Team:Georgia Tech/Project

From 2012.igem.org

(Difference between revisions)
(→Characterization of Fusions)
(→Design Considerations)
 
(15 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:Georgia_Tech/Template:stylesheet}}
{{:Team:Georgia_Tech/Template:stylesheet}}
{{:Team:Georgia_Tech/Template:GT-header}}
{{:Team:Georgia_Tech/Template:GT-header}}
-
 
-
[https://igem.org/2012_Judging_Form?id=916 Judging Form]
 
-
 
==Abstract==
==Abstract==
Line 16: Line 13:
===Motivation===
===Motivation===
 +
Biosensors have a wide range of applications, but for many of those applications there already exists a machine that can do a better job than our engineered bacteria. One of the biggest liabilities in using a biological system is the time associated with getting the desired information. Cells have to metabolize the desired chemical, alter gene expression, and accumulate enough protein in order to produce a measurable output.
 +
[[File:GT_biosensor_example.JPG|thumb|300px|left|A biosensor used in our mentor lab responding to different concentrations of autoinducer]]
 +
 +
In the graph to the left, it takes on the order of 2-3 hours before a LuxR based GFP reporter reaches maximum signal. We designed our system based on the prediction that waiting for dimerization is a lot faster than waiting for transcription, translation, and protein accumulation.
 +
 +
An added benefit to designing our system with TraR to fluoresce independent of TraR's ability to regulate genes is that TraR does not activate transcription in <i>E. coli</i>. [http://www.ncbi.nlm.nih.gov/pubmed/19732344 In a paper] published in 2009 by Qin et. al. they show that TraR is unable to recruit <i> E. coli</i>'s native RNA polymerase. It has been shown in [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC126196/ another paper], however, that TraR does fold properly into monomers and will dimerize in the presence of its autoinducer in <i>E. coli</i>. So this system, as we've designed it, will be the first to use TraR in a fluorescence based biosensor in <i>E. coli</i> since it does not require TraR to active transcription but only to fold correctly and dimerize.
===Design Considerations===
===Design Considerations===
Line 22: Line 25:
[[File:GT_PET11a_and_pMRBAD.png|right|thumb|250px|Plasmids provided by Dr. Regan from Yale]]
[[File:GT_PET11a_and_pMRBAD.png|right|thumb|250px|Plasmids provided by Dr. Regan from Yale]]
-
We decided to first make the fusions in the plasmids provided by [http://www.yale.edu/reganlab/ Dr. Lynne Regan] from Yale. By choosing this method, we were able to use the provided controls in testing our part.
+
We decided to first make the fusions in the plasmids provided by [http://www.yale.edu/reganlab/ Dr. Lynne Regan] from Yale. By choosing this method, we were able to use the provided controls in testing our part. [http://www.yale.edu/reganlab/pdfs/WilsonRegan2004NatMethods.pdf Here] is a paper detailing the plasmids.
The pET11a plasmid is under control of T7 polymerase, so we used Bl21(DE3) <i>E. coli</i> cells which have an IPTG-inducible copy of the polymerase on their chromosome.
The pET11a plasmid is under control of T7 polymerase, so we used Bl21(DE3) <i>E. coli</i> cells which have an IPTG-inducible copy of the polymerase on their chromosome.
Line 55: Line 58:
====Characterization of Fusions====
====Characterization of Fusions====
-
<br style="clear:both">
+
 
