|
|
(6 intermediate revisions not shown) |
Line 1: |
Line 1: |
- | <html>
| |
- | <link rel="stylesheet" href="https://2012.igem.org/wiki/index.php?title=Team:TU_Darmstadt/css&action=raw&ctype=text/css" type="text/css" />
| |
- | <div id="TUD">
| |
- | <div id="top">
| |
- | <ul>
| |
- | <li><a href="http://www.igem.tu-darmstadt.de/igem/projekt/index.en.jsp" title="iGEM">iGEM@TUD</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt" title="Home">Home</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Project" title="Project">Project</a><ul>
| |
- | <li><a href="/Team:TU_Darmstadt/Project" title="Team:Overview">Overview</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Project/Degradation" title="Degradation">1. Degradation</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Project/Transport" title="Transport">2. Transport</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Project/Metabolism" title="Metabolism">3. Metabolism</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Project/Material_Science" title="Material Science">4. Material Science</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Project/Simulation" title="Simulation">5. Simulation</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Project/Ecology" title="Ecology">Ecology</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Project/Philosophy" title="Philosophy">Philosophy</a></li></ul></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Team" title="Team:TU_Darmstadt/Team">Team</a><ul>
| |
- | <li><a href="/Team:TU_Darmstadt/Team" title="Team:TU_Darmstadt/Team">Members</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Supporters" title="Team:TU_Darmstadt/Supporters">Supporters</a></li></ul></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Parts" title="BioBricks">BioBricks</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Documentation" title="Documentation">Documentation</a><ul>
| |
- | <li><a href="/Team:TU_Darmstadt/Documentation" title="Documentation">Overview</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Labjournal" title="Labjournal">Labjournal</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Protocols" title="Protocols">Protocols</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Materials" title="Materials">Materials</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Modeling" title="Modeling">Modeling</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Safety" title="Safety">Safety</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Downloads" title="Downloads">Downloads</a></li></ul></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Human_Practice" title="Human Practice">Human Practice</a><ul>
| |
- | <li><a href="/Team:TU_Darmstadt/Human_Practice/Panel_Discussion " title="Panel Discussion">Panel Discussion</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Human_Practice/Symposia" title="Symposia">Symposia</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Human_Practice/Classes" title="Classes">Classes</a></li></ul></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Sponsors" title="Sponsors">Sponsors</a><ul>
| |
- | <li><a href="/Team:TU_Darmstadt/Sponsors" title="Sponsors">Overview</a></li>
| |
- | <li><a href="/Team:TU_Darmstadt/Contact" title="Contact">Benefits</a></li></ul></li>
| |
- | </ul>
| |
- | <div id="igem"><a href="https://2012.igem.org/Main_Page"></a></div>
| |
- | </div>
| |
- | <!-- end #menu -->
| |
- | </html>
| |
| | | |
- | <span style="font-size:200%;"><span style="color:#00689D;">Materials</span></span>
| |
- |
| |
- | ==Chemicals==
| |
- |
| |
- | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
- | |- style="font-size:11pt;font-weight:bold" align="center" valign="bottom"
| |
- | | width="60" height="15" | No.
