From 2012.igem.org

(Difference between revisions)

Latest revision as of 23:15, 26 September 2012

Omega-3 fatty acid synthesis

ω-3 fatty acids are a key component of the human diet. Our team is recreating this synthetic pathway in E. coli, using genes from the cyanobacteria Synechocystis and the trypanosomatid Leishmania major. Combining the DNA code for elongase and desaturase enzymes, we are planning to convert a fatty acid with a single desaturation into highly valuable ω-3 fatty acids.

Figure 1: "Synechocystis sp."
Figure 2: "Trypanosome cruzi"
Figure 3: "Leishmania major"

Omega-3 fatty acids are an essential part of the human diet (Bender, Bender, 1999). Human beings, like all larger organisms, cannot synthesize ω-3 fatty acids. This is due to a lack of the enzyme Δ15 desaturase, which creates a double bond at the 15th carbon of a long-chain fatty acid. Certain micro-organisms, such as microalgae and cyanobacteria, do contain this desaturase and can thus directly synthesize ω-3 fatty acids (Arts et al., 2009). ω-3 fatty acids then enter the food chain – algae are eaten by fish, and seafood is subsequently the main source of ω-3 for humans (Tonon et al., 2002).

However, the current economic policies of overfishing are a serious contributor to marine biodestruction. As the human population is estimated to rise to 9.1 billion by 2050 (Cohen, 2003), pressure on fish stock will increase. Additionally, global warming will reduce the availability of ω-3 (Arts et al., 2009): in response to high temperatures, microalgae produce less ω-3 desaturated fatty acids and more saturated fatty acids, as desaturated carbon chains cause a lower melting temperature in membranes (Garwin, Cronan, 1980). Thus, the combination of declining fish stock and a decrease in overall ω-3 fatty acids is making the supply for human nutrition a relevant issue.

Harvesting algae directly is costly and ineffective (Borowitzka, 1997). There is much potential in expressing a metabolic pathway for ω-3 fatty acid synthesis in E. coli, which is cheaper and more accessible.

Figure 4: "The metabolic pathway to ω-3 fatty acids"

Figure 4 shows the elongation and desaturation enzymes necessary to convert an 18:1 fatty acid, into an poly-unsaturated fatty acid.

modified from Livore et al., 2006

E. coli naturally synthesize unsaturated fatty acids up to a carbon chain length of 18, with a single desaturation (18:1) (Marr, Ingraham, 1969). Valuable ω-3 fatty acids require a double bonds at the third carbon from the end of its carbon chain and can have >20 carbons.

In order to have E. coli synthesize ω-3 fatty acids, we needed to introduce enzymes that could elongate and desaturate fatty acid substrates (cf. Fig. 4).

The genes for Δ12, Δ15 (ω6) and Δ6 were obtained from Synechocystis sp., a cyanobacterium. The trypanosomatid Leishmania major provided the DNA for the ELO 6 gene. Additionally, we used Trypanosome cruzi as a secondary source of Δ12.

However, our first successful ligations of Δ12 did not provide us with the expected 18:2 fatty acid. We hypothesized that E. coli’s inherent 18-carbon chain fatty acid might not be suited as a substrate for Δ12 – the double bond is in a different position, the 11th. Therefore, we "fed" our cells with suitable 18:1, to then observe 18:2 fatty acid, and ultimately ω-3 desaturation, in the mass spec results!

The following genes were employed (please click for sequences and KEGG numbers):

Δ6 Synechocystis Δ12 Synechocystis Δ15 Synechocystis ELO 6 L. major Δ12 T. Cruzi

These genes were amplified through PCR (Promega, GoTaq HotStart) at temperatures 48°C and 56°C.

The genes were initially ligated into pET-15b vector. After a number of expression attempts, some initial conclusions were reached. All experiments done on ELO6 failed. Also, Δ12 from T. cruzi gave overall weaker results than the same gene from Synechocystis. As such, latter work was only carried out on genes from Synechocystis.

Then, Δ6, Δ12, and Δ15 desaturases were successfully ligated into two distinct pET-Duet vectors (vectors with two multicloning sites). One vector contained Δ12 and Δ15 desaturases, and the other was ligated only with Δ6 desaturase.

Protein expression was clear after transformation into cell strain BL21(DE3) and induction by IPTG. However, functionality could not be established. It was hypothesized that the naturally-occuring 18:1 fatty acid in E. coli is the wrong substrate for the desaturases. This fatty acid has its desaturation at the 11th carbon, not at the 9th position required for a substrate. Thus, the E. coli were fed 18:1 (Δ9).

Full characterisatin and quantification of the fatty acid composition in transformed E. coli was performed by fatty acid conversion to the corresponding fatty acid methyl esters (FAMEs) followed by GC-MS analysis. In this way, lipid profiles of membrane assays and lipid extracts from cells were obtained.

After characterization, we ligated each of our desaturases into the submission vector pSB1C3.

Fig. 5: "UV photograph of PCR results"

The figure shows the results of a PCR extraction of our genes of choice, done with GoTaq HotStart PCR kit at 2 different annealing temperatures: Δ12 (48°C) - Δ12 (56°C) - Δ15 (48°C) - Δ15 (56°C) - Δ6 (48°C) - Δ6 (56°C).

Primers

All primers are notated 5' to 3'. Initially, we worked with NdeI and XhoI as the restriction sites.

When using the pET-duet vector, we needed additional primers for the alternative restriction sites and His-tags. For Δ6 and Δ12, we cut with HindIII and EcoRI; NdeI and XhoI were used for Δ15 and ELO6.

Analysis

Lipid Analysis

Lipids were extracted from transformed E. coli using the Blight/Dyer method. (Please refer to the Lipid extraction lab book entry for further detail.)

Mass Spectrometry

Lipids were extracted from transformed E. coli using the Blight/Dyer method. (Please refer to the Lipid extraction lab book entry for further detail.)

The fatty acid content of the transformed cells was measured to determine whether it differed from the previously analyzed background lipid composition. This was done using mass spectrometry.

Bradford protein assay

A Bradford protein assay was carried out to assess protein concentration (Bradford, 1976).

