Wet lab work-Thermosensor

From 2012.igem.org

(Difference between revisions)
 
Line 779: Line 779:
G12 30 (start = 6:36) (end = 8:25) (T = ) (OD600 = .159) (OD550 = -.015) (OD420 = .042)
G12 30 (start = 6:36) (end = 8:25) (T = ) (OD600 = .159) (OD550 = -.015) (OD420 = .042)
 +
 +
==September==
 +
 +
===September 17, 2012===
 +
Cloning for the iGEM registry
 +
All of our 11 new thermosensors using the following primers as well as the AraF and
 +
MglB mutant lactate sensors.
 +
 +
BI239 Prefix GBP,MglB forward
 +
ggcgaattcgcggccgcttctagATGAATAAGAAGGTGTTAACCCTG
 +
BI240 Suffix GGBP,MglB
 +
GGCCTG CAG CGG CCG CTA CTA GTATTATTTCTTGCTGAATTCAGCCAGG
 +
BI241 Prefix AraF
 +
ggcgaattcgcggccgcttctagATG CAC AAA TTT ACT AAA GCC C
 +
 +
BI242 iGEM suffix AraF reverse
 +
GCC CTG CAG CGG CCG CTA CTA GTA TTA CTT ACC GCC TAA ACC TTT TTT C
 +
BI243 Prefix TS forward
 +
ggcgaattcgcggccgcttctagagTTTAGCGTGACTTTCTTTCAACAGC
 +
BI244 suffix TS reverse
 +
gccCTG CAG CGG CCG CTA CTA GTATTGAGCGTTCATGTCTCATCC
 +
 +
===Sept 18, 2012===
 +
Ran all phusion PCR’s on gel…they all look great. Set up EcoRI/PSTI digests (also
 +
digest pSB1C3 purified by last years team.
 +
 +
===Sept 19, 2012===
 +
 +
Digests were run on gel. All digests look great! Cut out bands and ligate .
 +
 +
===Sept 20, 2012===
 +
Transform all ligations into DH5alpha – remember to select on LB-CAM NOT AMP!!!!
 +
 +
===Sept 21, 2012===
 +
Need to retransform, no colonies on plates!
 +
 +
===Sept 22===
 +
Retransformation looks great!
 +
 +
===Sept, 24===
 +
Clony PCR of all putative clones for registry. Most cloning gave 80% efficiency (see
 +
gel). Set up overnights to purify plasmids.
 +
 +
===Sept 25===
 +
Purify plasmids and submit for sequencing!
{{TeamBYUProvoFooter}}
{{TeamBYUProvoFooter}}

Latest revision as of 03:08, 4 October 2012

Team BYU Provo

Contents

April

4/24/12

Set up restriction digest of plasmid containing pBAD promoter, TSA, and LacZ to remove the thermosensor and insert a control thermosensor.


74-1JAR Restriction Digest

14ul ddH20

5ul NEB buffer 2

0.5ul 100x BSA

30 ul TSA plasmid pIG33

2ul PST1

2ul HindIII

ran product on low melt gel


74-1JAR Ligation


6.5ul ddH2O

1.5ul T4 DNA ligase

1 ul T4 DNA Ligase

3 ul vector (GS 74-1)

3 ul insert (TS control)

At room temp 30 min

Transformation

May

5/15/2012

Today we started the random mutagenesis screen. We used Protocol 2 for GBI Mutagenesis

First I (John) made 40 μL of 10 mM C/T stock

Protocol:

4 μL C 100 mm stock

4 μL T 100 mm stock

32 μL ddH2O

Then we made 50 μL of 2 mM G/A stock

Protocol:

1 μL G 100 mm stock

1 μL A 100 mm stock

48 μL ddH2O

Then we did the Mutagenesis (Protocol 2 for GBI Mutagenesis) (5x)

106 μL dd H2O

20 μL 10X ThermoPol buffer

15 μL 10 mM C/T stock

5 μL 2 mM G/A stock

15 μL JG54 (primer)

15 μL JG47 (primer)

10 μL template (TSA-Wild type and 5-3 in the other-there are 2 test tubes - this is the only difference between the two)