Diagnostic digests were performed on minipreps from transformed colonies to see if a traR-sized fragment was indeed inserted into the two plasmids. In both plasmids, a ~700bp fragment was observed. These minipreps were sent for sequencing and traR insertion was confirmed and seen to be in frame.
Diagnostic digests were performed on minipreps from transformed colonies to see if a traR-sized fragment was indeed inserted into the two plasmids. In both plasmids, a ~700bp fragment was observed. These minipreps were sent for sequencing and traR insertion was confirmed and seen to be in frame.
Transformed BL21(DE3) cells carrying both the pET11a-TraR-NGFP and pMRBAD-TraR-CGFP were plated on media containing IPTG, arabinose, and varying amounts of autoinducer, either synthesized, or from sterile supernatants. As of this writing, no conditions produce visible GFP on plates.
Transformed BL21(DE3) cells carrying both the pET11a-TraR-NGFP and pMRBAD-TraR-CGFP were plated on media containing IPTG, arabinose, and varying amounts of autoinducer, either synthesized, or from sterile supernatants. As of this writing, no conditions produce visible GFP on plates.
 +
 +
Flow cytometry was performed on colonies from the leucine zipper controls, colonies from plates without induction, and colonies grown on plates contiaint 25% supernatants from a strain constitutive for TraI, the enzyme responsible for making TraR's recognized autoinducer.
 +
 +
The leucine zipper colonies were centered around 10<sup>4</sup>, the colonies without induction around 10<sup>1</sup>. The colonies grown on TraI suppernatant supplemented media looked very similar to those without induction, with only a small peak in the range that GFP should produce.
 +
 +
Though this result is not completely positive, some GFP was observed in the TraR fusion colonies. This could mean that with careful optimization of conditions, this system could function as designed.
 +
<gallery>
 +
File:GFP_leucine_zipper_FACS.jpg|leucine zipper control plasmids
 +
File:Negative_FACS.jpg|no induction
 +
File:25%25_supernatants_FACS.jpg|25% TraI supernatants
 +
</gallery>
 +
<br style="clear:both">
==Submitted Parts==
==Submitted Parts==
 +
We successfully cloned 3 of our parts into pSB1c3 before the deadline.
 +
 +
[http://partsregistry.org/Part:BBa_K916001 TraR-NGFP translational Fusion]
 +
[http://partsregistry.org/Part:BBa_K916002 TraR-CGFP Translational Fusion]
 +
[http://partsregistry.org/Part:BBa_K916003 Leucine Zipper NGFP translational fusion]
 +
 +
However, the NGFP coding sequence contained a Spe1 site. We mistakenly thought that though these parts would be  incompatible with some assembly methods, that the parts would still be accepted with proper documentation explaining what assembly methods could and could not be used. We are working with iGEM headquarters to make sure we get compatible DNA submitted to the registry for these parts.
 +
 +
We are in the process of using QuikChange site directed mutagenesis to remove the Spe1 site from BBa_K916001 and BBa_K916003 and will resubmit the parts with compatible sequence as soon as possible.
 +
 +
We sequenced all three parts and saw that all of them were correctly cloned into pSB1c3. All sequencing information can be found on the parts physical DNA page.
 +
<groupparts>iGEM012 Georgia_Tech</groupparts>
<groupparts>iGEM012 Georgia_Tech</groupparts>
Line 75: Line 102:
====Response to Autoinducer====
====Response to Autoinducer====
-
In the presence of acylhomoserine lactone at various concentrations alone (100 μM, 10 μM, 1μM, 0.1 μM, 0.01 μM, 1 nm, 0.1 nm) and acylhomoserine lactone (same concentrations) + IPTG, DH5α/psB1AK3[BBa_K091134] did not produce a detectable fluorescent signal. However,the data are less than clear as our positive control showed no fluorescence either.
+
In the presence of N-oxo3 dodecanoyl homoserine lactone at various concentrations alone (100 μM, 10 μM, 1μM, 0.1 μM, 0.01 μM, 1 nm, 0.1 nm) and N-oxo3 dodecanoyl homoserine lactone (same concentrations) + IPTG, DH5α/psB1AK3[BBa_K091134] did not produce a detectable fluorescent signal. However,the data are less than clear as our positive control showed no fluorescence either.
====Sequencing====
====Sequencing====
The psB1AK3/BBa_K091134 plasmid was extracted from the transformed cells for sequencing. Standard primers for sequencing/amplifying BioBrick parts were used: VF2 (tgccacctgacgtctaagaa) and VR (attaccgcctttgagtgagc). The sequencing was successful for both primers. EMBOSS Needle was used to align sequencing results to the expected sequence for the part (see attached sequencing data).