Sequencing

We sent off samples to GATC for sequencing.

The fatty acids were released by base hydrolysis followed by organic extraction, the resulting fatty acids were derivatised with diazomethane to the corresponding fatty acid methyl esters (FAMEs), together with fatty acid standards. The samples were analysed by GC-MS and the retention times and fragmentation patterns, compared with FAME standards. The results are shown in Charts 3,4 and 5.

By combining a number of genes, we were able to partially recreate the pathway described above (Fig. 4).

Due to time constraints, we were unable to submit a BioBrick containing the sequence of all of the necessary genes for the ω-3 biosynthetic pathway. However, we were able to express and characterise Δ12, Δ15 and Δ6 desaturases, the first three enzymes involved in ω-3 biosynthesis. As shown in charts 2, 3 and 4, the presence of alpha-linoleic acid (18:3^Δ9,12,15), an omega-3 fatty acid, can be observed in E. coli. This does not occur naturally in their bacterial membrane.

Mass Spectrometry

Chart 2: "Fatty acid methyl ester analysis"

C18:3 refers to an 18 carbon backbone with 3 double bonds. C18:2 and C18:1 would have 2 double bonds and 1 respectively. The upper portion of this figure shows the peaks generated by the standard expected fatty acid methyl esters.The lower 4 panels show mass spec fingerprints that are indicative of our fatty acids of interest.

Chart 3: "Lipid extraction analysis"

All of the cellular lipids were extracted and their fatty acid methyl esters produced. These were analysed by mass spec. In the control cells no C18:2 is present. When Δ6 is expressed, a peak indicative of C18:2 is present. However, the primary fatty acid is still C18:1 - with the bouble bond present at position 9. With the expression of Δ12 and the addition of exogenous C18:1(Δ9) we get great abundance of C18:2 and negligible abundance of C18:1 indicating that the C18:1 is being processed successfully. The lowest graph shows that Δ12 expressed with Δ15 acts in a complementary fashion and the expected C18:3 - an Omega 3 - is produced.

Chart 4: "Membrane assay"

The cellular membranes were extracted and their lipids were analysed by mass spec. As in chart 2 it is confirmed that expression of Δ12 and Δ15 lead to the production of omega 3 fatty acids. This chart shows that these lipids locate to the plasma membrane of the bacteria

Bradford protein assay

Chart 5: "Bradford protein assay"

This chart shows the standard results of a Bradford protein assay. Measuring the absorbance at 595nm for set samples, a standard curve was calculated with the equation of y = 0.0006x + 0.0426.

Table 1: "Bradford protein assay"

Using the standard curve shown in chart 5, the protein concentrations of a number of transformed plasmids was calculated.

We have submitted 3 BioBricks involved in the ω-3 biosynthetic pathway to the Registry of Standard Parts:

Biobrick	Short name	Description	Length
BBa_K925000	Delta-12 desaturase	Desaturase introducing a double bond at the Δ-12 site in the hydrocarbon chain of oleic acid (18:1, Δ9) to give linoleic acid (18:2 Δ9,12)	1056
BBa_K925001	Delta-15 desaturase	Desaturase introducing a double bond at the Δ-15 site in the hydrocarbon chain of linoleic acid (18:2 ; Δ9,12) for its convertion into alpha-linoleic acid (18:3 ; Δ9,12,15), an ω -3 PUFA	1080
BBa_K925003	Delta-6 desaturase	Desaturase introducing a double bond at the Δ-12 site in the hydrocarbon chain of oleic acid (18:1, Δ9) to give linoleic acid (18:2 Δ9,12)	1080

Arts, et al., 2009. Lipids in Aquatic Ecosystems. New York. Springer.

Bender D. A. and Bender, A. E, 1999. Benders' dictionary of nutrition and food technology. Cambridge: CRC Press.

Bradford, M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 7;72:248-54.

Cohen, J., 2003. Human Population: The Next Half Century. Science, New Series, Vol. 302, No. 5648. Pp. 1172-1175.

Garwin J. L. and Cronan J. E. Jr, 1980. Thermal modulation of fatty acid synthesis in Escherichia coli does not involve de novo enzyme synthesis. J Bacteriol, 141(3): 1457–1459.

Livore V., Tripodi K., Utarro A., 2007. Elongation of polyunsaturated fatty acids in trypanosomatids. FEBS Journal, 274: 264–274.

Marr A., Ingraham J., 1969. Effect of temperature on the composition of fatty acids in Escherichia coli. J. Bactiol. 84(6). Pp. 1260–1267.

Tonon T., et al., 2002. Long chain polyunsaturated fatty acid production and partitioning to triacylglycerols in four microalgae. Phytochemistry, Vol 61 Iss 1. Pgs 15-24.

Team:St Andrews/Omega-3-synthesis

From 2012.igem.org

Latest revision as of 23:15, 26 September 2012

Omega-3 fatty acid synthesis

Introduction

Project description

Figure 1: "Synechocystis sp."

Figure 2: "Trypanosome cruzi"

Figure 3: "Leishmania major"

Recreating the pathway

Figure 4: "The metabolic pathway to ω-3 fatty acids"

Methods

Fig. 5: "UV photograph of PCR results"

Primers

Analysis

Results

Mass Spectrometry

Chart 2: "Fatty acid methyl ester analysis"

Chart 3: "Lipid extraction analysis"

Chart 4: "Membrane assay"

Bradford protein assay

Chart 5: "Bradford protein assay"

Table 1: "Bradford protein assay"

