|
|
| (21 intermediate revisions not shown) |
| Line 3: |
Line 3: |
| | [[File:Bacillus BioBrick Box banner.resized WORDS.JPG|620px|link=]] | | [[File:Bacillus BioBrick Box banner.resized WORDS.JPG|620px|link=]] |
| | | | |
| - | [[Image:BacillusBioBrickBox.png|100px|right|link=Team:LMU-Munich/Team:LMU-Munich/Bacillus_BioBricks]]
| |
| | | | |
| | + | [[Image:BacillusBioBrickBox.png|100px|right|link=]] |
| | | | |
| - | =='''B<sup>4</sup>''' - 22 core parts for ''Bacillus subtilis''==
| |
| | | | |
| - | A major goal of our iGEM project is to [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction introduce ''B. subtilis''] as a new chassis for BioBrick-based Synthetic Biology. For that purpose, we created a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry to make it accessible to many more future iGEM-Teams! This ''<b>Bacillus'' B</b>io<b>B</b>rick <b>B</b>ox ('''B<sup>4</sup>''') contains the following ''Bacillus'' specific parts: | + | |
| | + | =='''B<sup>4</sup>''' - 22 core parts for ''Bacillus subtilis''== |
| | + | <br> |
| | + | <p align="justify">A major goal of our iGEM project is to [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction introduce ''B. subtilis''] as a new chassis for BioBrick-based synthetic biology. For that purpose, we created a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry to make it accessible to many more future iGEM-teams and the entire public microbiology domain! This ''<b>Bacillus'' B</b>io<b>B</b>rick <b>B</b>ox ('''B<sup>4</sup>''') contains the following ''Bacillus'' specific parts:</p> |
| | | | |
| | | | |
| Line 14: |
Line 16: |
| | {| width="100%" | | {| width="100%" |
| | | | |
| - | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]''' | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Vectors|Vectors]]''' |
| - | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Promoters|Promoters]]''' | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Promoters|Promoters]]''' |
| - | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Reporters|Reporters]]''' | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Reporters|Reporters]]''' |
| - | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Affinity_Tags|Affinity tags]] | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Tags|Affinity tags]] |
| | |- | | |- |
| | |[[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]] | | |[[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]] |
| Line 51: |
Line 53: |
| | </div> | | </div> |
| | | | |
| - | Since ''Bacillus subtilis'' is not an organism commonly used in iGEM, please check out our [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction Introduction].
| |
| | | | |
| - | ==''Bacillus'' Vectors [[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]==
| |
| | | | |
| | + | [[File:NEXT.png|right|80px|link=Team:LMU-Munich/Germination_Stop]] [[File:BACK.png|left|80px|link=Team:LMU-Munich/Data/differentiation_tour]] |
| | | | |
| - | <p align="justify"> We have generated a suit of BioBrick-compatible vectors: three empty insertional backbones with different antibiotic resistances and integration loci, two reporter and two expression vectors. Here is a list of all the vectors we cloned and used.</p>
| |
| | | | |
| | | | |
| - | {| class="colored"
| |
| - | |-
| |
| - | !Vector Name
| |
| - | !colspan="2"|Resistance
| |
| - | !Insertion
| |
| - | !Description
| |
| - | !colspan="2"|Vector origin
| |
| - | |-
| |
| - | !<font color="#EBFCE4" size="2">BioBrick</font>
| |
| - | !''Eco''
| |
| - | !''Bsu''
| |
| - | !locus
| |
| - | !