The psB1AK3/BBa_K091134 plasmid was extracted from the transformed cells for sequencing. Standard primers for sequencing/amplifying BioBrick parts were used: VF2 (tgccacctgacgtctaagaa) and VR (attaccgcctttgagtgagc). The sequencing was successful for both primers. EMBOSS Needle was used to align sequencing results to the expected sequence for the part (see attached sequencing data).
-
The sequence from VF2 from bp 331 to 1099 aligned with the expected sequence from bp 1 to 752 with 92.2% identity. However, it was noted that the region from 332 to 404 bp on the VF2 sequence aligned imperfectly with the expected sequence for that region (1 to 75 bp in the expected sequence for the part).  This region includes the sequence for the PLlac 0-1 promoter
+
The sequence from VF2 from bp 331 to 1099 aligned with the expected sequence from bp 1 to 752 with 92.2% identity. However, it was noted that the region from 332 to 404 bp on the VF2 sequence aligned imperfectly with the expected sequence for that region (1 to 75 bp in the expected sequence for the part).  This region is supposed to include the sequence for the PLlac 0-1 promoter (R0011)
-
However, a comparison between the expected sequence (aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca) against the VF2 sequence (agttctggcaggtttggccgcgggttctttttggtacacgaaagc) reveals very little identity (43.1%). This leads us to believe that the promoter region for LasR expression is missing and that the part will not function as expected. A BLAST search the VF2 sequence suggests the part does contain the LasR coding sequence. Directly upstream of the LasR coding sequence is the ribosomal binding site which appears to be the correct sequence. However, upstream of the ribosomal binding site, the VF2 sequence BLASTs to the P. aeruginosa lasB gene starting at 247 bp. Upstream of lasB appears to be vector sequence. Nowhere in the sequence is the PLlac 0-1 promoter region.  
+
However, a comparison between the expected sequence (aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca) against the VF2 sequence (agttctggcaggtttggccgcgggttctttttggtacacgaaagc) reveals very little identity (43.1%). This leads us to believe that the promoter region (R0011) for LasR expression is missing and that the part will not function as expected. A BLAST search the VF2 sequence suggests the part does contain the LasR coding sequence (C0079). Directly upstream of the LasR coding sequence is the ribosomal binding site (B0034) which appears to be the correct sequence. However, upstream of the ribosomal binding site, the VF2 sequence BLASTs to the ''P. aeruginosa'' ''lasB'' gene starting at 247 bp. Upstream of ''lasB'' appears to be vector sequence. Nowhere in the sequence is the PLlac 0-1 promoter region (R0011).  
-
The VR sequence (reverse complement) from 1 to 939bp aligns with the expected sequence from 1059 to 2047bp with 97.7% identity. There appears to be no significantly misaligned region. The VR sequence appears to contain the correct sequences for the LasR+PAI promoter, the ribosomal binding site, GFP, and the transcriptional terminator.  
+
The VR sequence (reverse complement) from 1 to 939bp aligns with the expected sequence from 1059 to 2047bp with 97.7% identity. There appears to be no significantly misaligned region. The VR sequence appears to contain the correct sequences for the LasR+PAI promoter (R0079), the ribosomal binding site (B0032), GFP (E0040), and the transcriptional terminator (B0010 and B0012).
====Raw Sequencing Data====
====Raw Sequencing Data====
Line 287: Line 314:
===Conclusions===
===Conclusions===
-
From the sequencing data alone, it appears that beyond the expected PLlac 0-1 promoter region, the part is otherwise constructed as reported. However, the lack of the PLlac 0-1 promoter region means that lasR will not be expressed and there we anticipate that there will be no response (i.e. fluorescence) to the presence of the autoinducer.  To fix this part, the lasB and vector coding sequences upstream of lasR would need to be cut out and replaced with PLlac 0-1. This is predicted to restore the desired function to the part.
+
From the sequencing data alone, it appears that beyond the expected PLlac 0-1 promoter region, the part is otherwise constructed as reported. However, the lack of the PLlac 0-1 promoter region means that ''lasR'' will not be expressed and there we anticipate that there will be no response (i.e. fluorescence) to the presence of the autoinducer.  To fix this part, the ''lasB'' and vector coding sequences upstream of ''lasR'' would need to be cut out and replaced with PLlac 0-1. This is predicted to restore the desired function to the part.

