Team:ULB-Brussels/Materiel&Methods

From 2012.igem.org

(Difference between revisions)
 
(6 intermediate revisions not shown)
Line 2: Line 2:
-
<center><img id="logo" src="https://static.igem.org/mediawiki/2012/2/21/Dessin_sam.jpg" height="60%" width="60%">
+
<img id="logo" src="https://static.igem.org/mediawiki/2012/8/87/Bac.jpg" height="25%" width="25%">
-
</center>
+
<img id="logo" src="https://static.igem.org/mediawiki/2012/2/21/Dessin_sam.jpg" height="48%" width="48%">
 +
<img id="logo" src="https://static.igem.org/mediawiki/2012/5/55/Terry.jpg" height="25%" width="25%">
 +
 
</html>
</html>
Line 14: Line 16:
<html><center>
<html><center>
<a class="onglet" href="https://2012.igem.org/Team:ULB-Brussels/Introduction">Introduction</a>&nbsp;/&nbsp;
<a class="onglet" href="https://2012.igem.org/Team:ULB-Brussels/Introduction">Introduction</a>&nbsp;/&nbsp;
-
<a class="onglet" href="https://2012.igem.org/Team:ULB-Brussels/Materiel & Methods">Materiel & Methods</a>&nbsp;/&nbsp;
+
<a class="onglet" href="https://2012.igem.org/Team:ULB-Brussels/Material&Methods">Material & Methods</a>&nbsp;/&nbsp;
<a class="onglet" href="https://2012.igem.org/Team:ULB-Brussels/Results">Results</a>
<a class="onglet" href="https://2012.igem.org/Team:ULB-Brussels/Results">Results</a>
</center></html>
</center></html>
Line 31: Line 33:
<center><font color="#000000"; size="100"> Team ULB-Brussels, project page! </font></center>
<center><font color="#000000"; size="100"> Team ULB-Brussels, project page! </font></center>
 +
 +
<balise id="hautdepage"></balise>
<br></br>
<br></br>
Line 40: Line 44:
<br></br>
<br></br>
-
<h1><A NAME="Introduction"> Introduction </A> </h1>
+
<h1><A NAME="Material & Methods"> Material & Methods </A> </h1>
-
 