| |
| - | !Name
| |
| - | !Reference
| |
| - | |-
| |
| - | !pSB<sub>''Bs''</sub>1C [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823023 <font color="#EBFCE4" size="2">(BBa_K823023)</font>]
| |
| - | |Amp
| |
| - | |Cm
| |
| - | |''amyE''
| |
| - | |empty
| |
| - | |pDG1662
| |
| - | |[http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury]
| |
| - | |-
| |
| - | !pSB<sub>''Bs''</sub>4S [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823022 <font color="#EBFCE4" size="2">(BBa_K823022)</font>]
| |
| - | |Amp
| |
| - | |Spec
| |
| - | |''thrC''
| |
| - | |empty
| |
| - | |pDG1731
| |
| - | |[http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury]
| |
| - | |-
| |
| - | !pSB<sub>''Bs''</sub>2E [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823027 <font color="#EBFCE4" size="2">(BBa_K823027)</font>]
| |
| - | |Amp
| |
| - | |MLS
| |
| - | |''lacA''
| |
| - | |empty
| |
| - | |pAX01
| |
| - | |[http://www.ncbi.nlm.nih.gov/pubmed/11274134 Härtl]
| |
| - | |-
| |
| - | !pSB<sub>''Bs''</sub>1C-<i>lac</i>Z [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823021 <font color="#EBFCE4" size="2">(BBa_K823021) </font>]
| |
| - | |Amp
| |
| - | |Cm
| |
| - | |''amyE''
| |
| - | |<i>lacZ</i> reporter
| |
| - | |pAC6
| |
| - | |[http://www.ncbi.nlm.nih.gov/pubmed/11902727 Stülke]
| |
| - | |-
| |
| - | !pSB<sub>''Bs''</sub>3C-<i>lux</i>ABCDE [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823025 <font color="#EBFCE4" size="2">(BBa_K823025)</font>]
| |
| - | |Amp
| |
| - | |Cm
| |
| - | |''sacA''
| |
| - | |<i>luxABCDE</i> reporter
| |
| - | |pAH328
| |
| - | |[http://www.ncbi.nlm.nih.gov/pubmed/20709900 Schmalisch]
| |
| - | |-
| |
| - | !pSB<sub>''Bs''</sub>4S-P<sub><i>Xyl</i></sub> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823024 <font color="#EBFCE4" size="2">(BBa_K823024)</font>]
| |
| - | |Amp
| |
| - | |Spec
| |
| - | |''thrC''
| |
| - | |Xylose-promoter
| |
| - | |pXT
| |
| - | |[http://www.ncbi.nlm.nih.gov/pubmed/11069659 Derré]
| |
| - | |-
| |
| - | !pSB<sub>''Bs''</sub>0K-P<sub><i>spac</i></sub> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823026 <font color="#EBFCE4" size="2">(BBa_K823026)</font>]
| |
| - | |Amp
| |
| - | |Kan
| |
| - | |replicative
| |
| - | |IPTG-promoter
| |
| - | |pDG148
| |
| - | |[http://www.ncbi.nlm.nih.gov/pubmed/11728721 Joseph]
| |
| - | |-
| |
| - | !'''Sporo'''vector [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823054 <font color="#EBFCE4" size="2">(BBa_K823054)</font>]
| |
| - | |Amp
| |
| - | |Spec
| |
| - | |''thrC''
| |
| - | |to create [https://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins '''Sporo'''beads]
| |
| - | |pSB<sub>''Bs''</sub>4S
| |
| - | |[[Team:LMU-Munich/Bacillus_BioBricks/Sporovector|'''Sporo'''vector]]
| |
| - | |-
| |
| - | |}
| |
| - | <br>
| |
| - | <p align="justify">For the use of our vectors please see our [[Team:LMU-Munich/Lab_Notebook/Protocols|Protocols]] page. A general introduction to [[Team:LMU-Munich/Bacillus Introduction |''Bacillus subtilis'']] and its integrative vectors can be found [[Team:LMU-Munich/Bacillus_BioBricks/integration|here]]. All vectors have ampicillin as <i>Escherichia coli</i> resistance and RFP in the multiple cloning site as selection marker.</p>
| |
| | | | |
| | | | |
| - | The corresponding vector maps:
| |
| | | | |
| - | {|
| |
| - | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/e/e0/LMU-Munich-PSBBs1C.png" height=130"/></a></html>
| |
| - | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/2/2a/LMU-Munich-PSBBs4S.png" height=130"/></a></html>
| |
| - | |-
| |
| - | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/4/46/LMU-Munich-PSBBs2E.png" height=130"/></a></html>
| |
| - | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/0/04/LMU-Munich-PSBBs1C-lacZ.png" height=130"/></a></html>
| |
| - | |-
| |
| - | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/f/fc/LMU-Munich-PSBBs3C-luxABCDE.png" height=130"/></a></html>
| |
| - | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/d/de/LMU-Munich-PSBBs4S-Pxyl.png" height=130"/></a></html>
| |
| - | |-
| |
| - | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/0/03/LMU-Munich-PSBBs0K-Pspac.png" height=130"/></a></html>
| |
| - | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/a/ab/LMU-Munich-Sporovector.png" height=130"/></a></html>
| |
| - | |-
| |
| - | |}
| |
| | | | |
| | | | |
| | | | |
| - | <p align="justify">The number in the vector's name codes for the insertion locus and the following letter for the <i> Bacillus subtilis </i> resistance gene according to the following table:</p> | + | <p align="justify">Since ''Bacillus subtilis'' is not an organism commonly used in iGEM, please check out our [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction Introduction] to learn more about it.</p> |
| - | | + | |
| - | | + | |
| - | {| class="colored"
| + | |
| - | |-
| + | |
| - | !Number
| + | |
| - | !Insertion locus
| + | |
| - | !Letter
| + | |
| - | !Resistance
| + | |
| - | |-
| + | |
| - | !0
| + | |
| - | |replicative
| + | |
| - | !C
| + | |
| - | |Chloramphenicol (Cm)
| + | |
| - | |-
| + | |
| - | !1
| + | |
| - | |''amyE'' (amylase)
| + | |
| - | !E
| + | |
| - | |MLS (Erythromycin + Lincomycin)
| + | |
| - | |-
| + | |
| - | !2
| + | |
| - | |''lacA'' (β-galactosidase)