Latest revision as of 04:00, 4 October 2012

Igem-logo.png

Contents

Abstract

An intragenic complementation approach to engineer a faster fluorescence biosensor

Our goal is to engineer a novel biosensor with a faster readout than is currently available. Many bacteria produce, secrete, and respond to chemicals called autoinducers to monitor population density and to synchronize gene expression, a process called quorum sensing. In quorum sensing based biosensors, detection of autoinducer activates transcription of a reporter gene, which must then be translated and accumulate to detectable levels, which can take two to four hours. In our system, we will use TraR, a protein used in the quorum sensing response of Agrobacterium tumefaciens, which dimerizes only in the presence of its autoinducer. We have successfully fused traR to sequence for two separate complementary fragments of GFP. Upon addition of autoinducer, we predict that already accumulated TraR-GFP fragment monomers will dimerize, allowing the GFP fragments to interact and fluoresce. This new approach may drastically reduce the time necessary for future biosensors to produce detectable output.


Project Overview

Motivation

Biosensors have a wide range of applications, but for many of those applications there already exists a machine that can do a better job than our engineered bacteria. One of the biggest liabilities in using a biological system is the time associated with getting the desired information. Cells have to metabolize the desired chemical, alter gene expression, and accumulate enough protein in order to produce a measurable output.

A biosensor used in our mentor lab responding to different concentrations of autoinducer

In the graph to the left, it takes on the order of 2-3 hours before a LuxR based GFP reporter reaches maximum signal. We designed our system based on the prediction that waiting for dimerization is a lot faster than waiting for transcription, translation, and protein accumulation.

An added benefit to designing our system with TraR to fluoresce independent of TraR's ability to regulate genes is that TraR does not activate transcription in E. coli. [http://www.ncbi.nlm.nih.gov/pubmed/19732344 In a paper] published in 2009 by Qin et. al. they show that TraR is unable to recruit E. coli's native RNA polymerase. It has been shown in [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC126196/ another paper], however, that TraR does fold properly into monomers and will dimerize in the presence of its autoinducer in E. coli. So this system, as we've designed it, will be the first to use TraR in a fluorescence based biosensor in E. coli since it does not require TraR to active transcription but only to fold correctly and dimerize.

Design Considerations

Plasmids provided by Dr. Regan from Yale

We decided to first make the fusions in the plasmids provided by [http://www.yale.edu/reganlab/ Dr. Lynne Regan] from Yale. By choosing this method, we were able to use the provided controls in testing our part. [http://www.yale.edu/reganlab/pdfs/WilsonRegan2004NatMethods.pdf Here] is a paper detailing the plasmids.

The pET11a plasmid is under control of T7 polymerase, so we used Bl21(DE3) E. coli cells which have an IPTG-inducible copy of the polymerase on their chromosome.

The designed fusion into pET11a was compatible with the TraR sequence, but the pMRBAD fusion was not. The pMRBAD fusion was designed to use NcoI and AatII, but TraR had two AatII sites in the coding sequence. We instead cloned TraR in-between the NcoI and Sph1 sites. This added two amino acids to the linker, one of which was a cysteine. It is unclear whether these additional amino acids will disrupt the ability for TraR and the CGFP fragment to fold independently from one another.


The junction between traR and the C-terminal GFP fragment cloned into the SphI site: 

                   SphI          AatII
   R   K   L   I   A   C   N   G   T   S   G
   cgg aaa ctc atc gca tgc aat ggg acg tcg ggt 
       <-- traR--| |-- linker -->

Results

Leucine Zipper Controls

Leucine zipper controls glow only upon addition of both arabinose and IPTG

After co-transforming pET11a-z-NGFP and pMRBAD-z-CGFP into BL21(DE3) cells, we plated on media containing IPTG (0.1mM) and arabinose (0.2% w/v). We incubated at 30° C for 10 hours and left the plates on the bench top for 24 hours. We observed accumulation of GFP only in colonies plated with both IPTG and arabinose.

TraR Fusions

TraR PCR product using pCF222 from Dr. Fuqua as template

After trying to PCR traR coding sequence from multiple sources, we finally succeeded using a plasmid generously provided by [http://www.bio.indiana.edu/faculty/directory/profile.php?person=cfuqua Dr. Clay Fuqua] from University of Indiana (pCF222)

We successfully cloned traR coding sequence into pET11-a-link-NGFP between the XhoI and BamHI sites, and into pMRBAD-link-CGFP between the NcoI and SphI sites. We confirmed insertion with diagnostic digest and sequencing.

Characterization of Fusions

Diagnostic digests were performed on minipreps from transformed colonies to see if a traR-sized fragment was indeed inserted into the two plasmids. In both plasmids, a ~700bp fragment was observed. These minipreps were sent for sequencing and traR insertion was confirmed and seen to be in frame.