| |
- | | width="332" | Name
| |
- | | width="104" | Firma
| |
- | | width="77" | Order-ID
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 1
| |
- | | Terephthalat
| |
- | | Sigma-Aldrich
| |
- | | 185361-500G
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 2
| |
- | | Acetic acid
| |
- | | Roth
| |
- | | 6755.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 3
| |
- | | Methanol
| |
- | | Roth
| |
- | | CP43.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 4
| |
- | | Coomassie Brilliant Blue R-250
| |
- | | Roth
| |
- | | 9598.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 5
| |
- | | Trypton
| |
- | | Roth
| |
- | | 8952.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 6
| |
- | | Ethylene glycol
| |
- | | Roth
| |
- | | 9516.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 7
| |
- | | 3,4-Dihydroxybenzoic acid
| |
- | | Sigma-Aldrich
| |
- | | 37580-25G-F
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 8
| |
- | | Catechol
| |
- | | Sigma-Aldrich
| |
- | | C9510-100G
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 9
| |
- | | Isopropyl β-D-1-thiogalactopyranoside
| |
- | | Roth
| |
- | | CN08.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 10
| |
- | | Tetramethylethylenediamine
| |
- | | Roth
| |
- | | 2367.3
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 11
| |
- | | Ammonium persulfate
| |
- | | Roth
| |
- | | 9592.3
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 12
| |
- | | Bromophenol blue
| |
- | | Roth
| |
- | | A512.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 13
| |
- | | Glucose
| |
- | | Roth
| |
- | | X997.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 14
| |
- | | Calcium chloride
| |
- | | Roth
| |
- | | CN92.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 15
| |
- | | Dithiothreitol
| |
- | | Roth
| |
- | | 6908.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 16
| |
- | | Sodium carbonate
| |
- | | Roth
| |
- | | 8563.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 17
| |
- | | Phenylmethanesulfonylfluoride
| |
- | | Roth
| |
- | | 6367.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 18
| |
- | | NADH-Disodium
| |
- | | Roth
| |
- | | AE12.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 19
| |
- | | Nicotinamide adenine dinucleotide
| |
- | | Roth
| |
- | | AE11.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 20
| |
- | | orthophosphoric acid 85%
| |
- | | Roth
| |
- | | 9079.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 21
| |
- | | Trichloroacetic acid
| |
- | | Roth
| |
- | | 8789.2
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 22
| |
- | | Quick-Load® 100 bp DNA Ladder
| |
- | | NEB Biolabs
| |
- | | N0467S
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 23
| |
- | | Phenol
| |
- | | AppliChem
| |
- | | A4458.0250
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 24
| |
- | | Dimethyl sulfoxide
| |
- | | AppliChem
| |
- | | A1584.0100
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 25
| |
- | | Methylene blue
| |
- | | AppliChem
| |
- | | A4084.0025
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 26
| |
- | | Magnesium sulfate
| |
- | | AppliChem
| |
- | | A6287.0250
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 27
| |
- | | Cetrimonium bromide
| |
- | | AppliChem
| |
- | | A0805.0100
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 28
| |
- | | Tetramethylethylenediamine
| |
- | | AppliChem
| |
- | | A1148.0025
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 29
| |
- | | Urea
| |
- | | AppliChem
| |
- | | A5470.0500
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 30
| |
- | | Tween20
| |
- | | AppliChem
| |
- | | A1389.0500
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 31
| |
- | | Protein Marker III (6,5-200)
| |
- | | AppliChem
| |
- | | A4402.0001
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 32
| |
- | | Thiamine hydrochloride
| |
- | | AppliChem
| |
- | | A09955.0050
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 33
| |
- | | Triton X-100
| |
- | | AppliChem
| |
- | | A1388.0500
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 34