Biobricks

References

@@ Line 4: / Line 4: @@
 <head>
 <link rel="stylesheet" href="https://2012.igem.org/Team:St_Andrews/Template:DocsCssFull?action=raw&ctype=text/css" type="text/css" />
 <style type="text/css">
-h2 {
+h2 {padding-top: 0.5em;}
-      padding-top: 40px;
+.image-caption {margin-top: 0.5em;margin-bottom: 0.25em;}
-     }
+.thumbnail {text-decoration:none !important;background-color:#ffffff}
+.thumbnail:hover {color:inherit !important}
 </style>
 </head>
@@ Line 14: / Line 17: @@
-     <div class="container" id="content-container">
+     <div class="container" id="content-container" style="background-image:url('https://static.igem.org/mediawiki/2012/thumb/6/60/Omega3logo2Watermark.jpg/281px-Omega3logo2Watermark.jpg');background-repeat:no-repeat;background-position:top right;background-size:35%">
 <!-- Masthead
@@ Line 24: / Line 27: @@
      <ul class="nav nav-pills">
        <li><a href="#content-container">Introduction</a></li>
-       <li><a href="#project-description">Project Description</a></li>
+       <li><a href="#project-description">Project description</a></li>
-       <li><a href="#synthesizing-pathway">Synthesizing the pathway</a></li>
+       <li><a href="#Recreating-pathway">Recreating the pathway</a></li>
        <li><a href="#methods">Methods</a></li>
+      <li><a href="#results">Results</a></li>
        <li><a href="#biobricks">Biobricks</a></li>
        <li><a href="#references">References</a></li>
@@ Line 38: / Line 42: @@
 </div>
 <img src="https://static.igem.org/mediawiki/2012/5/57/OmegaThreeLogo_100.png" align="left"></img>
-		<p>ω-3 Fatty acids are an essential component of our diet and are paramount to maintaining human health. Our team is recreating this synthetic pathway in E. coli, using genes from the cyanobacteria Synechocystis and the trypanosomatid Leishmania major. Combining the DNA code for elongase and desaturase enzymes, we can convert the plain fatty acid of E. coli into highly valuable ω-3 fatty acids.
-</p>
+		<p>ω-3 fatty acids are a key component of the human diet. Our team is recreating this synthetic pathway in <i>E. coli</i>, using genes from the cyanobacteria Synechocystis and the trypanosomatid Leishmania major. Combining the DNA code for elongase and desaturase enzymes, we are planning to convert a fatty acid with a single desaturation into highly valuable ω-3 fatty acids.</p>
 <br>
 </section>
 <section id="project-description">
-	<br>
+<div class="page-header">
-  <h2>Project Description</h2>
+	<h1>Project description</h1>
+</div>
 <div class="row-fluid">
@@ Line 53: / Line 56: @@
                  <li class="span4">
                      <div class="thumbnail">
-                         <img src="https://static.igem.org/mediawiki/2012/7/78/Synechocystis_edit.jpg" alt=""><br>
+                         <img src="https://static.igem.org/mediawiki/2012/7/78/Synechocystis_edit.jpg" alt="" />
-		<p></p>
-		<center><i>Synechocystis sp.</i></center>
+<div class="image-caption">
-		<p></p>
+<p><h5>Figure 1: <em>"Synechocystis sp."</em></h5></p>
+</div>
                      </div>
                  </li>
@@ Line 62: / Line 66: @@
                  <li class="span4">
                      <div class="thumbnail">
-                         <img src="https://static.igem.org/mediawiki/2012/5/58/Trypanosoma-cruzi.jpg" alt=""><br>
+                         <img src="https://static.igem.org/mediawiki/2012/5/58/Trypanosoma-cruzi.jpg" alt="" />
-		<p></p>
+<div class="image-caption">
-		<center><i>Trypanosome cruzi</i></center>
+<p><h5>Figure 2: <em>"Trypanosome cruzi"</em></h5></p>
-		<p></p>
+</div>
                      </div>
                  </li>
@@ Line 71: / Line 75: @@
                  <li class="span4">
                      <div class="thumbnail">
-                         <img src="https://static.igem.org/mediawiki/2012/4/48/Leishmania_major_promastigotes_edit.jpg" alt=""><br>
+                         <img src="https://static.igem.org/mediawiki/2012/4/48/Leishmania_major_promastigotes_edit.jpg" alt="" />
-		<p></p>
+<div class="image-caption">
-		<center><i>Leishmania major</i></center>
+<p><h5>Figure 3: <i>"Leishmania major"</i></h5></p>
-		<p></p>
+</div>
                      </div>
                  </li>
@@ Line 82: / Line 86: @@
 <p></p>
-       <p>Omega-3 fatty acids are an essential part of the human diet (Bender, Bender, 1999). Human beings, as all larger organisms, cannot synthesize ω-3 fatty acids, This is due to a lack of the enzyme Δ15 desaturase, which creates a double bond at the 15th carbon of a long-chain fatty acid. Certain microrganisms, such as microalgae and cyanobacteria, do contain this desaturase and can thus directly synthesize ω-3 fatty acids (Arts <i>et al</i>, 2009). ω-3 fatty acids then enter the food chain – algae are eaten by fish, and seafood is sbsequently the main source of ω-3 for humans(Tonon et al, 2002).</p>
