore details, please visit our protocol page.
+
We tested the function of AdrA gene by plate assay. Formore details, please visit our protocol: <a href="https://2012.igem.org/Team:WHU-China/Notebooks?catalog=3#Plate Assay">Plate Assay</a>.
</p>
</p>
<a name="Results2"><h3>
<a name="Results2"><h3>
Line 1,082: Line 1,331:
</h3></a>
</h3></a>
<p><img src="http://partsregistry.org/wiki/images/e/e7/AdrA.jpg" width="500" height="620" hspace="2" vspace="1" border="2" align="top" /></p></br>
<p><img src="http://partsregistry.org/wiki/images/e/e7/AdrA.jpg" width="500" height="620" hspace="2" vspace="1" border="2" align="top" /></p></br>
-
<p align="justify">As can be seen from the plate. Clone with AdrA constitutively expressed using <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23107">BBa_J23107</a> is much more smaller compared to the control that only contain <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">the plasmids of RBS</a>, though the amount of bacteria is similar. This result showed that the AdrA was successfully expressed, elevating c-di-GMP level, leading to the increase expression of adhesins and inhibition of motility.</p>
+
<p align="justify">As can be seen from the plate. Clone with AdrA constitutively expressed using <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_J23107">BBa_J23107</a> was much more smaller compared to the control that only contain <a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_B0030">the plasmids of RBS</a>, though the amount of bacteria was similar. This result showed that the AdrA was successfully expressed, elevating c-di-GMP level, leading to the increase expression of adhesins and inhibition of motility.</p>
 +
</div>
<div class="passage divcell6">
<div class="passage divcell6">
-
<h3>Death Device</h3>
 
-
<h4> Outline</h4>
 
<p>
<p>
-
We plan to place endonuclease and YhjH gene downstream the xylR repressed promoter to make bacteria die and lose their adhesion when exposed to xylose.
+
<iframe width="420" height="315" src="http://youtu.be/BpK0gitnaFU" frameborder="0" allowfullscreen></iframe>
 +
</p>
 +
<p>The above is the video introduction of death device. For Chinese mainland visitor, please visit <a href="http://v.youku.com/v_show/id_XNDY2MTQwNDIw.html">here</a> for the video</p>
 +
<a name="Outline4"><h3> Outline </h3></a>
 +
<p align="justify">
 +
We plan to place endonuclease and YhjH gene downstream the xylR repressed promoter<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861200"> (BBa_K861200)</a> to make bacteria die and lose their adhesion when exposed to xylose.
</p>
</p>
-
<h4> Description </h4>
+
<a name="Description"><h3>Description</h3></a>
-
<p>
+
<p align="justify">
-
<img src="https://static.igem.org/mediawiki/2012/c/c3/Death.png" width="410.67" height="264" hspace="2" vspace="1" border="2"  
+
<img src="https://static.igem.org/mediawiki/2012/c/c3/Death.png" width="500" height="300" hspace="2" vspace="1" border="2"  
-
style="float:left" />
+
style="float:left" /></p>
-
In order to terminate the overreaction of fatty acid metabolism and cellulose synthesis, we design an elaborate device. Firstly, we determined to use endonuclease YhjH responsible for c-di-GMP degradation to counteract the impact of AdrA and BglII(BBa_K112106), a protein that can kill the microbe without inducing cell lysis. Since AdrA but not YhjH contains this restriction site, our E.coslim will lose their adhesion more easily. To control the expression of endonuclease and YhjH, a regulator is  
+
 
 +
<p align="justify">
 +
In order to terminate the overreaction of fatty acids degradation and cellulose synthesis, we designed a death device. Firstly, we determined to use endonuclease YhjH<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K861090"> (BBa_K861090)</a> responsible for c-di-GMP degradation to counteract the impact of AdrA and BglII(<a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_K112106"> (BBa_K112106)</a>), a protein that can kill the microbe without inducing cell lysis. Since AdrA but not YhjH contains this restriction site, our E.coslim will lose their adhesion more easily. To control the expression of endonuclease and YhjH, a regulator is  
necessary. We selected xylose as the inducer because this monomer hardly exists in nature, so the GMOs will not be killed under natural condition. Also, it is healthy and hard to be absorbed by human beings so the concentration of xylose in the gut can keep high for a long time. We are planning to device another synthetic promoter repressed by XylR from <i>B.subtilis</i>. We hope that eating xylose will  
necessary. We selected xylose as the inducer because this monomer hardly exists in nature, so the GMOs will not be killed under natural condition. Also, it is healthy and hard to be absorbed by human beings so the concentration of xylose in the gut can keep high for a long time. We are planning to device another synthetic promoter repressed by XylR from <i>B.subtilis</i>. We hope that eating xylose will  
-
subsequently derepress the expression of endonuclease and YhjH, ending up with the loss of adhesion and the death of our E.coslim.
+
subsequently derepress the expression of endonuclease and YhjH, ending up with the loss of adhesion and the death of our E.coslim, therefore efficiently terminate the process of lossing weight. For more information and for a brief introduction of our two-capsule design, please visit our <a href="https://2012.igem.org/Team:WHU-China/Modeling?catalog=0">Future Perspective </a>.
</p>
</p>
</br></br>
</br></br>
-
<h4> Forestalling HGT </h4>
+
<a name="Prevention of HGT"><h3> Prevention of HGT </h3></a>
-
<p>
+
<p align="justify">
In human gut, there are billions of microbes. Horizontal gene transfer of those high efficient metabolic genes between GMOs  
In human gut, there are billions of microbes. Horizontal gene transfer of those high efficient metabolic genes between GMOs  
Line 1,113: Line 1,368:
is highly necessary.
is highly necessary.
-
To prevent horizontal gene transfer, we designed a two-plasmids system. In one plasmid, xlyR repressor encoding gene from  
+
To prevent horizontal gene transfer, we designed a two-plasmids system. In one plasmid, xlyR repressor encoding gene<a href="http://partsregistry.org/wiki/index.php/Part:BBa_K143036"> (BBa_K143036)</a>  from  
<i>Bacillus subtilis</i> will be assembled with constitutively expressed promoter. On the other plasmid, metabolic gene will be coupled with xylR repressed death system. In  
<i>Bacillus subtilis</i> will be assembled with constitutively expressed promoter. On the other plasmid, metabolic gene will be coupled with xylR repressed death system. In  
Line 1,123: Line 1,378:
be killed.
be killed.
</p>
</p>
 +
 +
</div>
</div>
</div>
<em class="clear">
<em class="clear">
-
  </em>
+
  </em>
-
</div>
+
  </div>
<div class="footer">
<div class="footer">
</div>
</div>
-
</div>
+
</div>
<script src="http://www.yichengliu.com/code/igem/project.js">
<script src="http://www.yichengliu.com/code/igem/project.js">
</script>
</script>
</body>
</body>
</html>
</html>