| + | |
| - | !K
| + | |
| - | |Kanamycin (Kan)
| + | |
| - | |-
| + | |
| - | !3
| + | |
| - | |''sacA'' (sucrase)
| + | |
| - | !S
| + | |
| - | |Spectinomycin (Spec)
| + | |
| - | |-
| + | |
| - | !4
| + | |
| - | |''thrC'' (threonine synthase)
| + | |
| - | |
| + | |
| - | |
| + | |
| - | |-
| + | |
| | | | |
| | + | <div class="box"> |
| | + | ==''Bacillus'' Vectors [[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]== |
| | + | {| "width=100%" style="text-align:center;" style="align:right"| |
| | + | |<p align="justify">We have generated a suite of BioBrick-compatible vectors: three empty insertional backbones with different antibiotic resistances and integration loci, two reporter and two expression vectors.</p> |
| | + | |[[File:LMU-Munich-PSBBs1C.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Vectors]] |
| | |- | | |- |
| | + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Vectors]] |
| | |} | | |} |
| | + | </div> |
| | | | |
| - | | + | <div class="box"> |
| - | <p align="justify">The concentrations of the antibiotics for selection of ''B.subtilis'' transformation and tests for plasmid insertion can be found in our [https://2012.igem.org/Team:LMU-Munich/Lab_Notebook/Protocols Protocol] section.</p> | + | |
| - | | + | |
| - | <p align="justify">See [[Team:LMU-Munich/Bacillus_BioBricks/vector_use| here]] to find out how to use ''B. subtilis'' vectors. In this [[Team:LMU-Munich/Bacillus_BioBricks/integration|overview]], the integration mechanism of ''B. subtilis'' vectors is described.</p>
| + | |
| - | | + | |
| - | The design and special use of our Sporovector can be found [[Team:LMU-Munich/Bacillus_BioBricks/Sporovector |here]].
| + | |
| - | | + | |
| - | For results, check out our Data page: [[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Data/Vectors]]
| + | |
| - | | + | |
| - | | + | |
| - | | + | |
| | ==''Bacillus'' Promoters [[File:LMU PromoterIconBC.png|100px]]== | | ==''Bacillus'' Promoters [[File:LMU PromoterIconBC.png|100px]]== |
| - | | + | {| "width=100%" style="align:right"| |
| - | <p align="justify">To provide a set of promoters of different strength we characterized several promoters in ''Bacillus subtilis''. They can be divided in three different groups: | + | | |
| - | *the constitutive promoters from the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] from the Partsregistry
| + | <p align="justify">To provide a set of promoters of different strength we characterized several promoters in ''Bacillus subtilis''. Both constitutive and inducible promoters are covered.</p> |
| - | *the constitutive promoters P<sub>''liaG''</sub>, P<sub>''veg''</sub> and P<sub>''lepA''</sub> from ''B. subtilis''
| + | | |
| - | *the inducible promoters P<sub>''liaI''</sub> and ''xylR''-P<sub>''xyl''</sub> from ''B. subtilis''
| + | [[File:Promoters overview.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Promoters]] |
| - | | + | |
| - | For the characterization of the different promoters we used the ''lux'' operon [[File:Lux operon.png|100px]]. Here, promoter activity leads to expression of the luciferase and hence light production, which can be measured as luminescence.
| + | |
| - | | + | |
| - | We also used the reporter gene ''lacZ'' [[File:LacZ.png|50px]]. Here, promoter activation results in expression of a β-galactosidase, whose activity can be measured by breakdown of the chromophoric substrate ONPG (β-galactosidase assays). We used the reporter vector pSB<sub>''Bs''</sub>1C-''lacZ''. See this page for an overview and background information of all evaluated promoters and see the [https://2012.igem.org/Team:LMU-Munich/Data Data] page for more details.</p>
| + | |
| - | | + | |
| - | | + | |
| - | ====Overview of all evaluated promoters==== | + | |
| - | | + | |
| - | <p align="justify"> This section gives an overview on the strength of all evaluated promoters, which span a large range of activities. For more details and informations of the experiments see the [https://2012.igem.org/Team:LMU-Munich/Data Data] page of the promoters. Note that P<sub>''veg''</sub> was not evaluated with luminescence measurements and this bar is just projected from the results of the β-galactosidase assay.</p>
| + | |
| - | <br>
| + | |
| - | | + | |
| - | {| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;"
| + | |
| - | | style="width: 70%;background-color: #EBFCE4;" |
| + | |
| - | {|
| + | |
| - | |[[File:Promoters overview.png|600px|center]]
| + | |
| | |- | | |- |
| - | | style="width: 70%;background-color: #EBFCE4;" |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Promoters]] |
| - | {| style="color:black;" cellpadding="0" width="100%" cellspacing="0" border="0" align="center" style="text-align:center;"
| + | |
| - | |style="width: 70%;background-color: #EBFCE4;" | | + | |