+
-
<h1><A NAME="Materiel & Methods"> Materiel & Methods </A> </h1>
+
<table id="toc" class="toc">
<table id="toc" class="toc">
Line 51: Line 53:
</div>
</div>
<ul>
<ul>
-
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#1. E. coli strains"> 1. E. coli strains </A>
+
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#1. E. coli strains"> 1. E. coli strains </A>
-
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#2. Plasmids"> 2.Plasmids </A>
+
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#2. Plasmids"> 2.Plasmids </A>
-
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#3. Primers"> 3. Primers </A>
+
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#3. Primers"> 3. Primers </A>
-
<ul><p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#3.1. Primers for first amplification of each gene"> 3.1. Primers for first amplification of each gene </A>
+
<ul><p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#3.1. Primers for first amplification of each gene"> 3.1. Primers for first amplification of each gene </A>
-
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#3.2. Primers for second amplification"> 3.2. Primers for second amplification </A>
+
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#3.2. Primers for second amplification"> 3.2. Primers for second amplification </A>
-
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#3.3. Primers for insertion in immunity pBAD plasmid"> 3.3. Primers for insertion in immunity pBAD plasmid </A>
+
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#3.3. Primers for insertion in immunity pBAD plasmid"> 3.3. Primers for insertion in immunity pBAD plasmid </A>
-
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#3.4. Primers for fixing BE"> 3.4. Primers for fixing BE </A></ul>
+
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#3.4. Primers for fixing BE"> 3.4. Primers for fixing BE </A></ul>
-
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#4. Kits"> 4. Kits </A>
+
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#4. Kits"> 4. Kits </A>
-
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#5. Restriction"> 5. Restriction </A>
+
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#5. Restriction"> 5. Restriction </A>
-
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#6. Ligation"> 6. Ligation </A>
+
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#6. Ligation"> 6. Ligation </A>
-
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#7. Preparation of electrocompetent cells"> 7. Preparation of electrocompetent cells </A>
+
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#7. Preparation of electrocompetent cells"> 7. Preparation of electrocompetent cells </A>
-
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Project#8. Electroporation"> 8. Electroporation </A>
+
<p><A HREF="https://2012.igem.org/Team:ULB-Brussels/Materiel&amp;Methods#8. Electroporation"> 8. Electroporation </A>
</td>
</td>
Line 70: Line 72:
<font color=black>
<font color=black>
-
<h2><A NAME="1. E. coli strains"> I. E. coli strains </A> </h2>
+
<h2><A NAME="1. E. coli strains"> 1. E. coli strains </A> </h2>
<p>&nbsp;&nbsp;MC1061 : F− araD139, Δ(ara-leu)7696,galE15, galK16, Δ(lac)X74, rpsL (Strr), hsdR2 (rK−mK+), mcrA mcrB1 </p>
<p>&nbsp;&nbsp;MC1061 : F− araD139, Δ(ara-leu)7696,galE15, galK16, Δ(lac)X74, rpsL (Strr), hsdR2 (rK−mK+), mcrA mcrB1 </p>
<p>&nbsp;&nbsp;TOP10 (Invitrogen) : F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 nupG recA1 araD139  
<p>&nbsp;&nbsp;TOP10 (Invitrogen) : F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 nupG recA1 araD139  
Δ(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 λ- </p>
Δ(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 λ- </p>
 +
 +
<td><a href=""#hautdepage""><img id="logo" src="http://www.clker.com/cliparts/9/2/8/c/1216180855712705788claudita_home_icon.svg.hi.png" height="40px" width="40px" align="right"></a>
 +
 +
<br></br>
<h2><A NAME="2. Plasmids"> 2.Plasmids </A> </h2>
<h2><A NAME="2. Plasmids"> 2.Plasmids </A> </h2>
Line 84: Line 90:
<p>pSB1C3 : standard iGEM plasmid which has a resistance to Chloramphenicol</p>  
<p>pSB1C3 : standard iGEM plasmid which has a resistance to Chloramphenicol</p>  
<p>pSB1A3 : standard iGEM plasmid which has a resistance to Ampicilin</p>
<p>pSB1A3 : standard iGEM plasmid which has a resistance to Ampicilin</p>
 +
 +
<td><a href=""#hautdepage""><img id="logo" src="http://www.clker.com/cliparts/9/2/8/c/1216180855712705788claudita_home_icon.svg.hi.png" height="40px" width="40px" align="right"></a>
 +
<br></br>
<h2><A NAME="3. Primers"> 3. Primers </A> </h2>
<h2><A NAME="3. Primers"> 3. Primers </A> </h2>
Line 141: Line 150:
<p>&nbsp;&nbsp;MccCF-REV</p>
<p>&nbsp;&nbsp;MccCF-REV</p>
5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTTATTTCTCGGTAG-3'
5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTTATTTCTCGGTAG-3'
 +
Line 151: Line 161:
5'-AGCCTGCAGCGGCCGCTACTAGTAGGTTATAACGCTTGAATTAAGCCGCGCCGCGAAGCGGCGTCGGCTTGAAT
5'-AGCCTGCAGCGGCCGCTACTAGTAGGTTATAACGCTTGAATTAAGCCGCGCCGCGAAGCGGCGTCGGCTTGAAT
TTATGGGAATGGTAC-3'
TTATGGGAATGGTAC-3'
-
 
<br></br>
<br></br>
Line 210: Line 219:
5'-AGCGGCCGCTACTAGTAGGTTATAACGCTT-3'
5'-AGCGGCCGCTACTAGTAGGTTATAACGCTT-3'
 +
<td><a href=""#hautdepage""><img id="logo" src="http://www.clker.com/cliparts/9/2/8/c/1216180855712705788claudita_home_icon.svg.hi.png" height="40px" width="40px" align="right"></a>
<br></br>
<br></br>
Line 218: Line 228:
  Zymo Research, ZyppyTM Plasmid Miniprep Kit (ref: D4036)
  Zymo Research, ZyppyTM Plasmid Miniprep Kit (ref: D4036)
 +
<td><a href=""#hautdepage""><img id="logo" src="http://www.clker.com/cliparts/9/2/8/c/1216180855712705788claudita_home_icon.svg.hi.png" height="40px" width="40px" align="right"></a>
<br></br>
<br></br>
Line 235: Line 246:
<p>• Incubate for one hour at 37°C
<p>• Incubate for one hour at 37°C
 +
<td><a href=""#hautdepage""><img id="logo" src="http://www.clker.com/cliparts/9/2/8/c/1216180855712705788claudita_home_icon.svg.hi.png" height="40px" width="40px" align="right"></a>
<br></br>
<br></br>
Line 247: Line 259:
<p>• Incubate the ligation reaction overnight at room temperature.
<p>• Incubate the ligation reaction overnight at room temperature.
<p>• Electroporate the ligation on bacteria.
<p>• Electroporate the ligation on bacteria.
-
 