Latest revision as of 04:04, 27 October 2012

Project Description

The above figure is the overview of our design

Utilizing human microbiota to tackle diseases has long been the keen desire of scientists. This year, we WHU-China team engineered a kind of probiotics "E. coslim" from Escherichia coli, hoping to provide a new approach for treating obesity. Specifically, three genetic devices were designed to help people lose weight. The first two devices were assembled to metabolize the excessive energy in human intesinte. To achieve this goal, promoters activated by high concentration of glucose and fatty acids were devised and synthesized respectively. When functional genes were placed downstream of these promoters appropriately, the first two devices were supposed to degrade fatty acids and convert glucose into cellulose respectively, thus preventing excessive calorie intake as well as producing prebiotics. Meanwhile, the third device was designed to regulate human gut microbiota. Also, xylose inducing death device was planned to terminate the effects of "E.coslim" at will to prevent horizontal gene transfer and control the density of "E. coslim" in future applications. As a whole, we are developing "E. coslim" to metabolize the excessive energy and regulate the microbiome composition in intestine to control obesity.

Obesity: a severe global problem

Obesity refers to a health condition that body fat is accumulated to some extent. According to WHO, body mass index (BMI) is an index of weight-for-height that is commonly used to classify obesity in adults. It is a risk factor for various diseases, such as cardiovascular diseases (mainly heart disease and stroke), type 2 diabetes, musculoskeletal disorders (especially osteoarthritis), some cancers (endometrial, breast, and colon).



As it is shown in figure 1 and 2, a large amount of people from all over the world are overweight in both developed and developing countries and it is and will become more and more severe.



Figure 1(from reference [4]): Past and projected prevalence of overweight (BMI ≥25 kg/m2)

Figure 2: Prevalence of obesity in different countries.
(Picture from The Wellington Grey blog)

The Cause of Obesity

Obesity is most commonly caused by a combination of different factors such as excessive food energy intake, lack of physical activity, and genetic susceptibility, although a few cases are caused primarily by genes, endocrine disorders, medications or psychiatric illness.

However, the problem of obesity emerged globally only several decades ago. Since the change of genome of a species requires a long time, the outbreak of obesity is unlikely to be caused by changes in human genome. For most individuals, controlling food intake and doing physical activity in a proper way are effective strategies to lose weight. But for some people whose health condition or current life pace keep them away from systemic and regular exercise and diet, modulating the composition of microorganisms in intestine might act as an alternative.

Reports by Gordon have shown that, apart from human genome, the collective genome of microorganisms (microbiome) in human intestine is associated with our obesity [1]. Furthermore, microbiome is able to be changed through control of food intake [1].

Two groups of beneficial bacteria are dominant in the human gut, the Bacteroidetes and the Firmicutes. The relative proportion of Firmicutes increases in obese people by comparison with lean people [2].

Figure 3: How excess of energy contributes to obesity

Pertinent study by Gordon attested their initial hypothesis that changes in microbial component have a causal relationship with obesity, thus might have potential therapeutic implications [2] [3]. Colonization of germ-free mice with an ‘obese microbiota’ results in a significantly greater increase in total body fat than colonization with a ‘lean microbiota’ [3].
Figure from reference [3]


Present strategies to lose weight

Diet, exercise, drug and surgery are major ways to lose weight. However, they all have many drawbacks. Diet may cause nutritional imbalance and can be a heavy mental burden since the people may not be able to enjoy the food they want. Exercise requires regular time and is ineffective in many cases. Drugs and surgery may have many side effects and are many times more costly.

Our idea

Previous situations and insights construct our theoretical fundament. We tried to utilize synthetic biology to provide a cheap, convenient, effective and safe approach for treating obesity. Instead of passive alternation of microbiota, we tried to construct an engineered E.coli----- E.coslim to positively change microbiota in intestine. As Figure 3 shown, we place E.coslim in the role of sensing and consuming excessive energy, which thus leads to the double effects: lowering the proportion of Firmicutes and increasing that of Bacteroidetes, and decreasing the energy available in one’s intestine.

To achieve these two goals, we designed four devices, fatty acids consumption, cellulose synthesis, colonization and death device of E.coslim.

References


[1] Ruth E. Ley1, Peter J. Turnbaugh1, Samuel Klein1 & Jeffrey I. Gordon1 Microbial ecology: Human gut microbes associated with obesity. Nature 444, 1022-1023 (21 December 2006)
[2] Peter J. Turnbaugh1, Ruth E. Ley1, Michael A. Mahowald1, Vincent Magrini2, Elaine R. Mardis1,2 & Jeffrey I. Gordon1 An obesity-associated gut microbiome with increased capacity for energy harvest. Vol 444|21/28 December 2006| doi: 10.1038/nature05414
[3] Ley RE. Obesity and the human microbiome. Curr Opin Gastroenterol. 2010 Jan; 26(1):5-11.
[4] Y Claire Wang et.al. Health and economic burden of the projected obesity trends in the USA and the UK. Lancet. 2011

Introduction

To metabolize the excessive energy, fatty acids and sugar should be the primary targets for our E.coslim to help people lose weight. For E.coslim to degrade fatty acids and convert glucose into cellulose, they must be able to sense and get regulated by high concentration of glucose and fatty acids. Otherwise, the system may not only be inefficient but also may cause serious problems. However, there is no promoter available in nature that can be solely regulated by glucose or fatty acids. Therefore, to achieve our goals, we designed an indirect pathway and a direct synthetic promoter to sense and be regulated by glucose concentration. Also another synthetic promoter was designed to sense and be regulated by fatty acids.