Transformed BL21(DE3) cells carrying both the pET11a-TraR-NGFP and pMRBAD-TraR-CGFP were plated on media containing IPTG, arabinose, and varying amounts of autoinducer, either synthesized, or from sterile supernatants. As of this writing, no conditions produce visible GFP on plates.

Flow cytometry was performed on colonies from the leucine zipper controls, colonies from plates without induction, and colonies grown on plates contiaint 25% supernatants from a strain constitutive for TraI, the enzyme responsible for making TraR's recognized autoinducer.

The leucine zipper colonies were centered around 104, the colonies without induction around 101. The colonies grown on TraI suppernatant supplemented media looked very similar to those without induction, with only a small peak in the range that GFP should produce.

Though this result is not completely positive, some GFP was observed in the TraR fusion colonies. This could mean that with careful optimization of conditions, this system could function as designed.

leucine zipper control plasmids

no induction

25% TraI supernatants


Submitted Parts

We successfully cloned 3 of our parts into pSB1c3 before the deadline.

[http://partsregistry.org/Part:BBa_K916001 TraR-NGFP translational Fusion] [http://partsregistry.org/Part:BBa_K916002 TraR-CGFP Translational Fusion] [http://partsregistry.org/Part:BBa_K916003 Leucine Zipper NGFP translational fusion]

However, the NGFP coding sequence contained a Spe1 site. We mistakenly thought that though these parts would be incompatible with some assembly methods, that the parts would still be accepted with proper documentation explaining what assembly methods could and could not be used. We are working with iGEM headquarters to make sure we get compatible DNA submitted to the registry for these parts.

We are in the process of using QuikChange site directed mutagenesis to remove the Spe1 site from BBa_K916001 and BBa_K916003 and will resubmit the parts with compatible sequence as soon as possible.

We sequenced all three parts and saw that all of them were correctly cloned into pSB1c3. All sequencing information can be found on the parts physical DNA page.

<groupparts>iGEM012 Georgia_Tech</groupparts>

Characterizing the Las reciever BBa_K091134 from iGEM 2008's Davidson-Missouri Western team

Our findings have been summarized on the [http://partsregistry.org/Part:BBa_K091134:Experience#Georgia_Tech_2012_iGEM_Team_Review BBa_K091134 experience page].

Background

We characterized part BBa_K091134 from the registry which is designed to express GFP in the presence of the autoinducer N-oxo3 dodecanoyl homoserine lactone (Pseudomonas autoinducer, PAI). The part is contained in the plasmid psB1AK3 which has markers for ampicillin and kanamycin resistance. It contains the LasR receptor (C0079) from Pseudomonas aeruginosa and a GFP reporter (E0040). In this part, GFP expression is under the control of the LasR+PAI promoter (R0079). The part should produce LasR which receives the PAI. Binding of LasR to the PAI should be reported by GFP expression. lasR is reported to be under the control of the PLlac 0-1 promoter (R0011) in the part. The PLlac 0-1 promoter is a hybrid consisting of the lambda phage promoter P(L) with the cI binding sites replaced with lacO1. In nature, LasR bound to the PAI is the activator for the expression of the Pseudomonas aeruginosa elastase gene (lasB).

Methods and Results

Transformation and Selection

psB1AK3[BBa_K091134] was transformed into chemically competent (DH5α). Transformed cells were plated on LB agar plates containing either ampicillin, kanamycin, or ampicillin and kanamycin. Colonies were observed on the kan plates and the amp plates but never on the amp and kan plates. Characterization was continued using a colony from the LB/kan plate.

Response to Autoinducer

In the presence of N-oxo3 dodecanoyl homoserine lactone at various concentrations alone (100 μM, 10 μM, 1μM, 0.1 μM, 0.01 μM, 1 nm, 0.1 nm) and N-oxo3 dodecanoyl homoserine lactone (same concentrations) + IPTG, DH5α/psB1AK3[BBa_K091134] did not produce a detectable fluorescent signal. However,the data are less than clear as our positive control showed no fluorescence either.