2 μL Taq Polymerase (NEB)

20 μL 5 mM MnCl2 (added at the very end)

(This entire protocol was the original mix x5)

5/18/2012

Today we did the random mutagenesis screen again, making much more and putting it into 20 tubes. Here is the Protocol 2 for GBI Mutagenesis (15x)

First I (John) made 200 μL of 10 mM C/T stock

Protocol:

20 μL C 100 mm stock

20 μL T 100 mm stock

160 μL ddH2O

Then we made 100 μL of 2 mM G/A stock

Protocol:

2 μL G 100 mm stock

2 μL A 100 mm stock

96 μL ddH2O

Then we did the Mutagenesis (Protocol 2 for GBI Mutagenesis)

318 μL dd H2O

60 μL 10X ThermoPol buffer

45 μL 10 mM C/T stock

15 μL 2 mM G/A stock

45 μL JG54 (primer)

45 μL JG47 (primer)

30 μL template (TSA-Wild type and 5-3 in the other-there are 2 test tubes - this is the only difference between the two)

6 μL Taq Polymerase (NEB)

60 μL 5 mM MnCl2 (added at the very end)

(This entire protocol was the original mix x5)

File:Thermosensor Random Mutagenesis 5-25.jpg
Jordan's PCR product 5/25 Thermosensor screen

This was done for the 2 different templates and put into 20 tubes (30 μL per tube) per template. This gives us a total of 40 tubes.

5/25/2012

Today we ran it out on a gel. Here is the order: ladder, control, TSA, 5-3.

Here it is: (left)

5/29/2012

Restriction Digest today (Jordan and John)

For plasmid backbone (vector):

10 μL buffer

1 μL BSA

83 μL plasmid (pIG33 TSA)

3 μL each enzyme (PstI and HindIII)

For insert:

16.5 μL H2O

25 μL buffer

2.5 μL BSA

200 μL insert (TSA and 5-3)

6 μL each enzyme (PstI and HindIII)

Put them to incubate at 37°C for 2 hours.


5/31/2012

Ran out the restriction digests on a low melt agarose gel.

File:Random Mutagenesis TSA + 5-3.jpg
Restriction digests of TSA, 5-3, and pIG 33





Not sure if the restriction enzymes cut.... Faint bands at around 200 bp, so I think it did. Cut out the distinct bands from the gel.


Next step: ligation and transformation. (Be sure to set up backbone-only control for the ligation to compare transformation efficiency.)


June

6/1/2012

Ligation reaction

6.5 μL sterile H20

1.5 μL 10X ligase buffer

3 μL vector

3 μL insert

1 μL T4 DNA Ligase


Gel slices were gathered in two separate tubes for the mutated TSA insert and the backbone (pIG 33). Did a negative control (ligation with just the backbone, no insert.)


Next step: transform them into DH5α! Test negative control ligation's transformation efficiency versus the ligations with the insert's.


E. coli Transformation:

Thaw DH5α on ice (25 μL per transformation)

Add 2 μL of ligation reaction to each tube of competent E. coli.

Heatshock for 1 min. @ 42°C and place back on ice.

Add 500 μL LB to each tube.

Incubate @ 37 °C for 30 min.

Plate on LB + amp.


6/4/2012

The plates did not look right, so we are redoing the ligation (John and Jordan) with Dr. Grose. We think maybe the gel wasn't cut thin enough.

First we made a master mix (x5)

32.5 μL dd H2O

7.5 μL 10X ligase buffer (includes ATP)

5 μL T4 DNA ligase

We added 9 microliters of this master mix to each of the 5 tubes.

Then we added vector and insert appropriately to each one (TSA-1, TSA-2, 5-3 and controls for each of 2 backbone mixes).


6/5/2012

The plates looked better, but we are worried the backbone didn't turn out right, so we are redoing that. The insert should be fine, though.

Restriction digest on backbone:

10 μL buffer

1 μL BSA

83 μL plasmid (pIG33 TSA)

3 μL each enzyme (PstI and HindIII)


6/8/2012

After redoing the restriction digest of the backbone and getting a much thinner slice of gel, the ligations work many times better. The next step is a small trial screen.