Indirect Pathway Design

In a cell, the total amount of ATP, ADP and AMP molecules remains constant. Low glucose concentration results in high activity of adenylate cyclase converting ATP into cAMP, who binds to and converts cAMP receptor protein (abbreviated as CRP) to DNA-binding configuration. Conversely, when glucose concentration gets high, more ATP and less cAMP will be produced, resulting in low DNA-binding activity of CRP.

We embeded gene cI of lambda phage(BBa_P0451) downstream promoter PcstA (BBa_K118011), which can be activated by the binding of CRP, and genes of red fluorescence protein(RFP, BBa_I13507) respectively downstream the promoter BBa_R0051 repressed by protein cI. In this way we constructed an indirect regulation pathway with glucose sensors, transcription activator CRP and transcription repressor cI. If the device works as design, output of RFP will increase following the elevation of glucose concentration, and vice versa.

The indirect regulatory pathway

Method

Construction of plasmid for indirect regulation pathway

In this experiment, RFP reported the function of the indirect regulation pathway.

BBa_K861173: BBa_I13507, an mRFP generator with RBS and terminator, was embedded after CRP activated promoter BBa_K118011.

BBa_K861172: BBa_P0451, a cI generator with RBS and terminator, was embedded after promoter BBa_K118011 activated by CRP.

BBa_K861169: BBa_K861172 and BBa_I763007, a cI repressed RFP generator, were assembled .

BBa_K861174: BBa_K137115, constitutively expressing cI generator with promoter, RBS and terminator, was assembled to BBa_I763007

All new composite parts mentioned above were transformed to competent cells of Escherichia coli str. DH5a. All positive clones were validated using PCR, restriction enzyme digestion and DNA sequencing.

Cell culture fluorescence measurement

Minimal medium with different concentrations of glucose(1mM, 4mM, 10 mM , 20 mM , 50 mM ,100 mM) was transferred into a 96-well plate, 200 μL for each well. Then each well was inoculated with 2 μL of seed liquor which was activated overnight in M9 minimal medium with 50mM glucose at 37℃. The wells without inoculation were regarded as blank controls to revise the results. Under each condition, three parallel samples were set. The plate was incubated at 37℃, 150rpm. Cell culture fluorescence was recorded on a SpectraMax M2 plate reader (Molecular Devices). Excitation at 584 nm and emission at 607 nm were used. All fluorescence results were normalized with cell density by measuring the absorbance at 600 nm.

Capturing fluorescence image

Cell morphology was observed through fluorescence microscope, and the images of bacteria with different glucose concentrations were captured.

Fluorescence analysis of cyto-imaging

A program named FANCY was designed to recognize single cell and calculate the fluorescence strength according to the images. For more information, please click Here.

Results

Purified plasmids constructed before were digested with XbaI and PstI for confirmation. The agarose gel electrophoresis showed that the lengths were correct. At last, the plasmids were sent for sequencing. Results showed no mutation.

The result for fluorescence measurement of indirect device

In the cell culture fluorescence measurement experiment, fluorescence of BBa_K861173 decreased coordinating with glucose concentration, while BBa_K861169 increased. The fluorescence of BBa_K861174 was too low to record, so we do not show it here. All of the results coincided with expected results indicating that we have successfully constructed the promoter which was activated by high concentration of glucose.

The fluorescence image of indirect device in different concentration of glucose

Fluorescence images indicated that all cells were growing normally, because the size and morphology were both the same as that of the cells in LB medium. The fluorescence of the cells in the images showed the same discipline as results from the fluorescence measurement experiments.
The results of FANCY are showed as bellow, fluorescence intensity of PcstA+cI+RFP increased with the glucose concentration, while that of the PcstA+RFP decreased with glucose concentration. It conformed well with the results that showed above.

The fluorescence intensity of indirect device from program FANCY

 

Discussion
All results of the three experiments indicated the device worked as expected. Next, RFP will be replaced with genes of cellulose synthesis. So the excess glucose can be transformed into cellulose.
Although the indirect regulation pathway was tested effective,it worked through an intermediate product, protein cI. This determines that the device will be less sensitive to glucose than a direct regulation pathway without intermediate.

 

Direct Regulatory Promoter Design

1. Glucose sensor

To turn CRP into a repressor, we firstly consulted papers about CRP binding site and found out that 22-bp palindromic consensus site of the sequence AAATGTGATCT*AGATCACATTT. Unfortunately, this consensus sequence contained XbaI restriction site. We then designed the binding site by changing the most frequent bases in the binding site into second most frequent bases. Specifically, two binding sites were designed: AAATGTGATTTAAATCACATTT, AAATGTGATTATAATCACATTT.

Firstly, to construct a promoter that can be directly repressed by CRP, we inserted modified CRP binding site between -35 and -10 region of promoter BBa_ J23110 (TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGC). However, it did not work out as we expected. In our reporter assay, this promoter failed to express higher level of RFP when bacteria grew in M9 medium with higher glucose concentration.

Then, we tried a different strategy. We designed another promoter overlapping with CRP binding site to satisfy the sequence of -10 region of the promoter (TTGACAGCTAGCTCAAATGTGATTTAAATCACATTT). The promoter also failed to show the desired function, the expression of RFP showed that the promoter was unstable.

Finally, we designed a promoter with modified CRP binding site overlapping with the -10 region of the promoter. To satisfy better CRP binding, we firstly changed the sequence in -10 region to meet the CRP consensus sequence (TTGACAGCTAGCTCAAATGTGATTATAATCACATTT). We named it Pcar, which was short for Promoter of CRP As a Repressor . This time, Pcar showed exciting properties as we expected.

The above figure shows the design of the Pcar

2. Fatty acids sensor

In fact, fatty acids sensor had already been tried by iGEM2006_Tokyo_Alliance (BBa_J54220).Yet their design failed to give desirable function.
To design a promoter that is under the sole regulation of fatty acids concentration, double FadR binding sites in promoter of FadL were placed and overlapping with the downstream of constitutive promoter J23110 (TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCTATACTCTCGCC ACTGGTCTGATTTCTAAGA). We named the promoter PfadR. Also, we planned to overexpress FadR to prevent leaky expression of the promoter.