Sequencing

The psB1AK3/BBa_K091134 plasmid was extracted from the transformed cells for sequencing. Standard primers for sequencing/amplifying BioBrick parts were used: VF2 (tgccacctgacgtctaagaa) and VR (attaccgcctttgagtgagc). The sequencing was successful for both primers. EMBOSS Needle was used to align sequencing results to the expected sequence for the part (see attached sequencing data).

The sequence from VF2 from bp 331 to 1099 aligned with the expected sequence from bp 1 to 752 with 92.2% identity. However, it was noted that the region from 332 to 404 bp on the VF2 sequence aligned imperfectly with the expected sequence for that region (1 to 75 bp in the expected sequence for the part). This region is supposed to include the sequence for the PLlac 0-1 promoter (R0011)

However, a comparison between the expected sequence (aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca) against the VF2 sequence (agttctggcaggtttggccgcgggttctttttggtacacgaaagc) reveals very little identity (43.1%). This leads us to believe that the promoter region (R0011) for LasR expression is missing and that the part will not function as expected. A BLAST search the VF2 sequence suggests the part does contain the LasR coding sequence (C0079). Directly upstream of the LasR coding sequence is the ribosomal binding site (B0034) which appears to be the correct sequence. However, upstream of the ribosomal binding site, the VF2 sequence BLASTs to the P. aeruginosa lasB gene starting at 247 bp. Upstream of lasB appears to be vector sequence. Nowhere in the sequence is the PLlac 0-1 promoter region (R0011).

The VR sequence (reverse complement) from 1 to 939bp aligns with the expected sequence from 1059 to 2047bp with 97.7% identity. There appears to be no significantly misaligned region. The VR sequence appears to contain the correct sequences for the LasR+PAI promoter (R0079), the ribosomal binding site (B0032), GFP (E0040), and the transcriptional terminator (B0010 and B0012).

Raw Sequencing Data

VF2 Complete Sequence
NNNNNNNNNNNNCCNATAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGC
CAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTG
GGCCTTTCTGCGTTTATATACTAGAGGCCCCTCGCTGAGCGCGTCCCGGAGCTGGGGGCAACCTAGCTGCCACCTGCTTTTCTGCTAGCTATTCCAGCGAAAACATACAG
ATTTCCGGCGAAATCAAGGCTACCTGCCAGTTCTGGCAGGTTTGGCCGCGGGTTCTTTTTGGTACACGAAAGCTACTAGAGAAAGAGGAGAAATACTAGATGGCCTTGGT
TGACGGTTTTCTTGAGCTGGAACGCTCAAGTGGAAAATTGGAGTGGAGCGCCATCCTCCAGAAGATGGCGAGCGACCTTGGATTCTCGAAGATCCTGTTCGGCCTGTTGC
CTAAGGACAGCCAGGACTACGAGAACGCCTTCATCGTCGGCAACTACCCGGCCGCCTGGCGCGAGCATTACGACCGGGCTGGCTACGCGCGGGTCGACCCGACGGTCAGT
CACTGTACCCAGAGCGTACTGCCGATTTTCTGGGAACCGTCCATCTACCAGACGCGAAAGCAGCACGAGTTCTTCGAGGAAGCCTCGGCCGCCGGCCTGGTGTATGGGCT
GACCATGCCGCTGCATGGTGCTCGCGGCGAACTCGGCGCGCTGAGCCTCAGCGTGGAAGCGGAAAACCGGGCCGAGGCCAACCGTTTCATAGAGTCGGTCCTGCCGACCC
TGTGGATGCTCAAGGACTACGCACTGCAAAGCGGTGCCGGACTGGCCTTCGAACATCCGGTCAGCAAACCGGTGGTTCTGACCAGCCGGGANAAGGAAGTGTTGCAGTGG
NGCGCCATCGGCAGACCAGTTGGGAGANATCGGTTATCTGCAACTGCTCGGAAGCCAATGTGAACTTCCATATGGGAAATANTNNNNGGAAGTTCGGNGTGACNNCNNN
VF2 Alignment with BBa_K091134
Identity	712/772 (92.2%)

Similarity	712/772 (92.2%)

Gaps	23/772 ( 3.0%)


		   1 -ATTTCCGGCGAAATCAAGGCTACCTGCCAGTTCTGGCAGGTTTGGCCGC     49
                      |||....|||.|            |..||.|  ||.||   |||...||
EMBOSS_001         1 aattgtgagcgga------------taacaat--tgaca---ttgtgagc     33