Screen procedure:

E. coli transformations of ligation reaction into DH5α.

Plate the transformations on LB+amp+arabinose+xgal.

Two ways to screen plates (want to do both):

1.Grow for about 2 days at 30 °C.

 Mark all clear colonies or mark all blue colonies. (Make some way to keep track of the colonies.)
  Switch plates to 37 °C and check every couple of hours.

2.Grow plates for 1 day at 37 °C

 Switch plates to 42 °C. Check previously marked clear colonies for color change.

Ones that turn blue are the interesting ones. Keep your eyes on those!!


6/11/12

Growing Plates at 37°C for 2 days didn't work very well, but 30°C worked, we will shift them at 37°C and go ahead with a screen @ 30°C.

Ligation:

30 μL ligation reactions of TSA-1, TSA-2, and 5-3.


6/18/12

Did E. coli transformation of the 30 μL ligation reactions of TSA-1, TSA-2, and 5-3. (Did around 40 plates total, around 12 - 14 plates for each one.

Placed most at 30°C but put a few in at 37°C.


6/19/12

Checked the plates. The plates being screened at 30°C are not nearly grown up enough to check. The 37°C plates did grow up, but the colonies are not large.

Placed a test plate of TSA-1, TSA-2, and 5-3 in the 37°C. (They were grown over the weekend at 30°C. Marked the white/not blue colonies with black sharpie. Check periodically throughout the day.

Put in: 10:30 a.m.

Checking times:

1. 12:30 p.m.

2. 2:30 p.m.

3. 4:30 p.m.


More Ligations

30 μl ligations of TSA-1, TSA-2, and 5-3.


13 μL H20

3 μL 10X Ligase Buffer

6 μL vector

6 μL insert

2 μL T4 DNA Ligase


6/21/12

Thermosensor screen: shift plates grown at 30 to the 42. Check periodically.

Timetable is as follows:

1st-> 12:00 p.m.

2nd-> 5:00 p.m.

3rd-> Friday morning 10:00 a.m.


Color code:

Black-> colony blue initially

Purple-> 12:00 pm blue (4:00 pm)

Red-> 5:00 pm blue (8:00 am)

Green-> 10:00 am blue (12:00 am)

Orange-> white initially


6/27/2012

12:00 initial: Black

2:00 pm: John, Green

4:00 pm: Jordan, Red

6:00 pm: Brooke, Yellow

8:00 pm: Jordan, Blue

10:00 pm: Brooke, brown


Next day

8:00 am: Jordan, Purple

2:00 pm: All of us! Orange

July

7/9/2012

We patched green red and yellow onto plates, then identified which ones had a good change from 30 to 37 and 37 to 41. Then we took these and streaked them out on plates again.


7/10/2012

3 ligations today (with a new mutagenic PCR that Dr. Grose used)

-Just backbone

-backbone and TSA

-backbone and 5-3

13 μL H20

3 μL 10X Ligase Buffer

6 μL vector

6 μL insert

2 μL T4 DNA Ligase

Then we transformed the vectors into E. Coli!!!

Thaw DH5α on ice (25 μL per transformation)

Add 2 μL of ligation reaction to each tube of competent E. coli.

Heatshock for 1 min. @ 42°C and place back on ice.

Add 500 μL LB to each tube.

Incubate @ 37 °C for 30 min.

Plate on LB + amp.


7/10/2012

Plates were checked with controls, and the following appear to be good candidates for the database:

5-3G9, 5-3G10, 5-3G11, 5-3R2, 5-3P1, 5-3P2, 5-3P3, 5-3P4, 5-3P5, 5-3P6, 5-3P8, 5-3P10, 5-3P12

Need to make overnights of these and purify plasmids when possible.


7/16/2012

12:00 initial: Black

3:00 pm: Jordan, Green

5:00 pm: Karl, Red

7:00 pm: Dean, Yellow

9:00 pm: Brooke, Blue


Next day

8:00 am: Jordan, Purple

12:00 pm: All of us! Orange

7/25/2012

Catch up:

Lots more patching and streaking

We did a new screen using special Grose PCR methods (see Dr. Grose for details).