The above figure shows the design of the PfadR

Pcar

Although the indirect regulation pathway was tested effective, we went on attempting a more compact and widely useful direct regulation design. Hence we altered a constitutive promoter (BBa_J23119) into a CRP repressible one. We also established a new technical standard for our strategy of repressible promoter design (for more information, click on Standard), but we shall focus on the design itself now.

We designed promoter Pcar based on promoter BBa_J23119, inserting CRP-binding site and overlaping it with six base pairs in the -10 region of promoter. Since steric hindrance of CRP dimer blocks the function of -10 region, gene downstream will be repressed when glucose concentration is low. That is, most CRP appears in DNA-binding configuration. The repressive effect is undermined when glucose concentration increases. Accordingly, we changed CRP from an activator to a repressor, simplifying the device with potential advantages of higher sensibility and efficiency. As experimental results showed, promoter Pcar worked as we expected.

 

The direct regulatory pathway

Methods

Design of the promoter Pcar which is activated by glucose

Promoter Pcar, glucose biosensor plasmid, is derived from a constitutive promoter (BBa_J23119) by adding a CRP binding site upstream the promoter where has several base pairs overlapping with RNA polymerase binding site. The sequence was synthesized with restriction enzyme cutting site for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. The sequence of promoter Pcar had cohesive terminus at both ends, so it was very convenient for us to construct the plasmid for functional detection.The sequence of Pcar is as followed:

The design concept of promoter Pcar

Construction of plasmid for direct regulation pathway

In this experiment, RFP reported the function of the indirect regulation pathway.

BBa_K861179: BBa_I13507, an mRFP generator with RBS and terminator was embedded downstream the constitutive promoter BBa_J23119

BBa_K861176: BBa_I13507 was embedded downstream the artificial promoter Pcar.

BBa_K861178: a constitutive expressed CRP(BBa_J23116+BBa_K861161) was assembled with K861176.

All new composite parts mentioned above were transformed to competent cells of Escherichia coli str. DH5a. All positive clones were validated using PCR, restriction enzyme digestion and DNA sequencing.

Functional detection

The same methods with that of the indirect regulation pathway were used to confirm that the promoter worked as expected. For details, please click Here.

Results

Construction of the plasmid for functional detection

The sizes of the Promoters Pcar and J23119 are less than 100 bp. And they were proved to be correct by agarose gel electrophoresis. Restriction Digestion of the plasmid BBa_I13507 only have one lad on the agarose gel, it told that the plasmid was digested well. After transformation, competent cells were cultured on agar plate with 50 μg/L of ampicillin. Both red and white bacterial colonies emerged on one plate. The red ones were the correct clones revealing promoter embedded successfully, while the white ones were negative. The red clones were picked out and cultured in LB medium for plasmid extraction. Purified plasmids were digested with XbaI and PstI for confirmation. The bands of 2000bp and 1000bp showed that the promoter had been embedded successfully. At last, the plasmids we acquired were sent for sequencing, and the result showed no mutation existed.

The agarose gel for digestion comfirmation

Cell culture fluorescence measurement.

The correct clones were cultured in 96-well plate at 37℃ for 24 hours, then the fluorescence and absorbance at 600 nm were recorded on a SpectraMax M2 plate reader. All fluorescence results were normalized with absorbance at 600 nm. The results represented the fluorescence of every well.
The fluorescence of K861179 was about 10000 Relative Light Units. It did not vary with concentrations of glucose. However we found a positive correlation between the fluorescence of K861176 and concentration of glucose. At a glucose concentration lower than 4mM, the fluorescence was very low, but at high concentration of glucose like 100mM, the fluorescence was much less than that of K861179.

The result of promoter Pcar from fluorescence measurement

Capturing of the fluorescence image

Fluorescence images indicated that all the cells were growing normally, because the size and morphology were both the same with cells in LB medium. The fluorescence of the cells in the images showed the same discipline with results from the fluorescence measurement experiments. Fluorescence of K861179 was very strong but it didn't change with the glucose concentration. On the contrary, fluorescence of K861176 was relatively weak but increased with concentration of glucose.

Fluorescence images of Pcar and J23119 in different glucose concentration

Fluorescent analysis of cyto-imaging

The results of FANCY are showed as bellow, single cell was recognized from fluorescence images and fluorescence intensity was calculated. In the table, data showed that RFP expression was activated in high glucose concentration, which conformed well with results above.For more information about FANCY,click Here.

Fluorescent intensity of Pcar from program FANCY

 

Discussion

The promoter Pcar is a promoter designed for the Escherichia coli and it is derived from a constitutive promoter BBa_J23119. Pcar includes the CRP-binding site and the RNA polymerase-binding site which overlap each other several base pairs. Therefore, because of the steric hindrance between CRP and RNA polymerase, gene downstream of the promoter will be repressed at high concentration of CRP. In the cells, low glucose concentration results in increasing activity by adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound form, is able to bind tightly to the specific DNA site in the promoter and to repress the gene downstream. On the contrary, high glucose concentration will result in the activation of the promoter.

 

PfadR

Outline

The design of Pcar had sparkled the design of PfadR. In nature, beta oxidation needs these five genes, and is regulated by many factors besides fatty acids concentration. Therefore, there is no promoter that can meet our demand to be solely regulated by fatty acids. Therefore, we tried to develop a synthetic promoter that would be regulated solely by fatty acids. We found that the last 3 base pairs of constitutive promoter BBa_J23110 are the same as the first three base pairs of FadR binding site of FadL. Therefore, we thought that maybe by preventing the initiation of transcription, we can achieve our goal.

Design of the Promoter PfadR Repressed by Fatty Acids

Promoter PfadR, is derived from BBa_J23110. Specifically, FadR binding site of FadL gene was placed overlapping with the last 3 base pairs of BBa_J23110. The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. We used overlapping PCR to get the double strand DNA. The sequence design of PfadR is as followed:

Forward: GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT

Reverse: GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT


Procedures

For M9 medium using oleic acids as sole carbon source, oleic acids was first emulsified 10% Triton X-100. M9 medium was then slowly added with constant vortex. M9 medium with high concentration of oleic acids was diluted by M9 medium with triton to form various concentrations.