| - | <font color="#000000"; size="2"><p align="justify"> '''Overview of promoter activity evaluated with luminescence measurements in pSB<sub>''Bs''</sub>3C-''luxABCDE''.''' These values derive from the experiments you can find in our Data section. Lumi per OD<sub>600</sub> are taken at a OD<sub>600</sub> of 0.1. Values are the average and the standard deviation of three different experiments for clone 1. Shown is the activity of the Anderson promoters J23100 (#100), J23101 (#101), J23102 (#102), J23103 (#103), J23106 (#106), J23107 (#107), J23113 (#113), J23114 (#114), J23115 (#115), J23117 (#117), J23118 (#118) as well as the activity of the constitutive promoters P<sub>''liaG''</sub>, and P<sub>''lepA''</sub>. The activity of the inducible promoter P<sub>''liaI''</sub> is shown with (+bac) and without (-bac) induction with bacitracin (10 μg/ml). The promoter activity of P<sub>''veg''</sub> is projected from the results from the β-galactosidase assay and was not measured with luminescence measurements. For the assays shown, an intermediate version of the reporter vector pSB<sub>''Bs''</sub>3C-''luxABCDE'' was used, which still contained one forbidden PstI site.</p></font>
| + | |
| - | |}
| + | |
| - | |}
| + | |
| | |} | | |} |
| | + | </div> |
| | | | |
| - | | + | <div class="box"> |
| - | ====Evaluation of Anderson promoters in ''B. subtilis''====
| + | |
| - | | + | |
| - | <p align="justify">The first group of promoters evaluated are the promoters of the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] (''"Anderson promoters"''). They have already been extensively measured in ''Escherichia coli'' where they all showed a constitutive behavior with different strength. In this project, eleven Anderson promoters were characterized in ''B. subtilis'' with the ''lux'' operon as a reporter. In ''B. subtilis'' these promoters show quiet low activity (see [https://2012.igem.org/Team:LMU-Munich/Data/Anderson#Luminescence_measurements Data Anderson promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Anderson#Luminescence_measurements]]). | + | |
| - | To confirm these results some Anderson promoters were also evaluated with the reporter gene ''lacZ'' by doing β-galactosidase assays (see [https://2012.igem.org/Team:LMU-Munich/Data/Anderson Data Anderson promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Anderson#β-galactosidase_assays]]).</p>
| + | |
| - | | + | |
| - | | + | |
| - | *'''J23100''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823004 BioBrick:BBa_K823004])
| + | |
| - | *'''J23101''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823005 BioBrick:BBa_K823005])
| + | |
| - | *'''J23102''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823006 BioBrick:BBa_K823006])
| + | |
| - | *'''J23103''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823007 BioBrick:BBa_K823007])
| + | |
| - | *'''J23106''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823008 BioBrick:BBa_K823008])
| + | |
| - | *'''J23107''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823009 BioBrick:BBa_K823009])
| + | |
| - | *'''J23113''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823010 BioBrick:BBa_K823010])
| + | |
| - | *'''J23114''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823011 BioBrick:BBa_K823011])
| + | |
| - | *'''J23115''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823012 BioBrick:BBa_K823012])
| + | |
| - | *'''J23117''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823013 BioBrick:BBa_K823013])
| + | |
| - | *'''J23118''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823014 BioBrick:BBa_K823014])
| + | |
| - | <p align="justify"></p>
| + | |
| - | | + | |
| - | | + | |
| - | ====Constitutive promoters from ''B. subtilis'' as novel BioBricks====
| + | |
| - | | + | |
| - | <p align="justify">The second group of promoters are a set of constitutive promoters from ''B. subtilis'' that we have added to the Registry. We evaluated the promoters [http://partsregistry.org/Part:BBa_K823000 P<sub>''liaG''</sub>], [http://partsregistry.org/Part:BBa_K823003 P<sub>''veg''</sub>] and [http://partsregistry.org/Part:BBa_K823002 P<sub>''lepA''</sub>] using the ''lux'' operon as well as the ''lacZ'' gene as reporters.</p>
| + | |
| - | | + | |
| - | | + | |
| - | *'''P<sub>''liaG''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823000 BioBrick:BBa_K823000])
| + | |
| - | <p align="justify">P<sub>''liaG''</sub> is a constitutive promoter from ''B. subtilis''. It is responsible for the transcription of the last four genes of the ''liaIHGFSR'' locus and hence for the production of the components of the LiaRS system, which is important for the detection of cell wall antibiotics [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan ''et al.'', 2006)]. P<sub>''liaG''</sub> was evaluated with the ''lux'' operon (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive#Luminescence_measurements Data constitutive promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive#Luminescence_measurements]]) as well as the ''lacZ'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive Data constitutive promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive]]) as reporter. This promoter showed a much higher activity than the Anderson promoters, but was still relatively weak in comparison to other evaluated ''Bacillus'' promoters. </p>
| + | |
| - | | + | |
| - | | + | |
| - | *'''P<sub>''veg''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823003 BioBrick:BBa_K823003])
| + | |