More patching and streaking.

We are going to start doing Beta-Gal Assays. Today we are preparing 3 (one is a blank-to assure that contamination does not occur) overnights.

Protocol: 6 mL of LB with amp and arabinose Swipe a single colony (one from TSA, one from 5-3) and place into LB (a blank tip that was not swiped was placed in our blank LB)

Reagents for B-gal assays:

4 mg/mL ONPG (Substrate): Dissolve 4 mg substrate into 1 mL of Phosphate Buffer.

Z buffer:

Stop buffer (Phosphate buffer):

Chloroform and 0.1% SDS


Assay Protocol

Day 1: Start overnight cultures in LB+amp+arabinose

Day 2: Dilute cells early 1/100 in more LB+amp+arabinose and incubate at 30, 35, & 37 C (and in the future at 40) until they reach mid-log phase (should take 3 hr and 45 min for 30 C, 3 hr for 37 C, somewhere in between for 35 C and somewhere less than 3 for 40 C). You also need to make ONPG fresh the day the assays are to be done.

Preparation of cells:

Incubate cultures on ice for 20 minutes to stop growth and wash as follows:

Pellet 5 mL of cells at 4 C by centrifuging at 4,000 rpm (protocol says in Sorval SS34 rotor) for 10 min.

Pour off supernatant

Resuspend the cell pellet into 1.1 mL of chilled Z buffer.

Measure OD600 of cultures by diluting 100 μL into 900 of Z buffer.


Next, permeabilize 1 mL of cells by adding 100 uL chloroform and 50 uL 0.1% SDS. Note: Chloroform is easier to pippete if the air in the pippete tip is saturated-do this by drawing up and releasing chloroform several times.

Vortex and equilibrate the tubes 5 minutes in a 28 C water bath.


Assay

To start the reaction, add 0.2 mL substrate ONPG (o-nitrophenyl-B-D-galactoside)

Vortex and RECORD THE TIME OF ADDITION PRECISELY WITH TIMER OR STOPWATCH. This may take anywhere from 30 minutes to overnight, depending on the temperatures of incubation and the assayed thermoswitch.

Incubate cells at various temperatures.

Stop the reaction after yellow color develops by adding 0.5 mL 1 M Na2CO3.

Vortex and RECORD THE TIME PRECISELY.

Transfer to a new tube, spin 5 minutes at maximum speed to remove debris and chloroform.

Record the OD420 and OD550 for each tube.

Finish calculations.

7/26/2012

We calibrated the spectrophotometer, then measured the amount of bacteria. They were at 1.04 (mid-log phase is between .5 and 1, so we are barely okay). We did it wrong, though, so we are redoing it tomorrow (forgot to grow at different temperatures (30, 35 and 37).

We pulled them out at mid-log phase (.5-1) (around 3 hours - some took longer than others) and put them on ice for 20 min.

We made ONPG mixture (8 mg of ONPG and s mL of the phosphate buffer).

We made .1% SDS.

We then Followed the protocol exactly (see above)

Mid-log phases: ( times started at 9:45 a.m.)

5-3 30 C .064 2:15 p.m.

5-3 35 C .057 1:12 p.m.

5-3 37 C .109 1:10 p.m.

TSA 30 C .051 2:16 p.m.

TSA 35 C .051 1:40 p.m.

TSA 37 C .079 1:10 p.m.

OD600's

5-3 30 C .195

5-3 35 C .175

5-3 37 C .298

TSA 30 C .217

TSA 35 C .359

TSA 37 C .212

Reaction (adding ONPG)

5-3 30 C (start time = 3:11) (end time = 1:02) (OD420 = .16) (OD550 = .04) (T = 4206 minutes) (V = 1.75) (V measured at end)

5-3 35 C (start time = 3:12) (end time = 5:36) (OD420 = .630) (OD550 = .018) (T = 145 minutes) (V = 1.9 mL)

5-3 37 C (start time = 3:12) (end time = 5:36) (OD420 = .569) (OD550 = .017) (T = 145 minutes) (V = 1.9 mL)