+
<td><a href=""#hautdepage""><img id="logo" src="http://www.clker.com/cliparts/9/2/8/c/1216180855712705788claudita_home_icon.svg.hi.png" height="40px" width="40px" align="right"></a>
<br></br>
<br></br>
Line 258: Line 270:
<p>• Store it at -80°C.
<p>• Store it at -80°C.
 +
<td><a href=""#hautdepage""><img id="logo" src="http://www.clker.com/cliparts/9/2/8/c/1216180855712705788claudita_home_icon.svg.hi.png" height="40px" width="40px" align="right"></a>
<br></br>
<br></br>
Line 274: Line 287:
<p>• Put the bacteria for 1 hours at 37°C.
<p>• Put the bacteria for 1 hours at 37°C.
<p>• Plate the volume you need on dish (with appropriate antibiotics).
<p>• Plate the volume you need on dish (with appropriate antibiotics).
 +
 +
<td><a href=""#hautdepage""><img id="logo" src="http://www.clker.com/cliparts/9/2/8/c/1216180855712705788claudita_home_icon.svg.hi.png" height="40px" width="40px" align="right"></a>
<br></br>
<br></br>
-
<h1><A NAME="Results"> Results </A> </h1>
 
<br></br>
<br></br>

Latest revision as of 09:04, 25 September 2012

Home Team Official Team Profile Project

Introduction /  Material & Methods /  Results

Parts Submitted to the Registry Modeling Safety Older wiki's




Team ULB-Brussels, project page!




Material & Methods

Sommaire

1. E. coli strains

  MC1061 : F− araD139, Δ(ara-leu)7696,galE15, galK16, Δ(lac)X74, rpsL (Strr), hsdR2 (rK−mK+), mcrA mcrB1

  TOP10 (Invitrogen) : F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 λ-



2.Plasmids

pP70 : plasmid which contains the microcin C7 operon and a resistance to chloramphenicol

pCID909 : plasmid which contains the microcin B17 operon and a resistance to ampicilin

pBAD18: arabinose-inducible vector containing kanamicyn resistance

pBAD33: arabinose-inducible vector containing chloramphenicol resistance

pSB1K3 : standard iGEM plasmid which has a resistance to Kanamycin

pSB1C3 : standard iGEM plasmid which has a resistance to Chloramphenicol

pSB1A3 : standard iGEM plasmid which has a resistance to Ampicilin



3. Primers

The following primers were produced by Sigma-Aldrich and the sequences are shown in a 5’-3’ orientation.

3.1. Primers for first amplification of each gene

  MccBA-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGGAATTAAAAGCGAGTG-3'

  MccBA-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTCAGATATGTGAACCACT-3'

   MccBB-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGGTGCTCCCTGATATTAA-3'

   MccBB-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTTATCTCTCCAGACAGCT-3'

   MccBC-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGTCAAAACACGAAC-3'

  MccBC-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTTACTGTAGACATTTATCAT-3'

  MccBE-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGGTTACATTAAAAATGGC-3'

  MccBE-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTCATTGAGAACTCCAG-3'

  MccBF-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGACCATACCTCT-3'

  MccBF-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTCAGTCTCCTGTT-3'

  MccCC-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGTTAATTGGTGTCTAC-3'

  MccCC-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTCATACCATCTCCTTTTTAA-3'

  MccCF-FOR

5'-CCTCAGCTACACGTGCACTGATTAAAGAGGAGAAAATGATGATACAATC-3'

  MccCF-REV

5'-GCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTATAACCTTATTTCTCGGTAG-3'

3.2. Primers for second amplification

  Common-FOR

5'-GCAGAATTCGCGGCCGCTTCTAGAGCCTCAGCTACACGTGCACTG-3'