EMBOSS_001        50 GGGTTCTTTTTGGTACACGAAAGC-TACTAGAGAAAGAGGAGAAATACTA     98
                     ||.|  .....|.|||. ||...| |||||||||||||||||||||||||
EMBOSS_001        34 ggat--aacaagatact-gagcacatactagagaaagaggagaaatacta     80

EMBOSS_001        99 GATGGCCTTGGTTGACGGTTTTCTTGAGCTGGAACGCTCAAGTGGAAAAT    148
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001        81 gatggccttggttgacggttttcttgagctggaacgctcaagtggaaaat    130

EMBOSS_001       149 TGGAGTGGAGCGCCATCCTCCAGAAGATGGCGAGCGACCTTGGATTCTCG    198
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       131 tggagtggagcgccatcctccagaagatggcgagcgaccttggattctcg    180

EMBOSS_001       199 AAGATCCTGTTCGGCCTGTTGCCTAAGGACAGCCAGGACTACGAGAACGC    248
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       181 aagatcctgttcggcctgttgcctaaggacagccaggactacgagaacgc    230

EMBOSS_001       249 CTTCATCGTCGGCAACTACCCGGCCGCCTGGCGCGAGCATTACGACCGGG    298
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       231 cttcatcgtcggcaactacccggccgcctggcgcgagcattacgaccggg    280

EMBOSS_001       299 CTGGCTACGCGCGGGTCGACCCGACGGTCAGTCACTGTACCCAGAGCGTA    348
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       281 ctggctacgcgcgggtcgacccgacggtcagtcactgtacccagagcgta    330

EMBOSS_001       349 CTGCCGATTTTCTGGGAACCGTCCATCTACCAGACGCGAAAGCAGCACGA    398
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       331 ctgccgattttctgggaaccgtccatctaccagacgcgaaagcagcacga    380

EMBOSS_001       399 GTTCTTCGAGGAAGCCTCGGCCGCCGGCCTGGTGTATGGGCTGACCATGC    448
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       381 gttcttcgaggaagcctcggccgccggcctggtgtatgggctgaccatgc    430

EMBOSS_001       449 CGCTGCATGGTGCTCGCGGCGAACTCGGCGCGCTGAGCCTCAGCGTGGAA    498
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       431 cgctgcatggtgctcgcggcgaactcggcgcgctgagcctcagcgtggaa    480

EMBOSS_001       499 GCGGAAAACCGGGCCGAGGCCAACCGTTTCATAGAGTCGGTCCTGCCGAC    548
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       481 gcggaaaaccgggccgaggccaaccgtttcatagagtcggtcctgccgac    530

EMBOSS_001       549 CCTGTGGATGCTCAAGGACTACGCACTGCAAAGCGGTGCCGGACTGGCCT    598
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       531 cctgtggatgctcaaggactacgcactgcaaagcggtgccggactggcct    580


EMBOSS_001       599 TCGAACATCCGGTCAGCAAACCGGTGGTTCTGACCAGCCGGGANAAGGAA    648
                     |||||||||||||||||||||||||||||||||||||||||||.||||||
EMBOSS_001       581 tcgaacatccggtcagcaaaccggtggttctgaccagccgggagaaggaa    630

EMBOSS_001       649 GTGTTGCAGTGGNGCGCCATCGGC-AGACCAGTTGGGAGANATCGGTTAT    697
                     ||||||||||||.||||||||||| |||||||||||||||.|||||||||
EMBOSS_001       631 gtgttgcagtggtgcgccatcggcaagaccagttgggagatatcggttat    680

EMBOSS_001       698 CTGCAACTGCTCGGAAGCCAATGTGAACTTCCATATGGGAAATANTNNNN    747
                     ||||||||||||||||||||||||||||||||||||||||||||.|....
EMBOSS_001       681 ctgcaactgctcggaagccaatgtgaacttccatatgggaaatattcggc    730

EMBOSS_001       748 GGAAGTTCGGNGTGACNNCNNN    			       769
                     ||||||||||.|||||..|...
EMBOSS_001       731 ggaagttcggtgtgacctcccg    752
VF2 Misaligned Sequence vs. Expected Sequence
  