-<p>However, the current economic policies of overfishing are a serious contributor to marine biodestruction. As the human population is estimated to rise to 9.1 billion by 2050 (Cohen, 2003), pressure on fish stock will increase. Additionally, global warming will reduce the availability of ω-3 (Arts et al, 2009):  at higher temperatures, microalgae produce less ω-3 desaturated fatty acids. Desaturated carbon chains cause a lower melting temperature in the membrane, which the microorganism wants to avoid by synthesizing more saturated fatty acids in their membranes (Garwin, Cronan, 1980). Thus, the combination of declining fish stock and a decrease in overall ω-3 fatty acids is making the supply for human nutrition a relevant issue. </p>
+       <p>Omega-3 fatty acids are an essential part of the human diet (Bender, Bender, 1999). Human beings, like all larger organisms, cannot synthesize ω-3 fatty acids. This is due to a lack of the enzyme Δ15 desaturase, which creates a double bond at the 15th carbon of a long-chain fatty acid. Certain micro-organisms, such as microalgae and cyanobacteria, do contain this desaturase and can thus directly synthesize ω-3 fatty acids (Arts <i>et al.</i>, 2009). ω-3 fatty acids then enter the food chain – algae are eaten by fish, and seafood is subsequently the main source of ω-3 for humans (Tonon et al., 2002).</p>
+<p>However, the current economic policies of overfishing are a serious contributor to marine biodestruction. As the human population is estimated to rise to 9.1 billion by 2050 (Cohen, 2003), pressure on fish stock will increase. Additionally, global warming will reduce the availability of ω-3 (Arts et al., 2009):  in response to high temperatures, microalgae produce less ω-3 desaturated fatty acids and more saturated fatty acids, as desaturated carbon chains cause a lower melting temperature in membranes (Garwin, Cronan, 1980). Thus, the combination of declining fish stock and a decrease in overall ω-3 fatty acids is making the supply for human nutrition a relevant issue. </p>
 <p>Harvesting algae directly is costly and ineffective (Borowitzka, 1997). There is much potential in expressing a metabolic pathway for ω-3 fatty acid synthesis in <i>E. coli</i>, which is cheaper and more accessible. </p>
-<section id="synthesizing-pathway">
+<section id="Recreating-pathway">
-	<br>
+<div class="page-header">
-<h2>Synthesizing the pathway</h2>
+	<h1>Recreating the pathway</h1>
+</div>
-<div class="row-fluid">
+<div class="row">
-            <ul>
+<div class="span6">
-                <li class="span4">
+<img src="https://static.igem.org/mediawiki/2012/8/88/Pathway.gif" alt="" />
-                    <div class="thumbnail">
+<p><h5>Figure 4: <em>"The metabolic pathway to ω-3 fatty acids"</em></h5></p>
-                        <img src="https://static.igem.org/mediawiki/2012/8/88/Pathway.gif" alt=""><br>
+<div class="span5"><p>Figure 4 shows the elongation and desaturation enzymes necessary to convert an 18:1 fatty acid, into an poly-unsaturated fatty acid.</p>
-		<p></p>
+<p><em>modified from Livore et al., 2006</em></p>
-		<center>Figure 1 showing the elongation and desaturation enzymes necessary to convert an 18:1 fatty acid, which <i>E. coli</i> synthesizes, into an poly-unsaturated fatty acid.
+</div>
-                <p></p>
+</div>
-                <p><i>modified from Livore et al, 2006</i></p></center>
-		<p></p>
-                </ul>
-  </div>
-<p></p>
-<p><i>E. coli</i> naturally synthesize poly-unsaturated fatty acids up to a carbon chain length of 18, with a single desaturation at the 9th carbon (18:1) (Marr, Ingraham, 1969). Valuable ω-3 fatty acids require 3 double bonds, and need to have a chain length between 18 and 22 carbons.
-<p>In order to have <E. coli</i> synthesize ω-3 fatty acids, we needed to introduce enzymes that could elongate and desaturate fatty acid substrates. As seen in Fig. 1, this pathway can be recreated by a number of desaturases and elongases.</p>
+<div class="span6">
+<p><i>E. coli</i> naturally synthesize unsaturated fatty acids up to a carbon chain length of 18, with a single desaturation (18:1) (Marr, Ingraham, 1969). Valuable ω-3 fatty acids require a double bonds at the third carbon from the end of its carbon chain and can have >20 carbons.</p>
-<p>The genes for Δ12, Δ15 (ω6) and Δ6 were obtained from <i>Synechocystis sp.</i>, a cyanobacteria. The trypanosomatid <i>Leishmania major</i> provided the DNA for the ELO 6 gene. Additionally, we used <i>Trypanosome cruzi</i> as a secondary source of Δ12. </p>
+<p>In order to have <i>E. coli</i> synthesize ω-3 fatty acids, we needed to introduce enzymes that could elongate and desaturate fatty acid substrates (cf. Fig. 4).</p>
+<p>The genes for Δ12, Δ15 (ω6) and Δ6 were obtained from <i>Synechocystis sp.</i>, a cyanobacterium. The trypanosomatid <i>Leishmania major</i> provided the DNA for the ELO 6 gene. Additionally, we used <i>Trypanosome cruzi</i> as a secondary source of Δ12.</p>