| - | <p align="justify">P<sub>''veg''</sub> is known to show a strong constitutive activity during the vegetative growth phase and sporulation. This promoter is important for the transcription of the ''veg'' gene, which plays a role during sporulation [http://www.ncbi.nlm.nih.gov/pubmed?term=J.%20Biochem.%2C%20133%20%284%29%3A%20475%E2%80%93483: (Fukushima ''et al.'', 2003)]. P<sub>''veg''</sub> was only measured by using the reporter gene ''lacZ'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive Data constitutive promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive]]). This promoter was the strongest of our evaluation. It failed to clone into the ''lux'' reporter vector, presumably because of its strength.</p>
| + | |
| - |
| + | |
| - | | + | |
| - | *'''P<sub>''lepA''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823002 BioBrick:BBa_K823002])
| + | |
| - | <p align="justify"> P<sub>''lepA''</sub> is a constitutive promoter that is important for the transcription of the bicistronic operon. One of the expressed proteins is the protein P<sub>''lepA''</sub> [http://www.ncbi.nlm.nih.gov/pubmed?term=Microbiology%2C%20142%3A%201641%E2%80%931649: (Homuth ''et al.'', 1996)]. P<sub>''lepA''</sub> plays an important role during translation as it can move the mRNA-tRNA complex one step back in the ribosome which is expected to improve the fidelity of translation [http://www.ncbi.nlm.nih.gov/pubmed?term=Cell%2C%20127%20%284%29%3A%20721%E2%80%93733: (Qin ''et al.'', 2006)]. This protein was evaluated with the ''lux'' operon as a reporter (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive#Luminescence_measurements Data constitutive promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive#Luminescence_measurements]]). The activity of this promoter is between the activity of the strongest ''Bacillus'' promoter P<sub>''veg''</sub> and the weak P<sub>''liaG''</sub>. </p>
| + | |
| - | | + | |
| - | | + | |
| - | ====Inducible promoters from ''B. subtilis'' as a novel BioBrick====
| + | |
| - | | + | |
| - | <p align="justify">The last group of promoters consists of two inducible promoters from ''B. subtilis'', P''<sub>liaI</sub>'' and ''xylR''-P''<sub>xyl</sub>''. They are useful if the strength and timing of gene expression needs to be tightly controlled, because these promoters need an inducer to initiate transcription. P<sub>''liaI''</sub> is evaluated with the reporters ''lux'' and ''lacZ'' and added this novel promoter to the registry.</p>
| + | |
| - | | + | |
| - | | + | |
| - | *'''P<sub>''liaI''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823001 BioBrick:BBa_K823001])
| + | |
| - | <p align="justify">P''<sub>liaI</sub>'' is an inducible promoter from ''B. subtilis'', which responds to antibiotics that interfere with the integrity and biosynthesis of the cell wall [http://www.ncbi.nlm.nih.gov/pubmed/15273097 (Mascher ''et al.'', 2004)]. In the presence of a stimulus, the two-component system LiaRS is activated. The activated response regulator LiaR binds to the operator of the promoter and induces the transcription of the lia locus. When the promoter is turned on the two proteins LiaI and LiaH are expressed which play an important role in the stress response of ''B. subtilis''. The major strength of this promoter is its very low basal activity in the absence of an inducer and its high dynamic range [http://www.ncbi.nlm.nih.gov/pubmed/15273097 (Mascher ''et al.'', 2004)]. This promoter is evaluated with the reporter ''lux'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Inducible#Luminescence_measurements Data inducible promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Inducible#Luminescence_measurements]]) as well as ''lacZ'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Inducible Data inducible promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Inducible]]). The induction was measured with different concentrations of bacitracin, demonstrating a concentration-dependent response over a large range of promoter activities.</p>
| + | |
| - | | + | |
| - | | + | |
| - | *'''''xylR''-P<sub>''xyl''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K8230015 BioBrick:BBa_K823015])
| + | |
| - | <p align="justify">P<sub>''xyl''</sub>-''xylR'' is a xylose-inducible promoter from ''B. subtilis''. XylR is the repressor of P<sub>''xyl''</sub> in the absence of the sugar xylose. In the presence of xylose, XylR dissociates from the operator and P<sub>''xyl''</sub> is active (see e.g. [http://www.ncbi.nlm.nih.gov/pubmed/2544559 Kreuzer et al.]). For this promoter we have not yet suceeded to clone it in a reporter vector to evaluate the activity. So far, there is no data for this promoter.</p>
| + | |
| - | <br>
| + | |
| - | | + | |
| - | | + | |
| | ==''Bacillus'' Reporters [[File:LMU Reporter.png|50px]]== | | ==''Bacillus'' Reporters [[File:LMU Reporter.png|50px]]== |
| - | | + | {| "width=100%" style="align:right"| |
| - | <p align="justify"> | + | | |
| - | We designed and codon-optimized a set of reporters that are commonly used in ''B. subtilis''. All reporters have a modified iGEM Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RFC 25]) pre- and suffix for assembly of in-frame fusion proteins. Our prefix also includes the ''B. subitlis'' optimized ribosome binding site. </p> | + | <p align="justify">We designed and codon-optimized a set of reporters that are commonly used in ''B. subtilis''.</p> |
| - | | + | | |
| - | Find out more about the design of our [https://static.igem.org/mediawiki/2012/b/b9/LMU-Munich_2012_Our_Freiburg_standard_FusionPrefix.pdf prefix with ribosome binding site].