For M9 medium using glucose as sole carbon source, M9 medium with high concentration of glucose was diluted by M9 medium to form various concentrations.

After 24h of incubation in 24 well plates in 37°C, bacteria culture was centrifuged at 3000rmp for 5min, washed and resuspended in PBS. We detected the OD600 and fluorescence of using SpectraMax M2 plate reader (Molecular Devices) .Excitation at 584 nm and emission at 607 nm were used. All fluorescence was normalized with cell density by measuring the absorbance at 600 nm.

Result

Normalized using Fluorescence/0D600

Blue: Constitutive promoter J23110

Red: PfadR

Glucose Concentration gradient: 0.5, 1, 5, 10 mM

Fatty acid Concentration gradient: 0.025, 0.05, 0.1, 0.25, 0.5, 1, 1.5 mM

PfadR and BBa_J23110 promoter strength at different glucose and fatty acids concentration

As shown from the results, the promoter showed about 3 times induction from glucose to 1.5umol/L fatty acids medium and the fluorescence of PfadR was about one sixth of BBa_J23110. This may because the tandem FadR binding site had made it more difficult for Polymerase to start gene transcription. Also, in medium that used glucose as sole carbon source, PfadR seemed to be leaky. However, since our bacteria was wild type E.coli, Fab genes was not mutated, meaning that bacteria can synthesis fatty acids. Therefore, there may be a basal level fatty acids concentration inside the cell, making the transcription not being totally repressed.

It should also be noticed that, from fatty acids concentration 0.025umol/L to 1.5umol/L, the induction was not very obvious. For fatty acids concentration F0.25, 0.5 and 1, it seemed to have similar fluorescence strength. The promoter was not sensitive enough. To further improve the function of PfadR, we are planning to modify the sequence of FadR binding sites to make FadR overlap more willing promoter region. Also, we will try to overexpressed FadR protein to see its effects on PfadR.

 

Standard

To address the problem of sensing substrates in our metabolic devices, we have developed a few promoters following the strategy of modifying unconserved regions to protein binding sites. As steric hindrance can stop RNA polymerase as well as other transcription factors from correctly binding and functioning, the binding protein become the repressor of our synthetic promoters.

For different promoters, the details of modification come in different ways. For instance, the PfadR (BBa_J861060) was modified downstream -10 region, while Pcar (BBa_J861171) was modified between -35 and -10 region. Indeed we have tried some other modifications (for more information, click on design of promoters) but without desirable functions and we still do not know why. However, all modifications aimed at the same goal, to introduce overlapping sequences between binding site of the designed repressor and the promoter.

To test the function of these promoters, we used fluorescence measurements. First, both the modified promoter and the unmodified one (as control) were assembled with mRFP gene as a reporter. Hence, after culturing and testing fluorescence intensities using different methods (see indirect regulation and FANCY), we can learn if the synthetic promoter is regulated as expected.

After a few successes, we are endeavoring setting up a new technical standard on design, construction and functional test of promoters.

 

The above is the video introduction of fatty acid degradation device. For Chinese mainland visitor, please visit here for the video

Purpose

To help people lose weight without the need of food restriction, we designed a genetically modified E.coli that can sense and degrade excessive fatty acid intake by the host. We hope that, together with other two devices we designed, we can introduce our E.coslim as a resident in intestine to consume the excessive calories intake by the host and regulate intestinal microbiota.

Outline

Genes that are responsible for degradation and transportation of fatty acids (FAs) from E.coli K12 and from Salmonella enterica LT2 were cloned. Also, a promoter named PfadR that can be regulated solely by fatty acids was also designed. By placing those fatty acids degradation genes downstream of the artificially designed promoter PfadR (BBa_K861060), we hope to create a device that degrades FAs only when the concentration of FAs is high.

Long chain fatty acids are firstly imported by the transmembrane protein FadL. After FAs get into cells, a CoA will be added by inner membrane-associated FadD (acyl-CoA synthase). β-oxidation is initiated by FadE(acyl-CoA dehydrogenase), which will convert acyl-CoA into enoyl-CoA. The following cycles of hydration, oxidation, and thiolytic cleavage are carried out by tetrameric complex consisting of two FadA and two FadB proteins or two FadI and two FadJ in anaerobic condition. FadR is a transcriptional regulator that, when not binds to acyl-CoA, can either serve as an activator for fatty acid synthesis genes like FabA, FabB and etc., or a repressor for fatty acid degradation genes like FadA, FadB, FadD FadE, FadL, FadI, FadJ and etc. After long chain fatty acids are converted to fatty acyl- CoA by FadD, it can bind to FadR. The binding will alter the conformation of FadR, making FadR unable to bind to the DNA sequence it recognizes to fulfill its function. Therefore, FadR can no longer activate or repress the transcription of genes downstream FadR binding sites. However, to our knowledge, there is no promoter available in nature that can respond solely to FadR since those promoters are often also regulated by glucose concentration or oxidative stress and many other factors.
In our design, FadL, FadD, FadE, FadA, FadB, FadI and FadJ from Escherichia coli K12, and FadA, FadB and FadE from Salmonella enterica LT2 were placed downstream a synthetic promoter PfadR to make them solely regulated by fatty acids concentration.