+<p>However, our first successful ligations of Δ12 did not provide us with the expected 18:2 fatty acid. We hypothesized that <i>E. coli</i>’s inherent 18-carbon chain fatty acid might not be suited as a substrate for Δ12 – the double bond is in a different position, the 11th. Therefore, we "fed" our cells with suitable 18:1, to then observe 18:2 fatty acid, and ultimately ω-3 desaturation, in the mass spec results!</p>
+</div>
+</div>
-<p>However, our first successful ligations of Δ12 did not yield us with the expected 18:2 fatty acid. We hypothesized that E. coli’s inherent 18-carbon chain fatty acid might not be suited as a substrate for Δ12 – perhaps the double bond is in a different position. Therefore, we “fed” our cells with suitable 18:1, to then observe 18:2 fatty acid in the mass spec results!</p>
 </section>
 <section id="methods">
-	<br>
+<div class="page-header">
-<h2>Methods</h2>
+<h1>Methods</h1>
+</div>
+<div class="row-fluid">
+<div class="span6">
+<p> The following genes were employed (please click for sequences and KEGG numbers):</p>
-<span class="label label-info"><a href="#Sequences"><font color="white">Sequences</font></a></span>&nbsp;&nbsp;&nbsp;<span class="label label-info"><a href="#Primers"><font color="white">Primers</font></a></span>&nbsp;&nbsp;&nbsp;<span class="label label-info"><a href="#Sequencing"><font color="white">Sequencing results</font></a></span>&nbsp;&nbsp;&nbsp;<span class="label label-info"><a href="#Lipid"><font color="white">Lipid analysis</font></a></span>&nbsp;&nbsp;&nbsp;<span class="label label-info"><a href="#massspec"><font color="white">Mass Spectrometry</font></a></span>
-<BR>&nbsp;</BR>
-<a name="Sequences"><span class="label label-info">Sequences</span></a>
-<BR>&nbsp;</BR>
-<p>
 <div class="btn-toolbar">
-<a data-toggle="modal" href="#modal1" class="btn btn-primary btn-small"><font color="white">Δ12 T. Cruzi</font></a>
-<div class="modal hide" id="modal1">
+<a data-toggle="modal" href="#modal4" class="btn btn-primary btn-small"><font color="white">Δ6 Synechocystis</font></a>
+<div class="modal hide" id="modal4">
    <div class="modal-header">
      <button type="button" class="close" data-dismiss="modal">×</button>
-     <h3>Δ12 T. Cruzi</h3>
+     <h3>Δ6 Synechocystis</h3>
    </div>
    <div class="modal-body">
-<p>ATGTCGCGGGTTGACAATTTAACTGTCGCGCCGGGTCCACCGGATGTCATGAAGGCGGTG
+    <p>ATGCTAACAGCGGAAAGAATTAAATTTACCCAGAAACGGGGGTTTCGTCGGGTACTAAAC
-CTTAAGTCTGGGCGCAACAAGGAGCACAATGTCATTGTGCCTTCCTCCGCACTGACCATTG
+CAACGGGTGGATGCCTACTTTGCCGAGCATGGCCTGACCCAAAGGGATAATCCCTCCATG
-GAGAAATTCAGGAGAAAATCCCGGTAAAGTACTTTGAACGCAACACTACCCGGAGCGTCA
+TATCTGAAAACCCTGATTATTGTGCTCTGGTTGTTTTCCGCTTGGGCCTTTGTGCTTTTT
-TGTTTCTTTTACGCGACCTCGCACAGGTGGCGTTGACGTACGCCATTATGTACGCCGTCGCC
+GCTCCAGTTATTTTTCCGGTGCGCCTACTGGGTTGTATGGTTTTGGCGATCGCCTTGGCG
-TTGCCACTTGCCACTTCCATGGAAGTTTCTGCAGCAAGAACGTTGGCCGACGGTGGGGTGT
+GCCTTTTCCTTCAATGTCGGCCACGATGCCAACCACAATGCCTATTCCTCCAATCCCCAC
-TATCATTGATGGCAGGTACAGCCATGACGACAGCGGCGTGGCTTTTAAAGGCAGTGTTGTG
+ATCAACCGGGTTCTGGGCATGACCTACGATTTTGTCGGGTTATCTAGTTTTCTTTGGCGC
-GGCGGTGTTTTGGTTTGTACAGGGACTTAACGGCACTGCGCTTTGGGTCCTGGCTCACGAA
+TATCGCCACAACTATTTGCACCACACCTACACCAATATTCTTGGCCATGACGTGGAAATC
-TGCGGCCATCAGGCGTTCAGCCCCATGAAAGGTTTGAATGACGCCGTTGGCATGATTTTGC
+CATGGAGATGGCGCAGTACGTATGAGTCCTGAACAAGAACATGTTGGTATTTATCGTTTC
-ACTCTGCGCTGCTCGTGCCGTACCACAGCTGGCGCATCACCCACGGCGGCCACCACAAACA
+CAGCAATTTTATATTTGGGGTTTATATCTTTTCATTCCCTTTTATTGGTTTCTCTACGAT
-CACGAATCACCTCACGAAGGATCTTGTGTTTGTTCCAGACAAACGAAACGCGGTTGTGGAG
+GTCTACCTAGTGCTTAATAAAGGCAAATATCACGACCATAAAATTCCTCCTTTCCAGCCC
-CTCGTGGAGGAGGCGCCGCTGGTGTTATTAATTCAATTATTGCTGATTTTTCTCTTTGGTTG
+CTAGAATTAGCTAGTTTGCTAGGGATTAAGCTATTATGGCTCGGCTACGTTTTCGGCTTA
-GCCGGCACATCTTCTTTTTAATGCCTCTGGACAGGAATTTGGCCGACTCGCGAGCCACTTTG
+CCTCTGGCTCTGGGCTTTTCCATTCCTGAAGTATTAATTGGTGCTTCGGTAACCTATATG
-ACCCCGGCGCTCCATTTTTCCGCAGCGAAGACCGTCACGATATTGTCCTGTCGAATGTTGGG
+ACCTATGGCATCGTGGTTTGCACCATCTTTATGCTGGCCCATGTGTTGGAATCAACTGAA
-ATTGTCAGCGCGTTATTTGTCATTTTCTCCAGCGTTTACCGCTTTGGTTTTACAAATGTTTTCT
+TTTCTCACCCCCGATGGTGAATCCGGTGCCATTGATGACGAGTGGGCTATTTGCCAAATT
-GCTGGTACATTGTACCGTACCTCTGGGTGAACTTTTGGCTG
+CGTACCACGGCCAATTTTGCCACCAATAATCCCTTTTGGAACTGGTTTTGTGGCGGTTTA
-TGTACATTACATACCTGCAGCACACGGATATACGCATTCCTCACTACACACATGAGCACT
+AATCACCAAGTTACCCACCATCTTTTCCCCAATATTTGTCATATTCACTATCCCCAATTG
-GGACGTTTGTTCGCGGTGCATTGGCGGCTGTGGACAGGGACTACGGCTTTGTCCTTAACA
+GAAAATATTATTAAGGATGTTTGCCAAGAGTTTGGTGTGGAATATAAAGTTTATCCCACC
-CATGGCTCCATCACATCAATGATTCCCACGTGGTACATCACCTCTTTAGCAAAATGCCAC
+TTCAAAGCGGCGATCGCCTCTAACTATCGCTGGCTAGAGGCCATGGGCAAAGCATCGTGA</p>
-ACTACAACGCAATCCAGGTGACAAGAAAGTACATTCGTGAGATACTGGGTGCCACATACA
+<p>KEGG entry sll0541</p>
-TTACGGATGAGAGGTCACTGTGGAAGATGCTCTGGGAACAGCGTAGAGAGTGCCGCTATG
-TTGTTCCCGCAGAGGGCGTCTGTGTCTTTCATGGGTAA</p>
    </div>
    <div class="modal-footer">
@@ Line 183: / Line 189: @@
 GGCTACCGCACCTTCGGCTCCCTGAAAAAAGTTTAA
 </p>
+<p>KEGG entry 429257.20</p>
    </div>
    <div class="modal-footer">