  Common-REV

5'-AGCCTGCAGCGGCCGCTACTAGTAGGTTATAACGCTTGAATTAAGCCGCGCCGCGAAGCGGCGTCGGCTTGAAT TTATGGGAATGGTAC-3'

3.3. Primers for insertion in immunity pBAD plasmid

  ImMccBG-FOR

5'-CATTCTAGAATTAAAGAGGAGAAAATGGATATAATAGAAAAAAG-3'

  ImMccBG-REV

5'-GCACATGCATCATCCCCCTAC-3'

  ImMccCF-FOR

5'-AGCCAAGCTTGCATGTTATTTCTCGGTAG-3'

  ImMccCF-REV

5'-AGCCAAGCTTGCATG TTATGGGAATGGTAC-3'

  ImMccCEFOR

5'-ATTCGAGCTCGGTACATGGTGCAGATTATC-3'

  ImMccCEREV

5'-TTTCTCCTCTTTAATTTAACCAATTACTTTTGAAT-3'

3.4. Primers for fixing BE

  MccCB Endo For

5'-TTGCTTTAGGTTCCTTAAGG-3'

  MccCB Endo Rev

5'-TCAGCTTCTGGTACCTTATG-3'

  MccCB synthgene For1

5'-AAGGATGATTTCTGGAATTCGCGGCCG-3'

  MccCB synthgene Rev1

5'-CCTTAAGGAACCTAAAGCAA-3'

  MccCB synthgene For2

5'-CATAAGGTACCAGAAGCTGA-3'

  MccCB synthgene Rev2

5'-AGCGGCCGCTACTAGTAGGTTATAACGCTT-3'

4. Kits

Gel purification kit: Sigma-Aldrich, GenEluteTm PCR Clean-up (ref:NA1020)

Mini prep kit: Zymo Research, ZyppyTM Plasmid Miniprep Kit (ref: D4036)

5. Restriction

• Run a PCR to amplify the genes of interest with floating restriction sites.

• Digest the PCR product and the vector by the appropriate restriction enzymes.

     Restriction mix for the PCR products (insert):

       *Xµl of PCR products (X depending on the concentration of insert of the PCR products).

       *1µl of each restriction enzyme.

       *2µl appropriate buffer 10X.

       *Add Yµl bi-distilled water to reach a final volume of 20µl.

     Restriction mix for the vector:

       *200ng of vector.

       *1µl of each restriction enzyme.

       *2µl appropriate buffer 10X.

       *Add Xµl bi-distilled water to reach a final volume of 20µl.

• Incubate for one hour at 37°C

6. Ligation

• The ligation reaction proceeds with 100ng of restricted vector. The quantity of the PCR products is calculated according to the following formula: (100ng vector x PCR product size x 3)/(vector size) = PCR product quantity in ng.

     Ligation mix:

       *1µl T4 DNA ligase.

       *2µl buffer (10x).

       *Add the two restrictions reactions in a final volume of 20µl.

       *Add bi-distilled water for a final volume of 20µl.

       *ADN

• Incubate the ligation reaction overnight at room temperature.

• Electroporate the ligation on bacteria.

7. Preparation of electrocompetent cells

• Dilute 100x an overnight culture in LB medium and incubate at 30°C with shaking until the OD600nm reaches 0.5.

• Centrifuge in a cold rotor at 4500 rpm 4°C for 30 minutes.

• Remove supernatant, resuspend in 20ml cold H20, then centrifuge as above. Repeat this step twice.

• Remove supernatant, resuspend in 10ml cold glycerol, then centrifuge as above.

• Remove final supernatant carefully, resuspend in 1ml cold glycerol.

• Store it at -80°C.

8. Electroporation

   DNA dialysis:

• Fill a petri dish with dH2O.

• Make float a round 0.025µm Millipore dialysis filter on dH2O.

• Place the DNA on the Filter for 20 min, then take it back.

   Electroporation:

• Add dialysed DNA in 50µl of electrocompetent cells.

• Put mixture in an electroporation cuvette.

• Electroporate it at 2,500 volt, 200Ω and 25µFD.

• Add quickly 1ml of LB.

• Put the bacteria for 1 hours at 37°C.

• Plate the volume you need on dish (with appropriate antibiotics).