Team:Trieste/parts/10

From 2012.igem.org

(Difference between revisions)
 
(13 intermediate revisions not shown)
Line 10: Line 10:
                 <div class="box_contenuti">
                 <div class="box_contenuti">
<h2>Description </h2>  
<h2>Description </h2>  
-
This part is composed by J23100-B0034-β-glucosidase-B0015. When this part is expressed in bacteria, they become able to metabolize cellobiose converting it in two molecules of glucose.
+
This part is composed by J23100-B0034-β-glucosidase-B0015. When this part is expressed in bacteria, they become able to metabolize cellobiose converting it in two molecules of glucose.<br/>
-
</br>
+
<br/>
-
</br>
+
<center><img src="https://static.igem.org/mediawiki/2012/2/2e/BBBGLUCO.png" width="400px"/></center>
 +
<br/>
 +
 
 +
<strong>This part is an improvement of part BBa_K392008 that was used by UNITS_Trieste 2011 Team.</strong>
 +
<br/>
 +
<br/>
<h2>Assembly</h2>
<h2>Assembly</h2>
-
This composite part is developed by previous work by UNITS iGEM team 2011 and Edinburgh team 2011. They discovered that BBa_K392008 (Osaka 2010), coding for a Cellumonas fimi β-glucosidase, possess an apparent frameshift near the start of the coding sequence. The coding sequence has now been determined to start from an ATG located 220 bp downstream of the reported one. We therefore decided to correct the Bba_K392008 in order to have the correct coding sequence. In order to do this we made a PCR on Bba_K392008 by using the following primers:
+
This composite part is developed from previous work by UNITS iGEM team 2011 and Edinburgh team 2011. They discovered that BBa_K392008 (Osaka 2010), coding for a Cellumonas fimi β-glucosidase, possess an apparent frameshift near the start of the coding sequence. The coding sequence has now been determined to start from an ATG located 220 bp downstream of the reported one. We therefore decided to correct the Bba_K392008 in order to have the correct coding sequence. In order to do this we made a PCR on Bba_K392008 by using the following primers:
-
</br>
+
<br/>
-
</br>
+
<br/>
β-Glucosidase_Fw
β-Glucosidase_Fw
-
</br>
+
<br/>
GCATGAATTCGCGGCCGCTTCTAGATGACCACCACGCGCCCCTC  
GCATGAATTCGCGGCCGCTTCTAGATGACCACCACGCGCCCCTC  
-
</br>  
+
<br/>  
-
</br>
+
<br/>
β-Glucosidase_Rev
β-Glucosidase_Rev
-
</br>
+
<br/>
GCATCTGCAGCGGCCGCTACTAGTATCAGGGCTGGTAGGTCGCGG
GCATCTGCAGCGGCCGCTACTAGTATCAGGGCTGGTAGGTCGCGG
-
</br>
+
<br/>
-
</br>
+
<br/>
<h2>Results</h2>
<h2>Results</h2>
The new Cellulomonas fimi β-Glucosidase was sequenced and then assembled in a transcriptional unit together with J23100, B0034 and B0015.
The new Cellulomonas fimi β-Glucosidase was sequenced and then assembled in a transcriptional unit together with J23100, B0034 and B0015.
-
</br>
+
<br/>
-
E.coli cells expressing the β-Glucosidase were able to grow in M9 minimal medium supplemented with cellobiose 1% as the only C source while E.coli without this composite part are not able to grow.
+
<i>E.coli</i> cells expressing the β-Glucosidase were able to grow in M9 minimal medium supplemented with cellobiose 1% as the only C source while<i> E.coli</i> without this composite part are not able to grow.
-
</br>  
+
<br/>
-
<h2>Modelling</h2>
+
<center><img src="https://static.igem.org/mediawiki/igem.org/5/56/Trieste_B-Glucosidase_V.jpg" width="500px"/></center>
-
</br>  
+
<br/>  
-
<h2>Looking forward</h2>
+
<br/>  
-
</br>
+
<h3><a href="http://partsregistry.org/Part:BBa_K875020"target="_blank">Link to the Registry</a></h3>
<h3><a href="http://partsregistry.org/Part:BBa_K875020"target="_blank">Link to the Registry</a></h3>
-
</br>
+
<br/>
    
    
    <!--  ******************** CONTENUTO QUI ****************** -->  
    <!--  ******************** CONTENUTO QUI ****************** -->  
Line 54: Line 58:
                 <li><a href="https://2012.igem.org/Team:Trieste/parts/8">BBa_K875008 - Tse2 Toxin</a></li>
                 <li><a href="https://2012.igem.org/Team:Trieste/parts/8">BBa_K875008 - Tse2 Toxin</a></li>
                 <li><a href="https://2012.igem.org/Team:Trieste/parts/9">BBa_K875009 - LL 37</a></li>
                 <li><a href="https://2012.igem.org/Team:Trieste/parts/9">BBa_K875009 - LL 37</a></li>
-
                 <li><a href="https://2012.igem.org/Team:Trieste/parts/10">BBa_K875020 - Glucosidase</a></li>
+
                 <li class="select"><a href="https://2012.igem.org/Team:Trieste/parts/10">BBa_K875020 - Glucosidase</a></li>
</strong>
</strong>

Latest revision as of 18:10, 26 October 2012

BBa_K875020

More

Description

This part is composed by J23100-B0034-β-glucosidase-B0015. When this part is expressed in bacteria, they become able to metabolize cellobiose converting it in two molecules of glucose.


This part is an improvement of part BBa_K392008 that was used by UNITS_Trieste 2011 Team.

Assembly

This composite part is developed from previous work by UNITS iGEM team 2011 and Edinburgh team 2011. They discovered that BBa_K392008 (Osaka 2010), coding for a Cellumonas fimi β-glucosidase, possess an apparent frameshift near the start of the coding sequence. The coding sequence has now been determined to start from an ATG located 220 bp downstream of the reported one. We therefore decided to correct the Bba_K392008 in order to have the correct coding sequence. In order to do this we made a PCR on Bba_K392008 by using the following primers:

β-Glucosidase_Fw
GCATGAATTCGCGGCCGCTTCTAGATGACCACCACGCGCCCCTC

β-Glucosidase_Rev
GCATCTGCAGCGGCCGCTACTAGTATCAGGGCTGGTAGGTCGCGG

Results

The new Cellulomonas fimi β-Glucosidase was sequenced and then assembled in a transcriptional unit together with J23100, B0034 and B0015.
E.coli cells expressing the β-Glucosidase were able to grow in M9 minimal medium supplemented with cellobiose 1% as the only C source while E.coli without this composite part are not able to grow.


Link to the Registry


Università degli studi di Trieste ICGEB Illy Fondazione Cassa di Risparmio
iGEM 2012 iGEM 2012 iGEM 2012 iGEM 2012 iGEM 2012 iGEM 2012
HTML Hit Counter