| |
- | | DNA-Dye NonTox
| |
- | | AppliChem
| |
- | | A9555.1000
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 35
| |
- | | Agarose
| |
- | | Roth
| |
- | | 3810.2
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 36
| |
- | | Ethanol 96 %
| |
- | | Roth
| |
- | | T171.4
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 37
| |
- | | Ethylenediaminetetraacetic acid
| |
- | | Roth
| |
- | | X986.2
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 38
| |
- | | Ethanol
| |
- | | Roth
| |
- | | P076.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 39
| |
- | | Tetracycline hydrochloride
| |
- | | Roth
| |
- | | 237.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 40
| |
- | | D-Desthiobiotin 10x Buffer E
| |
- | | iba
| |
- | | 2-1000-025
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 41
| |
- | | 2-(4-Hydroxyphenylazo)benzoic acid
| |
- | | Sigma-Aldrich
| |
- | | H5126-5G
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 42
| |
- | | 10 mM dNTP-Mix
| |
- | | Roth
| |
- | | L785.2
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 43
| |
- | | Hydrochloric acid
| |
- | | Roth
| |
- | | 9277.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 44
| |
- | | Acrylamid - Bis (37,5:1)
| |
- | | Roth
| |
- | | 3029.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 45
| |
- | | Ammonium acetate
| |
- | | Roth
| |
- | | 7869.2
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 46
| |
- | | Agar-Agar
| |
- | | Roth
| |
- | | 5210.3
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 47
| |
- | | Chloroform
| |
- | | Roth
| |
- | | 4423.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 48
| |
- | | Glycine
| |
- | | Roth
| |
- | | 3790.2
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 49
| |
- | | Dipotassium phosphate
| |
- | | Roth
| |
- | | T875.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 50
| |
- | | Sodium chloride
| |
- | | Roth
| |
- | | 9265.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 51
| |
- | | Yeast extract
| |
- | | Roth
| |
- | | 2363.2
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 52
| |
- | | Monopotassium phosphate
| |
- | | Roth
| |
- | | P018.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 53
| |
- | | Glycerine
| |
- | | Roth
| |
- | | 3783.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 54
| |
- | | Sodium hydroxide
| |
- | | Roth
| |
- | | P031.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 55
| |
- | | Tris-Base
| |
- | | Roth
| |
- | | AE15.2
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 56
| |
- | | Isopropyl alcohol
| |
- | | Roth
| |
- | | CP41.3
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 57
| |
- | | Isoamyl alcohol
| |
- | | Roth
| |
- | | T870.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 58
| |
- | | Acetonitrile
| |
- | | Roth
| |
- | | 7330.2
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 59
| |
- | | Acetone
| |
- | | Roth
| |
- | | 5025.5
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 60
| |
- | | Chloramphenicol
| |
- | | Roth
| |
- | | 3886.2
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 61
| |
- | | Ampicillin
| |
- | | Roth
| |
- | | K029.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 62
| |
- | | Kanamycin
| |
- | | Roth
| |
- | | T832.1
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 63
| |
- | | Sodium dodecyl sulfate
| |
- | | Roth
| |
- | | 5136.1
| |
- |
| |
- | |}
| |
- |
| |
- | ==Primer==
| |
- |
| |
- | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
- | |- style="font-size:11pt;font-weight:bold" align="center" valign="bottom"
| |
- | | width="22" height="15" | No.
| |
- | | width="89" | Name
| |
- | | width="422" | 5´-->3´
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 1
| |
- | | tphA2-l-F
| |
- | | TCATGCTTGCATCTCCTGTC
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 2
| |
- | | tphA2-l-Prefix
| |
- | | GAATTCGCGGCCGCTTCTAGATGCAAGAATCCATCATCCAGTGGC
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 3
| |
- | | tphA1-Suffix_R
| |
- | | CTGCAGCGGCCGCTACTAGTACTAATGGTTGCCAGTCGGGTCTG