Progress

Cloning of the gene

First, the genome of Escherichia coli K12 str. DH5ɑ and Salmonella enterica LT2 (symbolized as S-) were extracted and amplified by PCR using primers for each gene. The sequences of the primers used are as bellow (5’---3’).
fadR Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG
Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC
fadA Forward: GGAATTCTCTAGAATGGAACAGGTTGTCATTGTCG
Reverse: GACTAGTTTAAACCCGCTCAAACACCGT
fadB Forward: GGAATTCTCTAGAATGCTTTACAAAGGCGACACC
Reverse: GACTAGTTTAAGCCGTTTTCAGGTCGCC
fadD Forward: GGAATTC TCTAGATTGAAGAAGGTTTGGCTTAACCG
Reverse: GACTAGTTCAGGCTTTATTGTCCACTTTGC
fadE Forward: GGAATTC TCTAGAATGATGATTTTGAGTATTCTCG
Reverse: GACTAGTTTACGCGGCTTCAACTTTCCG
fadL Forward: GGAATTC TCTAGAATGAGCCAGAAAACCCTG
Reverse: GACTAGTTAGAACGCGTAGTTAAAGTTAG
fadI Forward: GGAATTC TCTAGA ATGGGTCAGGTTTTACC
Reverse: GACTAGTTTATTCCGCCTCCAGAACCA
fadJ Forward: GGAATTCTCTAGAATGGAAATGACATCAGC
Reverse: GACTAGTTTATTGCAGGTCAGTTGCAGTTG
s-fadA Forward: GGAATTCTCTAGAATGGTCATTAAGGCGCAAAG
Reverse: GACTAGTCTTATCGCCCCTGAATGGCTAAATC
s-fadB Forward: GGAATTCTCTAGAATGCTTTATAAAGGCGACACC
Reverse: GACTAGTTAAGCCGTTTTCAGAGAACC
s-fadE Forward: GGAATTCTCTAGAATGATGATTTTGAGTATTATCG
Reverse: GACTAGTTATGCGGCTTCGACTTTACGC

Design of the Promoter PfadR Repressed by Fatty Acids

Promoter PfadR, was derived from BBa_J23110. Specifically, FadR binding site of fadL gene was placed overlapping with the last 3 base pairs of BBa_J23110. The sequence was synthesized with restriction sites for EcoRI and XbaI at the 5' terminal and SpeI at 3' terminal. We used overlapping PCR to get the double strand DNA. The primer design of PfadR is as followed:
Forward: GGAATTCTCTAGATTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGCTGGTCCGACCT
Reverse: GACTAGTTCTTAGAAATCAGACCAGTGGCGAGAGTATAGGTCGGACCAGCTAGCATTGT

Construction of Biobricks

Fatty acid degradation project is divided into two parts: promoter, and gene function.
To discover the optimal combination of those fatty acid genes :
1. PCR was used to clone those genes in E.coli K12 and Salmonella enterica LT2
, 2. those genes were restriction digested and ligated into pSB1C3,
3. those genes were restriction digested and ligated with RBS(B0030),
4. RBS-FadA, RBS-FadI, and RBS-S-FadA was ligated with both BBa_R0011 promoter and our PfadR
RBS-FadR, RBS-FadB, RBS-FadJ, RBS-FadE, RBS-FadD, RBS-FadL, RBS-S-FadB, and RBS-S-FadE were ligated with B0034,
5. Promoter-RBS-FadA was ligated with RBS-FadB-Terminator, Promoter-RBS-FadI was ligated with RBS-FadJ-Terminator and Promoter-RBS-S-FadA was ligated with RBS-S-FadB-Terminator. RBS-FadE-Terminator, RBS-FadD-Terminator, RBS-FadL-Terminator, and RBS-S-FadE-Terminator, were ligated with BBa_R0011 promoter, PfadR and various constitutive promoters. For Promoter PfadR
(1) promoter PfadR was synthesized using overlapping PCR
(2) RFP reporter was ligated downstream the promoter and ligted into pSB6A1
(3) J23116+ RBS+ FadR+ Terminator was ligated to PfadR+ RFP in pSB6A1

Experimental Procedure

Cupric acetate-pyridine reaction

We used cupric acetate-pyridine as a color developing reagent to determine fatty acids consumption of genetically modified bacteria. We have modified existing methods to extract free fatty acid in M9 medium. Also, we used IPTG induced promoter BBa_R0011 to see the expression of those proteins and extract proteins from cells. For more details, please see protocol: Cupric-Soap Reaction for more details.

We also conducted in vitro experienments in which we characterized fatty acid degradation capabilities of combination of enzymes using a cell free system. Please see protocol: In vitro Experiment for more details.

Results

Characterization of each gene

In this experiment, we wanted to test whether the ability of degrading fatty acids of our genetically modified bacteria was enhanced as expected by transforming plasmids constitutively expressing related genes in the β-oxidation pathway. The effects of the genes we tested is listed in the following chart I. The ability was reflected by the change of the concentration of the fatty acids in the medium. It was measured by cupric-acetate soap reaction as described in Protocols section. Each time we inoculated 50mg bacteria into 30ml M9 medium using fatty acids as sole carbon source, collecting the sample at the time as shown in the picture. Then the analysis of the free fatty acids was performed.

The following figures showed the effects on degrading fatty acids by expressing different genes in β-oxidation pathway in E.coli. They were under the regulation of promoters with different kinds of strength. J23107 and J23114 are constitutive promoters provided by the committee. PfadR is the promoter designed by ourselves. It consists of the sequence of a constitutive promoter and the binding sequence of the transcription factor, FadR, which is the sensor of the fatty acids. FadE is the acyl-CoA dehydrogenase, which have been proved as performing the rate limiting reaction in the pathway. S-FadE is the counterpart of FadE in the bacteria Samonella. FadD is the acyl-CoA synthase. FadL, a transmembrane protein, is responsible for transporting fatty acids into the bacteria. The control we used was the E.coli expressing galU, a gene responsible for synthesize cellulose.

Fatty acid degradation at 6h

Fatty acid degradation at 12h

Fatty acid degradation at 18h

Fatty acid degradation at 24h

Fatty acid degradation of bacteria overexpressing each gene in 24h

Based on the measurements of the consumption at given time, we concluded that overexpressing FadL increased the metabolizing ability no matter under the regulation of J23114 (BBa_K861002) or our designed promoter, PfadR(BBa_K861003). The advantage was more obvious when the time expanded (consumption at 18h and 24h). It's plausible because more fadL may transport more fatty acids into the bacteria. The increased inner fatty acids concentration was quite favorable. We also noticed that the later one's consumption was lower. It may attribute to the fact that our promoter was weaker than the J23114. If the copy number of FadL was less, its metabolizing rate would be slower. And the fact that the PfadR needs to be induced may also make the time needed to synthesize protein longer, which may make it less competitive. These data opposed to our assumption that overexpressing the rate limiting enzyme FadE ((BBa_K861025 and (BBa_K861026) wouldn't have obvious effect. It may because the original level of FadE was enough, thus overexpression was not needed. The strength of the promoter didn't affects the rate much, which partially suggested the reason above.