      <a href="#" class="btn" data-dismiss="modal">Close</a>
      </div>
-</div>
+    </div>
 <a data-toggle="modal" href="#modal3" class="btn btn-primary btn-small"><font color="white">Δ15 Synechocystis</font></a>
@@ Line 215: / Line 223: @@
 CAAGGTTCAGGGGTCTATTACCAATCCCCATCCAATGGTGGATATCAAAAGAAACCTTAA
 </p>
+<p>KEGG entry s111441</p>
    </div>
    <div class="modal-footer">
      <a href="#" class="btn" data-dismiss="modal">Close</a>
      </div>
-</div>
+    </div>
-<a data-toggle="modal" href="#modal4" class="btn btn-primary btn-small"><font color="white">Δ6 Synechocystis</font></a>
-<div class="modal hide" id="modal4">
-  <div class="modal-header">
-    <button type="button" class="close" data-dismiss="modal">×</button>
-    <h3>Δ6 Synechocystis</h3>
-  </div>
-  <div class="modal-body">
-    <p>ATGCTAACAGCGGAAAGAATTAAATTTACCCAGAAACGGGGGTTTCGTCGGGTACTAAAC
-CAACGGGTGGATGCCTACTTTGCCGAGCATGGCCTGACCCAAAGGGATAATCCCTCCATG
-TATCTGAAAACCCTGATTATTGTGCTCTGGTTGTTTTCCGCTTGGGCCTTTGTGCTTTTT
-GCTCCAGTTATTTTTCCGGTGCGCCTACTGGGTTGTATGGTTTTGGCGATCGCCTTGGCG
-GCCTTTTCCTTCAATGTCGGCCACGATGCCAACCACAATGCCTATTCCTCCAATCCCCAC
-ATCAACCGGGTTCTGGGCATGACCTACGATTTTGTCGGGTTATCTAGTTTTCTTTGGCGC
-TATCGCCACAACTATTTGCACCACACCTACACCAATATTCTTGGCCATGACGTGGAAATC
-CATGGAGATGGCGCAGTACGTATGAGTCCTGAACAAGAACATGTTGGTATTTATCGTTTC
-CAGCAATTTTATATTTGGGGTTTATATCTTTTCATTCCCTTTTATTGGTTTCTCTACGAT
-GTCTACCTAGTGCTTAATAAAGGCAAATATCACGACCATAAAATTCCTCCTTTCCAGCCC
-CTAGAATTAGCTAGTTTGCTAGGGATTAAGCTATTATGGCTCGGCTACGTTTTCGGCTTA
-CCTCTGGCTCTGGGCTTTTCCATTCCTGAAGTATTAATTGGTGCTTCGGTAACCTATATG
-ACCTATGGCATCGTGGTTTGCACCATCTTTATGCTGGCCCATGTGTTGGAATCAACTGAA
-TTTCTCACCCCCGATGGTGAATCCGGTGCCATTGATGACGAGTGGGCTATTTGCCAAATT
-CGTACCACGGCCAATTTTGCCACCAATAATCCCTTTTGGAACTGGTTTTGTGGCGGTTTA
-AATCACCAAGTTACCCACCATCTTTTCCCCAATATTTGTCATATTCACTATCCCCAATTG
-GAAAATATTATTAAGGATGTTTGCCAAGAGTTTGGTGTGGAATATAAAGTTTATCCCACC
-TTCAAAGCGGCGATCGCCTCTAACTATCGCTGGCTAGAGGCCATGGGCAAAGCATCGTGA</p>
-  </div>
-  <div class="modal-footer">
-    <a href="#" class="btn" data-dismiss="modal">Close</a>
-    </div>
-</div>
 <a data-toggle="modal" href="#modal5" class="btn btn-primary btn-small"><font color="white">ELO 6 L. major</font></a>
@@ Line 275: / Line 254: @@
 GCGAAGAAGAAGCACCGGGGCTACGTCAAGGCGGACCCGGCCAATAAAAAGAAGGCCGCC
 ATTCTGCCCTTCATCATGTAG</p>
+<p>KEGG entry LmjF32.1160</p>
+  </div>
+  <div class="modal-footer">
+    <a href="#" class="btn" data-dismiss="modal">Close</a>
+    </div>
+    </div>
+<a data-toggle="modal" href="#modal1" class="btn btn-primary btn-small"><font color="white">Δ12 T. Cruzi</font></a>
+<div class="modal hide" id="modal1">
+  <div class="modal-header">
+    <button type="button" class="close" data-dismiss="modal">×</button>
+    <h3>Δ12 T. Cruzi</h3>
+  </div>
+  <div class="modal-body">
+<p>ATGTCGCGGGTTGACAATTTAACTGTCGCGCCGGGTCCACCGGATGTCATGAAGGCGGTG
+CTTAAGTCTGGGCGCAACAAGGAGCACAATGTCATTGTGCCTTCCTCCGCACTGACCATTG
+GAGAAATTCAGGAGAAAATCCCGGTAAAGTACTTTGAACGCAACACTACCCGGAGCGTCA
+TGTTTCTTTTACGCGACCTCGCACAGGTGGCGTTGACGTACGCCATTATGTACGCCGTCGCC
+TTGCCACTTGCCACTTCCATGGAAGTTTCTGCAGCAAGAACGTTGGCCGACGGTGGGGTGT
+TATCATTGATGGCAGGTACAGCCATGACGACAGCGGCGTGGCTTTTAAAGGCAGTGTTGTG
+GGCGGTGTTTTGGTTTGTACAGGGACTTAACGGCACTGCGCTTTGGGTCCTGGCTCACGAA
+TGCGGCCATCAGGCGTTCAGCCCCATGAAAGGTTTGAATGACGCCGTTGGCATGATTTTGC
+ACTCTGCGCTGCTCGTGCCGTACCACAGCTGGCGCATCACCCACGGCGGCCACCACAAACA
+CACGAATCACCTCACGAAGGATCTTGTGTTTGTTCCAGACAAACGAAACGCGGTTGTGGAG
+CTCGTGGAGGAGGCGCCGCTGGTGTTATTAATTCAATTATTGCTGATTTTTCTCTTTGGTTG
+GCCGGCACATCTTCTTTTTAATGCCTCTGGACAGGAATTTGGCCGACTCGCGAGCCACTTTG
+ACCCCGGCGCTCCATTTTTCCGCAGCGAAGACCGTCACGATATTGTCCTGTCGAATGTTGGG
+ATTGTCAGCGCGTTATTTGTCATTTTCTCCAGCGTTTACCGCTTTGGTTTTACAAATGTTTTCT
+GCTGGTACATTGTACCGTACCTCTGGGTGAACTTTTGGCTG
+TGTACATTACATACCTGCAGCACACGGATATACGCATTCCTCACTACACACATGAGCACT
+GGACGTTTGTTCGCGGTGCATTGGCGGCTGTGGACAGGGACTACGGCTTTGTCCTTAACA
+CATGGCTCCATCACATCAATGATTCCCACGTGGTACATCACCTCTTTAGCAAAATGCCAC
+ACTACAACGCAATCCAGGTGACAAGAAAGTACATTCGTGAGATACTGGGTGCCACATACA
+TTACGGATGAGAGGTCACTGTGGAAGATGCTCTGGGAACAGCGTAGAGAGTGCCGCTATG
+TTGTTCCCGCAGAGGGCGTCTGTGTCTTTCATGGGTAA</p>
+<p>KEGG entry 429257.20</p>
    </div>
    <div class="modal-footer">
@@ Line 280: / Line 295: @@
      </div>
 </div>
+</div>
+<BR>
+<p>These genes were amplified through PCR (Promega, GoTaq HotStart) at temperatures 48°C and 56°C.</p>
+<p>The genes were initially ligated into pET-15b vector. After a number of expression attempts, some initial conclusions were reached. All experiments done on ELO6 failed. Also, Δ12 from <i>T. cruzi</i> gave overall weaker results than the same gene from <i>Synechocystis</i>. As such, latter work was only carried out on genes from <i>Synechocystis</i>.</p>
+<p>Then, Δ6, Δ12, and Δ15 desaturases were successfully ligated into two distinct pET-Duet vectors (vectors with two multicloning sites). One vector contained Δ12 and Δ15 desaturases, and the other was ligated only with Δ6 desaturase.</p>