TSA 30 C (start time = 3:11) (end time = 8:12) (OD420 = .559) (OD550 = .009) (T = 1021 minutes) (V = 1.75 mL)

TSA 35 C (start time = 3:11) (end time = 5:36) (OD420 = 1.381) (OD550 = .015) (T = 145 minutes) (V = 1.8 mL)

TSA 37 C (start time = 3:11) (end time = 5:36) (OD420 = .519) (OD550 = .011) (T = 145 minutes) (V = 1.85 mL)

Miller Units = 1000*(OD420-1.75*OD550)/(T*V*OD600)

5-3 30 C = 1000*(.16-1.75*.04)/(4206*1.75*.195) = .0627

5-3 35 C = 1000*(.63-1.75*.018)/(145*1.9*.175) = 12.4138

5-3 37 C = 1000*(.569-1.75*.017)/(145*1.9*.298) = 6.5683

TSA 30 C = 1000*(.559-1.75*.009)/(1021*1.75*.217) = 1.4011

TSA 35 C = 1000*(1.381-1.75*.015)/(145*1.8*.359) = 14.4585

TSA 37 C = 1000*(.519-1.75*.011)/(145*1.85*.212) = 8.7877

7/30/2012

More transformations of same ligations from PCR that Dr. Grose did (5-3 and TSA)

Let them grow

August

8/2/2012

More Beta-gal assays today on 12 different samples we had saved from screens before.

We grew up the 12 + 1 control in 30, 35 and 37 and tested for mid-log phase. They started growing at 9:15 a.m. and we checked for mid-log phase at 12:13 p.m.

For 35 two of the mid log phases (OD 600) were .237 and .497 (way too far gone)

For 37 two of the mid log phases were .101 and .060 (right in mid-log phase)

For 30 one of the mid log phases was .012

Only the 37's are ready at this point, so we are doing the assay with them (same protocol as above). Here are the 13 different species:

TSA 37 (OD600 = .159) (start time = 2:17 p.m.)

P1 37 (OD600 = .125) (start time = 2:17 p.m.)

P2 37 (OD600 = .161) (start time = 2:15 p.m.)

P3 37 (OD600 = .095) (start time = 2:18 p.m.)

P4 37 (OD600 = .054) (start time = 2:18 p.m.)

P5 37 (OD600 = .129) (start time = 2:16 p.m.)

P8 37 (OD600 = .101) (start time = 2:16 p.m.)

P10 37 (OD600 = .080) (start time = 2:17 p.m.)

P12 37 (OD600 = .202) (start time = 2:19 p.m.)

G9 37 (OD600 = .107) (start time = 2:18 p.m.)

G10 37 (OD600 = .133) (start time = 2:19 p.m.)

G12 37 (OD600 = .092) (start time = 2:19 p.m.)

5-3 37 (OD600 = .157) (about a .06 difference when it was turned) (start time = 2:19 p.m.)

We checked the reading on one of the 30's again (1:14): .023 They still need more time.

We think some of the OD600 readings were taken wrong, so we may correct for lower values at the end.

TSA 37 (1.5 mL) (OD550 = .031, OD420 = .731) (stop time = 4:12 p.m.)

P1 37 (1.5 mL) (OD550 = .032, OD420 = 1.686 ) (stop time = 4:12 p.m.)

P2 37 (1.5 mL) (OD550 = .035, OD420 = .351 ) (stop time = 4:13 p.m.) DILUTED 9:1

P3 37 (1.5 mL) (OD550 = .040 , OD420 = .136 ) (stop time = 4:08 p.m.) DILUTED 9:1

P4 37 (1.5 mL) (OD550 = .033 , OD420 = .113 ) (stop time = 4:13 p.m.) DILUTED 9:1

P5 37 (1.5 mL) (OD550 = .046 , OD420 = .770 ) (stop time = 4:15 p.m.)

P8 37 (1.5 mL) (OD550 = .048 , OD420 = 1.650 ) (stop time = 4:15 p.m.)