We found that the slope between 12h and 18h and between 18 and 24h were less than the others. It may because the bacteria have entered static status, the amount of bacteria became consistent. Also, after the first death phase, they entered logarithmic phase again. Since our inoculation was relatively large and the oleate was excessive, the situation that the bacteria has experience two life cycle was possible. A growth curve in the future can test the theory.

In vitro Experiment

The in vitro experiment was designed to make up for the limitation of time to test the combination of expressing different genes together (We were short of time assembling the genes together). So we used the cell extracts to do the enzyme assay. The advantage was that we can easily mix the enzyme we want together. Since the purpose of this experiment was to test whether overexpressing multiple genes were superior to a single gene, we set the amount of every gene the same in the combination for simplicity. In the future, we can test more combinations to find the best ratio.

Fatty acids remaining after 6 hours of reaction

The result was that the cell extract of bacteria overexpressing FadE (BBa_K861024), FadD (BBa_K861013), S- FadA S- FadB(BBa_K861038) (a regulon), FadI FadJ(BBa_K861037) (a regulon) separately all degraded oleate obviously faster than the control. This may be somewhat contrasting to the result of our in vivo assay, in which overexpressing the FadD and FadE did not have obvious results. However, it can be explained. The promoter was not that strong in the in vivo assay, otherwise the growth of the bacteria would be inhibited. However, in the in vitro assay, this consideration was not necessary. Also, the concentration in the final reaction system was quite high by collecting 1L medium, which may improve the metabolizing rate.

It also showed that simultaneously increasing the concentration of FadE, FadD, S- FadA and S- FadB significantly improved the degrading ability. Increasing the doze of the FadI and FadJ on the basis of above did not make any difference, while increasing FadA and FadB may be indispensible because only expressing FadD and FadE was worse than expressing the gene alone.

The above is the video introduction of cellulose synthesis degradation device. For Chinese mainland visitor, please visit here for the video.

Outline

Cellulose is an essential material for keeping intestine peristalsis without producing energy, as prebiotics, feeding vegetarian bacteria flora (including Bacteroides, whose appropriate amount has proved important to prevent obesity) of intestine as well. Thus, cellulose helps people keep slim and healthy.

The developing device aims at transforming glucose into cellulose, thus producing cellulose as well as reducing energy intake. To achieve this goal, we cloned genes of enzymes responding to cellulose synthesis from the Escherichia coli str. DH5α, constructing functional expressional elements with these genes respectively downstream of promoter activated by glucose. In this way, cellulose synthetase complex was built artificially under regulation of glucose, repressed under low concentration of glucose and activated under high concentration of glucose.

In the future, this device can be integrated to the assembled E. coslim, activated when excess glucose is sensed in intestine, converting it to cellulose.

The same as device I (fatty acid degradation), on one hand, we divide our work into two parallel sections. Function section includes a series of molecular biological manipulation on four genes of the cellulose synthetase complex and another two genes responding to produce substrates for cellulose synthesis. On the other hand, the design, construction and function tests of glucose-activated promoter belong to regulation section.

Design

Genes to be Cloned

4 genes, bcsA, bcsB, bcsZ and bcsC, from the rdar morphotype bacterium, are involved in cellulose biosynthesis.

BcsA is considered to be the catalytic subunit.

BcsB can be activated the soon it binds to c-di-GMP.

BcsZ encodes endo-1,4-D-glucanase which belongs to glycosyl hydrolase family Ⅷ. Activation of BcsZ is required for optimal synthesis and membrane translocation of cellulose.

Although BcsC is transcribed constitutively, cellulose synthesis occurs only in the circumstances of AdrA.

AdrA ,a diguanylate cyclase (DGC), cyclizestwo GTPs into c-di-GMP. In turn, the activity of cellulose synthase can be increased when binds to c-di-GMP.

GalU catalyzes the addition of UTP to α-D-glucose 1-phosphate to yield UDP-D-glucose, which is the substrate for cellulose synthase complex

GalF is a predicted subunit of a GalU/GalF protein complex involved in colanic acid building blocks biosynthesis

Plasmid construct concept

After the indirect regulatory pathway and promoter Pcar being tested to be effective,we can embed the genes which are involved in cellulose synthesis downstream any one of them.So cellulase can only be expressed when glucose concentration is high, and also the expression will increase with glucose concentration. In this way, our E.coslim will have the ability to convert excess glucose into cellulose.

Progress

Clone of genes

As for the genes that we cloned, there was no difference between E. Coli str. K12 MG1655 and more available DH5α. we purified and amplified these genes from genome of Escherichia coli str. DH5α using PCR. The primers contained standard restriction enzyme cutting sites. The sequences of the primers used are as below.

  bcsA Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG
  Sense CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG

  bcsB Antisense CCTGCAGTACTAGTATTACTCGTTATCCGGGTTAAGAC
  Sense CGAATTCTTCTAGAGATGAAAAGAAAACTATTCTGGATTTG

  bcsZ Antisense CCTGCAGTACTAGTATTAGTGTGAATTTGCGCATTCCTGG
  Sense CGAATTCTTCTAGAGATGAATGTGTTGCGTAGTGGAATCG

  bcsC Antisense CCTGCAGTACTAGTATTACCAGTCGGCGTAAGGTATCA
  Sense CGAATTCTTCTAGAGATGCGCAAATTCACACTAAACATATTC

  galF Antisense CCTGCAGTACTAGTATTATTCGCTTAACAGCTTCTCG
  Sense CGAATTCTTCTAGAGATGACGAATTTAAAAGCAGTTATACC

  galU Antisense CCTGCAGTACTAGTATTACTTCTTAATGCCCATCTCTTCT
  Sense CGAATTCTTCTAGAGATGGCTGCCATTAATACGAAAG

 

Then the genes were digested with restriction enzymes and assembled to RBS (BBa_B0030) and terminator (BBa_B0024).