| + | [[File:LMU GFP.jpg|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Reporters]] |
| - | | + | |
| - | prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
| + | |
| - | | + | |
| - | suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
| + | |
| - | | + | |
| - | | + | |
| - | *'''GFP''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823039 BioBrick:BBa_K823039])
| + | |
| - | | + | |
| - | | + | |
| - | {| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;"
| + | |
| - | | style="width: 70%;background-color: #EBFCE4;" | | + | |
| - | {|
| + | |
| - | |[[File:WT-B53 fluorescence.png|300px|center]]
| + | |
| | |- | | |- |
| - | | style="width: 70%;background-color: #EBFCE4;" |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Reporters]] |
| - | {| style="color:black;" cellpadding="0" width="90%" cellspacing="0" border="0" align="center" style="text-align:center;"
| + | |
| - | |style="width: 70%;background-color: #EBFCE4;" | | + | |
| - | <font color="#000000"; size="2"><p align="justify">Fig. 5: Fluorescence of wild type spores and B53-'''Sporo'''beads (containing the P<sub>''cotYZ''</sub>-''cotZ''-''gfp''-terminator construct)</p></font>
| + | |
| | |} | | |} |
| - | |}
| + | </div> |
| - | |}
| + | |
| - | <p align="justify">We took a ''gfp'' derivate of the ''Bacillus subtilis'' plasmid pGFPamy and added the BioBrick compatible pre- and suffix of the Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RFC 25]). The functionality of this BioBrick verified by creat e.g. our [https://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins '''Sporo'''beads].</p> | + | |
| | | | |
| - | | + | <div class="box"> |
| - | *'''mKate2''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029])
| + | ==Affinity Tags [[File:Proteinaffinitytagbutton.png|50px]]== |
| - | | + | {| "width=100%" style="align:right"| |
| - | | + | | |
| - | {| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;" | + | <p align="justify">We synthesized 5 affinity tags for protein purification. They all are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags.</p> |
| - | | style="width: 70%;background-color: #EBFCE4;" | | + | |
| - | {|
| + | |
| - | |[[File:MKate Pellet_ii.JPG|400px|center]]
| + | |
| | |- | | |- |
| - | | style="width: 70%;background-color: #EBFCE4;" |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Tags]] |
| - | {| style="color:black;" cellpadding="0" width="95%" cellspacing="0" border="0" align="center" style="text-align:center;"
| + | |
| - | |style="width: 70%;background-color: #EBFCE4;" | | + | |
| - | <font color="#000000"; size="2"><p align="justify">'''''mKate2'' fused to the terminator B0014 under the control of the Anderson promoter J23101 (up), P<sub>''liaI''</sub> (middle) and P<sub>''lepA''</sub> (down) in pSB<sub>''Bs''</sub>1C.''' Pellets are ''Escherichia coli'' cells which contain the plasmid with the insert labelled to the right.</p></font>
| + | |
| - | |}
| + | |
| - | |}
| + | |
| | |} | | |} |
| | + | </div> |
| | + | <br> |
| | + | <br> |
| | + | <br> |
| | <br> | | <br> |
| - |
| |
| - | <p align="justify">We codon-optimized the sequence of this monomeric far-red fluorescence protein for the use in ''B. subtilis'' and synthesized it (by [http://de-de.invitrogen.com/site/de/de/home/Products-and-Services/Applications/Cloning/gene-synthesis.html GeneArt]) with pre- and suffix of the Freiburg standard. We cloned this reporter in front of the terminator B0014. For the evaluation, this reporter was successfully combined with the promoters P<sub>''liaI''</sub>, P<sub>''lepA''</sub> and the Anderson promoter J23101 in the empty ''Bacillus'' vector pSB<sub>''Bs''</sub>1C from our '''''Bacillus''B'''io'''B'''rick'''B'''ox. At the moment we already have the right construct integrated into the chromosome of ''B. subtilis''. Unfortunately, we have not yet measured this reporter.</p>
| |
| - |
| |
| - | Reference: [http://www.evrogen.com/products/mKate2/mKate2.shtml mkate2]
| |
| - |
| |
| - |
| |
| - | *'''LacZ''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823019 BioBrick:BBa_K823019])
| |
| - |
| |
| - |
| |
| - | {| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;"
| |
| - | | style="width: 70%;background-color: #EBFCE4;" |
| |
| - | {|
| |
| - | |[[File:LacZ plate.png|center|400px]]
| |
| - | |-