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 4
| |
- | | tphA3-Suffix_R
| |
- | | CTGCAGCGGCCGCTACTAGTATCATAGCGGCAATGACATCAGCGTG
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 5
| |
- | | tphA3-Prefix_F
| |
- | | GAATTCGCGGCCGCTTCTAGATGATCCATGAAATTCAAATCGCGG
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 6
| |
- | | tphA1-l-R
| |
- | | CTAATGGTTGCCAGTCGGGT
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 7
| |
- | | tphA1-l-PstI(99)-F
| |
- | | CATGGTCTCCTCCAGGCCGGCATCGAGCT
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 8
| |
- | | tphA1-l-Prefix
| |
- | | GAATTCGCGGCCGCTTCTAGATGAACCACCAGATCCATATCCACG
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 9
| |
- | | tphA3-l-F
| |
- | | TCATAGCGGCAATGACATCA
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 10
| |
- | | tphA3-l-Prefix
| |
- | | GAATTCGCGGCCGCTTCTAGAGATGATCCATGAAATTCAAATCGC
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 11
| |
- | | Prefix
| |
- | | GAATTCGCGGCCGCTTCTAGAG
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 12
| |
- | | tphB-l-F
| |
- | | TCAGACCGGTTGGGCTCCGA
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 13
| |
- | | tphB-l-Prefix
| |
- | | GAATTCGCGGCCGCTTCTAGAGATGACAATAGTGCACCGTAGATT
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 14
| |
- | | tphA2-l-R
| |
- | | ATGCAAGAATCCATCATCCAG
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 15
| |
- | | tphA1-l-R
| |
- | | ATGAACCACCAGATCCATATC
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 16
| |
- | | tphA1-l-PstI(99)-R
| |
- | | CATGGTCTCCTGGAGGGCTGCATCCAGTAC
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 17
| |
- | | tphA3-l-R
| |
- | | ATGATCCATGAAATTCAAAT
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 18
| |
- | | Suffix
| |
- | | CTGCAGCGGCCGCTACTAGTA
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 19
| |
- | | tphB-l-Suffix-R
| |
- | | CTGCAGCGGCCGCTACTAGTATCAGACCGGTTGGGCTCCGAGTA
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 20
| |
- | | EcoRIGFxa-tphA1
| |
- | | TTCTGGAATTCGGGTATTGAAGGAAGAATGAACCACCAGATCCATAT
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 21
| |
- | | EcoRIGFxa-tphA2
| |
- | | TTCTGGAATTCGGGTATTGAAGGAAGAATGCAAGAATCCATCATCCA
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 22
| |
- | | EcoRIGFxa-tphA3
| |
- | | TTCTGGAATTCGGGTATTGAAGGAAGAATGATCCATGAAATTCAAAT
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 23
| |
- | | EcoRIGFxa-tphB
| |
- | | TTCTGGAATTCGGGTATTGAAGGAAGAATGACAATAGTGCACCGTAG
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 24
| |
- | | EcoRIGFxa-aroY
| |
- | | TTCTGGAATTCGGGTATTGAAGGAAGAATGACAGCGCCTATCCAG
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 25
| |
- | | RBS-tphA1
| |
- | | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGAACCACCAGATCCATAT
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 26
| |
- | | RBS-tphA2
| |
- | | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGCAAGAATCCATCATCCA
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 27
| |
- | | RBS-tphA3
| |
- | | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGATCCATGAAATTCAAAT
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 28
| |
- | | RBS-tphB
| |
- | | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGACAATAGTGCACCGTAG
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 29
| |
- | | RBS-aroY
| |
- | | TTCTGGAATTCGCGGCCGCTTCTAGAGAAAGACAGGACCTACTAGATGACAGCGCCTATCCAG
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 30
| |
- | | VF2
| |
- | | TGCCACCTGACGTCTAAGAA
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 31
| |
- | | VR
| |
- | | ATTACCGCCTTTGAGTGAGC
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 32
| |
- | | pPR-IBA2 rev
| |
- | | TAGTTATTGCTCAGCGGTGG
| |
- |
| |
- | |- style="font-size:11pt" align="center" valign="bottom"
| |
- | |style="font-weight:bold" align="center" height="15" | 33
| |
- | | pPR-IBA2 for
| |
- | | TAATACGACTCACTATAGGG
| |
- |
| |
- | |}
| |
- |
| |
- | ==Plasmids==
| |
- |
| |
- | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
- | |- style="font-size:11pt;font-weight:bold" align="center"
| |
- | | width="60" height="15" | No.