Construction of the plasmid expressing cellulose synthetase controlled by promoter we designed

All coding sequences were assembled to RBS and terminator, afterwards, they were embedded downstream the promoter Pcar, which can be activated at high glucose concentration.
The biobricks constructed were showed as bellow:

  BBa_K861102: Pcar+RBS+bcsA+terminator

  BBa_K861112: Pcar+RBS+bcsB+terminator

  BBa_K861122: Pcar+RBS+bcsZ+terminator

  BBa_K861132: Pcar+RBS+bcsC+terminator

  BBa_K861142: Pcar+RBS+galU+terminator

  BBa_K861152: Pcar+RBS+galF+terminator

  BBa_K861074: Pcar+RBS+adrA+terminator

All new composite parts mentioned above were transformed to competent cells of Escherichia coli str. DH5α. All positive clones were validated using PCR, restriction enzyme digestion and DNA sequencing.

Detection of Cellulose Synthesis

To detect the cellulose synthesis, we used cellulase to degrade cellulose in the cell culture. Then total reducing sugar in the culture was measured. So the difference of total reducing sugar between culture before and after treated with cellulase represented the total cellulose synthesized by the cell. For detailed information, please click Here.

Results

Clone of genes

The gene bcsA is 2619bp, bcsB is 2340bp, bcsZ is 1107 bp, bcsC is 3474bp, galU is 909bp and galF is 894 bp. After PCR amplification, DNA fragments were examined by agarose gel electrophoresis. All genes proved to be correct. Then the genes were digested with restriction enzymes and embedded into plasmid backbone pSB1A2. To confirm the accuracy of sequences, positive clones were sent for sequencing after transformation. And the results showed that no mutation existed in genes.

Detection of Cellulose Synthesis

After treating with cellulase, total reducing sugar in supernatant and deposits were measured by methods described in our protocol. Colors in the tubes
becoming darker meant that reducing sugar increased with time. Amount of reducing sugar was calculated according to standard curve of glucose.

The formula of standard curve is as bellow:

y=1.3795x+0.0373

In our experiment, cells that expressed protein which has nothing to do with cellulose synthesis was used as a control.We transformed the seven genes involved in cellulose synthesis into E.coli and measured cellulose production with method mentioned above. In the step of measuring total cellulose production, excessive cellulase was appended and incubated at 50 ℃ for 1 hour, and results showed that some of the seven genes help increase the ability of cellulose synthesis.

In addition,AdrA is responsible for the production of a small molecule,c-di-GMP, which is known as an activator of cellulase. So we co-overexpress adrA with bcsA. Cellulose output in both supernatant and deposit were showed in the following figure. The cellulose production in adrA+bcsA was more than 0.6 mg/mL, which was almost two times higher than that of control.

 

Disscusion

In our experiment, results showed that cellulose yield in adrA+bcsA was higher than that of the single gene. So it indicated that the co-expression of some genes would increase cellulose production. In the next stage, we will try more combination of these genes and find the most efficient one

Actually, BcsB can be activated by c-di-GMP. But till the deadline, we have not successfully assembled Pcar and bcsB. In the following work, we are going to assemble a plasmid including all of the seven genes. Maybe in this way, cellulose production will increase greatly.

Other than application in the project of E.coslim, the cellulose device can also be used in many other fields, such as papermaking industry, biomedical materials, audio equipment and so on.

The above is the video introduction of colonization device. For Chinese mainland visitor, please visit here for the video

Purpose

One big challenge of probiotics is their survival in intestine. We respond to this challenge by expressing gene adrA responsible for manufacturing the second messager c-di-GMP, a magic molecule that leads to inhibition of motility and increase of adhesion and division of E.coli.

Outline

AdrA protein can convert GTP into c-di-GMP, a magic second massager that, besides promoting the production of cellulose(for more details, see our celluose synthesis device), can reduce the expression of flagella and acute virulence gene simultaneously. In the same time, c-di-GMP can facilitate the synthesis of various adhesins and exopolysaccharides and can promote the proteolysis of replication inhibitors. As a result, AdrA makes cells become adhesive and promote the formation of biofilm, making the bacteria gain advantages to survive in the hostile environment of intestine.

Experimental Procedure

We tested the function of AdrA gene by plate assay. Formore details, please visit our protocol: Plate Assay.

Results


As can be seen from the plate. Clone with AdrA constitutively expressed using BBa_J23107 was much more smaller compared to the control that only contain the plasmids of RBS, though the amount of bacteria was similar. This result showed that the AdrA was successfully expressed, elevating c-di-GMP level, leading to the increase expression of adhesins and inhibition of motility.

The above is the video introduction of death device. For Chinese mainland visitor, please visit here for the video

Outline

We plan to place endonuclease and YhjH gene downstream the xylR repressed promoter (BBa_K861200) to make bacteria die and lose their adhesion when exposed to xylose.

Description

In order to terminate the overreaction of fatty acids degradation and cellulose synthesis, we designed a death device. Firstly, we determined to use endonuclease YhjH (BBa_K861090) responsible for c-di-GMP degradation to counteract the impact of AdrA and BglII( (BBa_K112106)), a protein that can kill the microbe without inducing cell lysis. Since AdrA but not YhjH contains this restriction site, our E.coslim will lose their adhesion more easily. To control the expression of endonuclease and YhjH, a regulator is necessary. We selected xylose as the inducer because this monomer hardly exists in nature, so the GMOs will not be killed under natural condition. Also, it is healthy and hard to be absorbed by human beings so the concentration of xylose in the gut can keep high for a long time. We are planning to device another synthetic promoter repressed by XylR from B.subtilis. We hope that eating xylose will subsequently derepress the expression of endonuclease and YhjH, ending up with the loss of adhesion and the death of our E.coslim, therefore efficiently terminate the process of lossing weight. For more information and for a brief introduction of our two-capsule design, please visit our Future Perspective .



Prevention of HGT

In human gut, there are billions of microbes. Horizontal gene transfer of those high efficient metabolic genes between GMOs and normal intestine residents may get out of control and cause disastrous effects. Therefore, a mechanism to prevent HGT is highly necessary. To prevent horizontal gene transfer, we designed a two-plasmids system. In one plasmid, xlyR repressor encoding gene (BBa_K143036) from Bacillus subtilis will be assembled with constitutively expressed promoter. On the other plasmid, metabolic gene will be coupled with xylR repressed death system. In our GMOs, since death system is suppressed by xylR in low xylose concentration, the bacteria will not die. However, when the HGT of those high efficient metabolic genes happens, the death system will not be suppressed, and the recipient will be killed.