+<p>Protein expression was clear after transformation into cell strain BL21(DE3) and induction by IPTG. However, functionality could not be established. It was hypothesized that the naturally-occuring 18:1 fatty acid in <i>E. coli</i> is the wrong substrate for the desaturases. This fatty acid has its desaturation at the 11th carbon, not at the 9th position required for a substrate. Thus, the <i>E. coli</i> were fed 18:1 (Δ9).</p>
+<p>Full characterisatin and quantification of the fatty acid composition in transformed <i>E. coli</i> was performed by fatty acid conversion to the corresponding fatty acid methyl esters (FAMEs) followed by GC-MS analysis. In this way, lipid profiles of membrane assays and lipid extracts from cells were obtained.</p>
+<p>After characterization, we ligated each of our desaturases into the submission vector pSB1C3.</p>
+</div>
+<div class="span6 well">
+    <ul class="thumbnails">
+    <img src="https://static.igem.org/mediawiki/2012/6/61/PCR_of_genes.png" alt="">
+<p><h5>Fig. 5: <em>"UV photograph of PCR results"</em></h5></p>
+<p>The figure shows the results of a PCR extraction of our genes of choice, done with GoTaq HotStart PCR kit at 2 different annealing temperatures: Δ12 (48°C) - Δ12 (56°C) - Δ15 (48°C) - Δ15 (56°C) - Δ6 (48°C) - Δ6 (56°C). </p>
+   </ul>
+</div>
+</div>
-<BR>&nbsp;</BR><BR>&nbsp;</BR>
+<h2>Primers</h2>
-<a name="Primers"><span class="label label-info">Primers</span></a>
+<p>All primers are notated 5' to 3'. Initially, we worked with NdeI and XhoI as the restriction sites.</p>
-<BR>&nbsp;</BR>
-<p>All primers are notated 5' to 3'.
-<BR>&nbsp;</BR>
 <div class="btn-toolbar">
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
     Δ12 T. Cruzi forward
      <span class="caret"></span>
@@ Line 300: / Line 337: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
      Δ12 T. Cruzi reverse
      <span class="caret"></span>
@@ Line 310: / Line 347: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
      Δ12 Synechocystis forward
      <span class="caret"></span>
@@ Line 320: / Line 357: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
      Δ12 Synechocystis reverse
      <span class="caret"></span>
@@ Line 330: / Line 367: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
      Δ15 Synechocystis forward
      <span class="caret"></span>
@@ Line 340: / Line 377: @@
 </div>
-<p>
 <div class="btn-toolbar">
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
      Δ15 Synechocystis reverse
      <span class="caret"></span>
@@ Line 353: / Line 390: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
      Δ6 Synechocystis forward
      <span class="caret"></span>
@@ Line 363: / Line 400: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
      Δ6 Synechocystis reverse
      <span class="caret"></span>
@@ Line 373: / Line 410: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
      ELO6 L. major forward
      <span class="caret"></span>
@@ Line 383: / Line 420: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
      ELO6 L. major reverse
      <span class="caret"></span>
@@ Line 391: / Line 428: @@
    </ul>
 </div>
-</p>
 </div>
-<BR>&nbsp;<?BR>
+<p>When using the pET-duet vector, we needed additional primers for the alternative restriction sites and His-tags. For Δ6 and Δ12, we cut with HindIII and EcoRI; NdeI and XhoI were used for Δ15 and ELO6.</p>
-<p>When using the pET-duet vector, we needed additionally primers for the alternative restriction sites and His-tags.</p>
 <div class="btn-toolbar">
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
      ELO6 L. major forward
      <span class="caret"></span>
@@ Line 410: / Line 444: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
-     Δ15 T. Cruzi forward
+     Δ15 Synechocystis sp. forward
      <span class="caret"></span>
    </a>
@@ Line 420: / Line 454: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
-     Δ6 T. Cruzi forward
+     Δ6 Synechocystis sp. forward
      <span class="caret"></span>
    </a>
@@ Line 430: / Line 464: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
-     Δ6 T. Cruzi reverse
+     Δ6 Synechocystis sp. reverse
      <span class="caret"></span>
    </a>
@@ Line 440: / Line 474: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
-     Δ12 T. Cruzi forward
+     Δ12 Synechocystis sp. forward
      <span class="caret"></span>
    </a>
@@ Line 450: / Line 484: @@
 <div class="btn-group">
-   <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">
+   <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
-     Δ12 T. Cruzi reverse
+     Δ12 Synechocystis sp. reverse
      <span class="caret"></span>
    </a>
@@ Line 458: / Line 492: @@
    </ul>
 </div>
+<p>For the submission vector, we once again required new primers, using restriction sites EcoRI and PstI. For Δ6 and Δ12 forward, we used the primers from the duet vector (see above). </p>
+<div class="btn-group">
+  <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