| |
- | | width="60" | Name
| |
- | | width="60" | Sequence
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | |style="font-weight:bold" align="center" height="15" | 1
| |
- | | pSB1C3
| |
- | |style="text-decoration:underline;color:#0000FF" | [http://partsregistry.org/Part:pSB1C3 Get]
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | |style="font-weight:bold;text-decoration:none" align="center" height="15" | 2
| |
- | | pSB1AK3
| |
- | |style="text-decoration:underline;color:#0000FF" | [http://partsregistry.org/Part:pSB1AK3 Get]
| |
- |
| |
- | |- align="center"
| |
- | |style="font-size:11pt;font-weight:bold;text-decoration:none" align="center" height="15" | 3
| |
- | | BBa_J61002
| |
- | |style="font-size:11pt;text-decoration:underline;color:#0000FF" | [http://partsregistry.org/Part:BBa_J61002 Get]
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | |style="font-weight:bold;text-decoration:none" align="center" height="15" | 4
| |
- | | pSB1A2
| |
- | |style="text-decoration:underline;color:#0000FF" | [http://partsregistry.org/Part:pSB1A2 Get]
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | |style="font-weight:bold;text-decoration:none" align="center" height="15" | 5
| |
- | | pPR-IBA2
| |
- | |style="text-decoration:underline;color:#0000FF" | [http://www.iba-lifesciences.com/isotope/2/2-1391-000-Sequence-pPR-IBA2.txt Get]
| |
- |
| |
- | |}
| |
- |
| |
- | ==Biobricks from the registry==
| |
- |
| |
- | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
- | |- style="font-size:11pt;font-weight:bold" align="center"
| |
- | | width="60" height="15" | No.
| |
- | | width="65" | Name
| |
- | | width="60" | Platte
| |
- | | width="60" | Well
| |
- | | width="60" | Resistence
| |
- | | width="90" | Plasmid backbone
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | |style="font-weight:bold" align="center" height="15" | 1
| |
- | | BBa_K316003
| |
- | | align="center" | 4
| |
- | | 15C
| |
- | | C
| |
- | | pSB1C3
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | |style="font-weight:bold" align="center" height="15" | 2
| |
- | | BBa_J23100
| |
- | | align="center" | 1
| |
- | | 18C
| |
- | | A
| |
- | | BBa_J61002
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | |style="font-weight:bold" align="center" height="15" | 3
| |
- | | BBa_B0015
| |
- | | align="center" | 1
| |
- | | 23L
| |
- | | A und K
| |
- | | pSB1AK3
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | |style="font-weight:bold" align="center" height="15" | 4
| |
- | | BBa_J61101
| |
- | | align="center" | 1
| |
- | | 5L
| |
- | | A
| |
- | | pSB1A2
| |
- |
| |
- | |}
| |
- |
| |
- |
| |
- | ==Bacteria==
| |
- |
| |
- | {| class="wikitable" <hiddentext>generated with [[:de:Wikipedia:Helferlein/VBA-Macro for EXCEL tableconversion]] V1.8<\hiddentext>
| |
- | |- style="font-size:11pt;font-weight:bold" align="center"
| |
- | | width="180" height="30" | Species
| |
- | | width="76" | Strain
| |
- | | width="501" | Genotype
| |
- | | width="46" | DSM-No.
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | | height="22" | Escherichia coli
| |
- | | DH5α
| |
- | | F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK- mK+), λ–
| |
- | | 6897
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | | height="17" | Escherichia coli
| |
- | | MG1655
| |
- | | F- λ- ilvG- rfb-50 rph-1
| |
- | | 18039
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | | height="19" | Escherichia coli
| |
- | | BL21(DE3)pLysS
| |
- | | F- ompT gal dcm lon hsdSB(rB- mB-) λ(DE3) pLysS(cmR)
| |
- | | none
| |
- |
| |
- | |- style="font-size:11pt" align="center"
| |
- | | height="15" | Comamonas testosteroni
| |
- | | Kf-1
| |
- | | -
| |
- | | 14576
| |
- |
| |
- | |}
| |