          VF2: agttctggcaggtttggccgcgggttctttttggtacacgaaagc
     Expected: aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca
VR Complete Sequence (Reverse Complement)
NNNTACCTNCCAGTTCNGGCAGGNTTNGNCCNNGNGTTNTTTTTGGTNCNNGAAAGCTACTAGAGTCACNCAGGAAAGTACTAGATGCGTAAAGGAGAAGAACTTTTCAC
TGGAGTNGTCCCAATTNTGTTGAATTAGATGGTGATNNAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTT
ATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTT
TTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTG
TTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAA
CAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGT
CCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTA
CACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGT
GAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACC
CTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGNTCGGTCGTNNNNNNNNNNNNNNNNNNN
VR Alignment with BBa_K091134
Identity	919/941 (97.7%)

Similarity	919/941 (97.7%)

Gaps	3/941 ( 0.3%)


EMBOSS_001         1 NNNTACCTNCCAGTTCNGGCAGGNTTNGNCCNNGNGTTNTTTTTGGTNCN     50
                     ...|||||.|||||||.|||||| ||.|.||..|.|||.||||||||.|.
EMBOSS_001         1 ggctacctgccagttctggcagg-tttggccgcgggttctttttggtaca     49

EMBOSS_001        51 NGAAAGCTACTAGAGTCACNCAGGAAAGTACTAGATGCGTAAAGGAGAAG    100
                     .||||||||||||||||||.||||||||||||||||||||||||||||||
EMBOSS_001        50 cgaaagctactagagtcacacaggaaagtactagatgcgtaaaggagaag     99

EMBOSS_001       101 AACTTTTCACTGGAGTNGTCCCAATT-NTGTTGAATTAGATGGTGAT-NN    148
                     ||||||||||||||||.||||||||| .||||||||||||||||||| ..
EMBOSS_001       100 aacttttcactggagttgtcccaattcttgttgaattagatggtgatgtt    149

EMBOSS_001       149 AATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATA    198
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       150 aatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacata    199

EMBOSS_001       199 CGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTC    248
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       200 cggaaaacttacccttaaatttatttgcactactggaaaactacctgttc    249

EMBOSS_001       249 CATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCG    298
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       250 catggccaacacttgtcactactttcggttatggtgttcaatgctttgcg    299

EMBOSS_001       299 AGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCC    348
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       300 agatacccagatcatatgaaacagcatgactttttcaagagtgccatgcc    349

EMBOSS_001       349 CGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACT    398
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       350 cgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaact    399

EMBOSS_001       399 ACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGA    448
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       400 acaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaataga    449

EMBOSS_001       449 ATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACA    498
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       450 atcgagttaaaaggtattgattttaaagaagatggaaacattcttggaca    499

EMBOSS_001       499 CAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACA    548
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       500 caaattggaatacaactataactcacacaatgtatacatcatggcagaca    549

EMBOSS_001       549 AACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAA    598
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       550 aacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaa    599

EMBOSS_001       599 GATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGG    648
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       600 gatggaagcgttcaactagcagaccattatcaacaaaatactccaattgg    649

EMBOSS_001       649 CGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTG    698
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       650 cgatggccctgtccttttaccagacaaccattacctgtccacacaatctg    699

EMBOSS_001       699 CCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAG    748
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       700 ccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgag    749

EMBOSS_001       749 TTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATA    798
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       750 tttgtaacagctgctgggattacacatggcatggatgaactatacaaata    799

EMBOSS_001       799 ATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGAC    848
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       800 ataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagac    849

EMBOSS_001       849 TGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAG    898
                     ||||||||||||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       850 tgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagag    899

EMBOSS_001       899 TCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA    939
                     |||||||||||||||||||||||||||||||||||||||||
EMBOSS_001       900 tcacactggctcaccttcgggtgggcctttctgcgtttata    940

Conclusions

From the sequencing data alone, it appears that beyond the expected PLlac 0-1 promoter region, the part is otherwise constructed as reported. However, the lack of the PLlac 0-1 promoter region means that lasR will not be expressed and there we anticipate that there will be no response (i.e. fluorescence) to the presence of the autoinducer. To fix this part, the lasB and vector coding sequences upstream of lasR would need to be cut out and replaced with PLlac 0-1. This is predicted to restore the desired function to the part.

Retrieved from "http://2012.igem.org/Team:Georgia_Tech/Project"