| |
| - | | style="width: 70%;background-color: #EBFCE4;" |
| |
| - | {| style="color:black;" cellpadding="0" width="95%" cellspacing="0" border="0" align="center" style="text-align:center;"
| |
| - | |style="width: 70%;background-color: #EBFCE4;" |
| |
| - | <font color="#000000"; size="2"><p align="justify">''lacZ'' fused to the terminator B0014 under the control of P<sub>''spac''</sub> in the expression vector pSB<sub>Bs</sub>0K-P<sub>''spac''</sub>. P<sub>''spac''</sub> induced with IPTG</p></font>
| |
| - | |}
| |
| - | |}
| |
| - | |}
| |
| - |
| |
| - |
| |
| - | <p align="justify">This evaluated ''lacZ'' gene is derived from the ''Bacillus'' reporter vector pAC6. It is constructed in the Freiburg Standard ([http://partsregistry.org/Help:Assembly_standard_25 RFC 25]) for in-frame fusion proteins. It also includes a ribosome binding site optimized for ''Bacillus subtilis'' translation. This ''lacZ'' BioBrick was tested in the expression vector pSB<sub>''Bs''</sub>0K-P<sub>''spac''</sub>. This construct gave output, so the reporter gene is functional qualitatively. See [https://2012.igem.org/Team:LMU-Munich/Data/Vectors Data] in the vector evaluation section of pSB<sub>''Bs''</sub>0K-P<sub>''spac''</sub>. A more qualitatively measurement will follow soon.</p>
| |
| - |
| |
| - | Reference for the vector: [http://www.ncbi.nlm.nih.gov/pubmed/11902727 pAC6]
| |
| - |
| |
| - |
| |
| - |
| |
| - | *'''luc''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823028 BioBrick:BBa_K823028])
| |
| - | <p align="justify">
| |
| - | The <i>luc</i> gene encodes the monomeric firefly luciferase, which requires a special substrate to produce luminescence. We codon-optimized it for <i>Bacillus subtilis</i>, added a ribosome binding site and synthesized by [http://de-de.invitrogen.com/site/de/de/home/Products-and-Services/Applications/Cloning/gene-synthesis.html GeneArt].
| |
| - | </p>
| |
| - | <p align="justify">
| |
| - | Firefly luciferase is by far the most commonly used bioluminescent reporter. This monomeric enzyme of 61kDa catalyzes a two-step oxidation reaction to yield light, usually in the green to yellow region, typically 550–570nm . The first step is activation of the luciferyl carboxylate by ATP to yield a reactive mixed anhydride. In the second step, this activated intermediate reacts with oxygen to create a transient dioxetane that breaks down to the oxidized products, oxyluciferin and CO<sub>2</sub>. Upon mixing with substrates, firefly luciferase produces an initial burst of light that decays over about 15 seconds to a low level of sustained luminescence. This kinetic profile reflects the slow release of the enzymatic product, thus limiting catalytic turnover after the initial reaction.
| |
| - | </p>
| |
| - | <p align="justify">
| |
| - | The popularity of native firefly luciferase as a genetic reporter is due to the sensitivity and convenience of the enzyme assay and tight coupling of protein synthesis with enzyme activity. Firefly luciferase, which is encoded by the ''luc'' gene, is a monomer that does not require any post-translational modifications; it is available as a mature enzyme directly upon translation of its mRNA. Catalytic competence is attained immediately after release from the ribosome. Also, luciferase has a very short half-life in cells (approximately 3 hours). Combined, these properties make luciferase an extremely responsive reporter, far more so than other commonly used reporters.
| |
| - | </p>
| |
| - |
| |
| - | {| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;"
| |
| - | | style="width: 70%;background-color: #EBFCE4;" |
| |
| - | {|
| |
| - | |[[File:Luciferin reaction mod.png|center|400px]]
| |
| - | |-
| |
| - | | style="width: 70%;background-color: #EBFCE4;" |
| |
| - | {| style="color:black;" cellpadding="0" width="95%" cellspacing="0" border="0" align="center" style="text-align:center;"
| |
| - | |style="width: 70%;background-color: #EBFCE4;" |
| |
| - | <font color="#000000"; size="2">Reference:[http://www.promega.com/resources/product-guides-and-selectors/protocols-and-applications-guide/bioluminescent-reporters/ Promega]</font>
| |
| - | |}
| |
| - | |}
| |
| - | |}
| |
| - |
| |
| - | It was used in <i>B. subtilis</i> before ([http://www.ncbi.nlm.nih.gov/pubmed/21552330 Mirouze et al. 2011]).