P10 37 (1.5 mL) (OD550 = .044 , OD420 = 1.031 ) (stop time = 4:09 p.m.)

P12 37 (1.5 mL) (OD550 = .039 , OD420 = .303 ) (stop time = 4:10 p.m.) DILUTED 9:1

G9 37 (1.5 mL) (OD550 = .030 , OD420 = .228 ) (stop time = 4:14 p.m.) DILUTED 9:1

G10 37 (1.5 mL) (OD550 = .038 , OD420 = .130 ) (stop time = 4:07 p.m.) DILUTED 9:1

G12 37 (1.5 mL) (OD550 = .028 , OD420 = .188 ) (stop time = 4:11 p.m.) DILUTED 9:1

5-3 37 (1.5 mL) (OD550 = .033 , OD420 = .510 ) (stop time = 4:11 p.m.)

This B-gal basically failed, so we are doing it again


8/7/2012

Redoing that same B-gal (started growing at 8 or 9 in the morning. All other times are p.m.) (V = 1.75)

TSA 37 (start = 4:30) (end = 5:04) (T = 34) (OD600 = 0.354) (OD550 = .012) (OD420 = .086)

5-3 37 (start = 4:29) (end = 5:04) (T = 35) (OD600 = 0.294) (OD550 = -.002) (OD420 = .092)

P1 37 (start = 4:30) (end = 5:04) (T = 34) (OD600 = 0.265) (OD550 = .003) (OD420 = .093)

P2 37 (start = 4:29) (end = 5:02) (T = 33) (OD600 = 0.237) (OD550 = -.002) (OD420 = .150)

P3 37 (start = 4:26) (end = 5:05) (T = 39) (OD600 = 0.264) (OD550 = .006) (OD420 = .176)

P4 37 (start = 4:30) (end = 5:03) (T = 33) (OD600 = 0.256) (OD550 = -.024) (OD420 = .109)

P5 37 (start = 4:28) (end = 5:04) (T = 36) (OD600 = 0.263) (OD550 = -.005) (OD420 = .096)

P8 37 (start = 4:31) (end = 5:03) (T = 32) (OD600 = 0.290) (OD550 = .008) (OD420 = .127)

P10 37 (start = 4:29) (end = 5:03) (T = 34) (OD600 = 0.246) (OD550 = .011) (OD420 = .090)

P12 37 (start = 4:27) (end = 5:05) (T = 38) (OD600 = 0.266) (OD550 = .002) (OD420 = .142)

G9 37 (start = 4:27) (end = 5:04) (T = 37) (OD600 = 0.282) (OD550 = .005) (OD420 = .144)

G10 37 (start = 4:27) (end = 5:05) (T = 38) (OD600 = 0.272) (OD550 = -.025) (OD420 = .086)

G12 37 (start = 4:28) (end = 5:05) (T = 37) (OD600 = 0.217) (OD550 = .011) (OD420 = .077)

TSA 35 (start = 4:28) (end = 8:41) (T = ) (OD600 = .282) (OD550 = -.003) (OD420 = .482)

5-3 35 (start = 4:31) (end = 8:41) (T = ) (OD600 = .240) (OD550 = .008) (OD420 = .431)

P1 35 (start = 4:29) (end = 5:06) (T = 37) (OD600 = .286) (OD550 = .015) (OD420 = .049)

P2 35 (start = 4:30) (end = 5:06) (T = 36) (OD600 = .260) (OD550 = -.024) (OD420 = .101)

P3 35 (start = 4:29) (end = 5:06) (T = 37) (OD600 = .285) (OD550 = -.026) (OD420 = .104)

P4 35 (start = 4:36) (end = 5:05) (T = 29) (OD600 = .263) (OD550 = .010) (OD420 = .076)

P5 35 (start = 4:36) (end = 5:06) (T = 30) (OD600 = .255) (OD550 = .010) (OD420 = .041)

P8 35 (start = 4:26) (end = 5:07) (T = 41) (OD600 = .221) (OD550 = -.014) (OD420 = .054)

P10 35 (start = 4:28) (end = 5:07) (T = 39) (OD600 = .296) (OD550 = -.014) (OD420 = .035)