| |
| - | The non-optimized version of this reporter gene was already successfully used in B. subtilis. While we have not found the time to evaluate this BioBrick we expect that it will work at least as good.
| |
| - |
| |
| - |
| |
| - | ==Affinity Tags [[File:Proteinaffinitytagbutton.png|50px]]==
| |
| - |
| |
| - |
| |
| - | <p align="justify">
| |
| - | All our tags have been synthesized by [http://de-de.invitrogen.com/site/de/de/home/Products-and-Services/Applications/Cloning/gene-synthesis.html GeneArt]. They are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags. </p>
| |
| - |
| |
| - | Find out more about the design of our [https://static.igem.org/mediawiki/2012/b/b9/LMU-Munich_2012_Our_Freiburg_standard_FusionPrefix.pdf prefix with ribosome binding site].
| |
| - |
| |
| - | prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
| |
| - |
| |
| - | suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
| |
| - |
| |
| - |
| |
| - | *'''3x Flag-tag''' [http://partsregistry.org/Part:BBa_K823034 (BioBrick:BBa_K823034)]
| |
| - |
| |
| - | <p align="justify">
| |
| - | The Flag-tag was the first epitope tag to be published ([http://www.nature.com/nbt/journal/v6/n10/full/nbt1088-1204.html Hopp, Prickett et al. (1988)]). It consists of eight hydrophobic amino acids: DYKDDDDK. To enhence senstitivity in Western blots, it is routinely used as a 3x Flag tag in ''B. subtilis'' [http://www.ncbi.nlm.nih.gov/pubmed?term=wiegert%20flag (Kaltwasser ''et al.'', 2002)]. Its sequence is: <b>DYKDHDGDYKDHDIDYKDDDDK</b>. There are a variety of monoclonal antibodies against this tag, N-terminal as well as position insensitive.</p>
| |
| - |
| |
| - |
| |
| - | *'''HA - tag''' [http://partsregistry.org/Part:BBa_K823035 (BioBrick:BBa_K823035)]
| |
| - |
| |
| - | <p align="justify">
| |
| - | The HA-tag is an epitope derived from the HA-virus. There was first an antibody against it and then the epitope was characterized ([http://www.ncbi.nlm.nih.gov/pubmed/6204768 Wilson, I.A. et al. (1984)]). It was then furthermore used as a tag for protein purification and recognition ([http://www.ncbi.nlm.nih.gov/pubmed/2455217 Field et al. (1988)]). The amino acid sequence is: <b>YPYDVPDYA</b>.</p>
| |
| - |
| |
| - |
| |
| - | *'''cMyc - tag''' [http://partsregistry.org/Part:BBa_K823036 (BioBrick:BBa_K823036)]
| |
| - |
| |
| - | <p align="justify">
| |
| - | The cMyc-tag is derived from the cMyc gene product. Antibodies were generated from the immunization with synthetic peptides from the cMyc sequence ([http://mcb.asm.org/content/5/12/3610.short Evan, Bishop et al.(1985)]). The amino acid sequence is <b>EQKLISEEDL</b>.</p>
| |
| - |
| |
| - |
| |
| - | *'''His - tag''' [http://partsregistry.org/Part:BBa_K823037 (BioBrick:BBa_K823037)]
| |
| - |
| |
| - | <p align="justify">
| |
| - | The His-tag is a metal chelating peptide ([http://www.nature.com/nbt/journal/v6/n11/full/nbt1188-1321.html Hochul,Stüber et al. (1988)]) consisting of at least 6 histidin residues. It can be used for protein purification by metal<sup>2+</sup>ion-containing columns (nickel). There are also antibodies against this tag, or nickel/cobalt containing fluorescent probes can be used for detection. Moreover, an immobilization is possible in nickel/cobalt coated plastikware.
| |
| - | The aminoacid sequence is:<b>HHHHHHHHHH</b></p>
| |
| - |
| |
| - |
| |
| - | *'''Strep - tag''' [http://partsregistry.org/Part:BBa_K823038 (BioBrick:BBa_K823038)]
| |
| - |
| |
| - | <p align="justify">
| |
| - | The Strep-tag is a mimicry peptide of biotin which binds to Streptavidin ([http://www.sciencedirect.com/science/article/pii/S1050386299000339 Skerra, Schmidt (1999)]). Its sequence is <b>WSHPQFEK</b>. It can be used for protein purification, immobilization with streptavidin or strep-tactin ([http://www.ncbi.nlm.nih.gov/pubmed/9415448 Voss, Skerra (1997)]) or detection with Strep-tactin or antibodies.</p>
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| | <div class="box"> | | <div class="box"> |
| | ====Project Navigation==== | | ====Project Navigation==== |
"