P12 35 (start = 4:26) (end = 5:07) (T = 41) (OD600 = .262) (OD550 = .018) (OD420 = .076)

G9 35 (start = 4:37) (end = 5:06) (T = 29) (OD600 = .289) (OD550 = .017) (OD420 = .081)

G10 35 (start = 4:28) (end = 5:07) (T = 39) (OD600 = .276) (OD550 = -.003) (OD420 = .028)

G12 35 (start = 4:27) (end = 5:07) (T = 40) (OD600 = .165) (OD550 = -.006) (OD420 = .010)

TSA 30 (start = 6:38) (end = 8:40) (T = ) (OD600 = .215) (OD550 = .004) (OD420 = .694) (not diluted)

5-3 30 (start = 6:37) (end = ) (T = ) (OD600 = .218) (OD550 = ) (OD420 = )

P1 30 (start = 6:39) (end = 8:24) (T = ) (OD600 = .284) (OD550 = -.011) (OD420 = .036)

P2 30 (start = 6:38) (end = 7:51) (T = ) (OD600 = .196) (OD550 = .010) (OD420 = .082)

P3 30 (start = 6:37) (end = 7:51) (T = ) (OD600 = .176) (OD550 = .006) (OD420 = .048)

P4 30 (start = 6:38) (end = 7:52) (T = ) (OD600 = .263) (OD550 = .015) (OD420 = .094)

P5 30 (start = 6:35) (end = 8:24) (T = ) (OD600 = .195) (OD550 = -.008) (OD420 = .057)

P8 30 (start = 6:34) (end = 7:51) (T = ) (OD600 = .190) (OD550 = .009) (OD420 = .094)

P10 30 (start = 6:39) (end = 8:25) (T = ) (OD600 = .196) (OD550 = -.015) (OD420 = .045)

P12 30 (start = 6:35) (end = 7:51) (T = ) (OD600 = .208) (OD550 = -.002) (OD420 = .067)

G9 30 (start = 6:36) (end = 7:50) (T = ) (OD600 = .296) (OD550 = .013) (OD420 = .046)

G10 30 (start = 6:36) (end = 8:39) (T = ) (OD600 = .232) (OD550 = .000) (OD420 = .584) (not diluted)

G12 30 (start = 6:36) (end = 8:25) (T = ) (OD600 = .159) (OD550 = -.015) (OD420 = .042)

September

September 17, 2012

Cloning for the iGEM registry All of our 11 new thermosensors using the following primers as well as the AraF and MglB mutant lactate sensors.

BI239 Prefix GBP,MglB forward ggcgaattcgcggccgcttctagATGAATAAGAAGGTGTTAACCCTG BI240 Suffix GGBP,MglB GGCCTG CAG CGG CCG CTA CTA GTATTATTTCTTGCTGAATTCAGCCAGG BI241 Prefix AraF ggcgaattcgcggccgcttctagATG CAC AAA TTT ACT AAA GCC C

BI242 iGEM suffix AraF reverse GCC CTG CAG CGG CCG CTA CTA GTA TTA CTT ACC GCC TAA ACC TTT TTT C BI243 Prefix TS forward ggcgaattcgcggccgcttctagagTTTAGCGTGACTTTCTTTCAACAGC BI244 suffix TS reverse gccCTG CAG CGG CCG CTA CTA GTATTGAGCGTTCATGTCTCATCC

Sept 18, 2012

Ran all phusion PCR’s on gel…they all look great. Set up EcoRI/PSTI digests (also digest pSB1C3 purified by last years team.

Sept 19, 2012

Digests were run on gel. All digests look great! Cut out bands and ligate .

Sept 20, 2012

Transform all ligations into DH5alpha – remember to select on LB-CAM NOT AMP!!!!

Sept 21, 2012

Need to retransform, no colonies on plates!

Sept 22

Retransformation looks great!

Sept, 24

Clony PCR of all putative clones for registry. Most cloning gave 80% efficiency (see gel). Set up overnights to purify plasmids.

Sept 25

Purify plasmids and submit for sequencing!