+    Δ6 Synechocystis reverse
+    <span class="caret"></span>
+  </a>
+  <ul class="dropdown-menu">
+<div class="span5">GTTCCTGCAGTCACGATGCTTTGCCCATGG CTCTAG</div>
+  </ul>
+</div>
+<div class="btn-group">
+  <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
+    Δ15 Synechocystis forward
+    <span class="caret"></span>
+  </a>
+  <ul class="dropdown-menu">
+<div class="span4">GGATCCGAATTCATGCGTCTAGAAATTTCATCG</div>
+  </ul>
 </div>
-<BR>&nbsp;</BR>
-<a name="Sequencing"><span class="label label-info">Sequencing results</span></a>
+<div class="btn-group">
-<BR>&nbsp;</BR>
+  <a class="btn btn-mini dropdown-toggle" data-toggle="dropdown" href="#">
+    Δ15 and Δ12 Synechocystis reverse
+    <span class="caret"></span>
+  </a>
+  <ul class="dropdown-menu">
+<div class="span3">GTTCCTGCAGTTAAACTTTTTTCAGGGAGC</div>
+  </ul>
+</div>
+</div>
+<h2>Analysis</h2>
+<div class="row-fluid">
+<div class="span2">
+<strong>Lipid Analysis</strong>
+<p>Lipids were extracted from transformed <i>E. coli</i> using the Blight/Dyer method. (Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book">Lipid extraction lab book entry</a> for further detail.)</p>
+</div>
-<dl class="dl-horizontal">
+<div class="span4">
-<dt>16/7/12 Δ15</dt>
+<strong>Mass Spectrometry</strong>
-        <dd><p><ul>Δ15 and  Δ6 desaturases from <i>Synechocystis</i> in pET-15b were sent off for sequencing. Once again, the results were discouraging even though protein and lipid analysis showed the opposite. BLAST showed that the gene found in both samples corresponded to a <i>T. brucei</i> HMG-CoA reductase which we thought we had cut out from the plasmid. We thus performed a PCR, using the vectors sent off for sequencing as a template.</ul></p>
+<p>Lipids were extracted from transformed <i>E. coli</i> using the Blight/Dyer method. (Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book">Lipid extraction lab book entry</a> for further detail.)</p>
+<p>The fatty acid content of the transformed cells was measured to determine whether it differed from the previously analyzed background lipid composition. This was done using mass spectrometry.</p>
+</div>
-        <p><ul><a data-toggle="modal" href="#modal7" class="btn btn-primary btn-mini"><font color="white">Sequence</font></a>
+<div class="span2">
-<div class="modal hide" id="modal7">
+<strong>Bradford protein assay</strong>
+<p>A Bradford protein assay was carried out to assess protein concentration (Bradford, 1976).</p>
+</div>
+<div class="span2">
+<strong>Sequencing</strong>
+<p>We sent off samples to GATC for sequencing.<p>
+</div>
+</div>
+</section>
+<section id="results">
+<div class="page-header">
+	<h1>Results</h1>
+</div>
+<p>The fatty acids were released by base hydrolysis followed by organic extraction, the resulting fatty acids were derivatised with diazomethane to the corresponding fatty acid methyl esters (FAMEs), together with fatty acid standards. The samples were analysed by GC-MS and the retention times and fragmentation patterns, compared with FAME standards. The results are shown in Charts 3,4 and 5.<p>
+<p>By combining a number of genes, we were able to partially recreate the pathway described above (Fig. 4).<p>
+<p>Due to time constraints, we were unable to submit a BioBrick containing the sequence of all of the necessary genes for the ω-3 biosynthetic pathway. However, we were able to express and characterise Δ12, Δ15 and Δ6 desaturases, the first three enzymes involved in ω-3 biosynthesis. As shown in charts 2, 3 and 4, the presence of alpha-linoleic acid (18:3<sup>Δ9,12,15</sup>), an omega-3 fatty acid, can be observed in <i>E. coli</i>. This does not occur naturally in their bacterial membrane.</p>
+<h2>Mass Spectrometry</h2>
+<div class="row-fluid">
+<div class="span12 well">
+    <ul class="thumbnails">
+    <li class="span4">
+    <a href="#fame-analysis" data-toggle="modal" class="thumbnail">
+    <img src="https://static.igem.org/mediawiki/2012/4/4e/Fame_analysis.png" alt="">
+    <p><h5>Chart 2: <em>"Fatty acid methyl ester analysis"</em></h5></p>
+    <p>C18:3 refers to an 18 carbon backbone with 3 double bonds. C18:2 and C18:1 would have 2 double bonds and 1 respectively. The upper portion of this figure shows the peaks generated by the standard expected fatty acid methyl esters.The lower 4 panels show mass spec fingerprints that are indicative of our fatty acids of interest.</p>
+    </a>
+    </li>
+<div class="modal large hide" id="fame-analysis">
    <div class="modal-header">
      <button type="button" class="close" data-dismiss="modal">×</button>
-     <h3>Δ15 Syn. in pET-15b</h3>
+     <h3>Chart zoom: <em>Fatty acid methyl ester analysis</em></h3>
    </div>
    <div class="modal-body">
-     <p>atATACCAtggGcAgCAGccaTcnnCATcaTCAtnncAGCagCGGCCTggtgCCGCGCGGCAGCCATATGCTTCgtagga
+     <img src="https://static.igem.org/mediawiki/2012/4/4e/Fame_analysis.png" alt="">
-cTCTCTCatgtgCTtgtGGGACAGGCAAAACGGGttgGGGCGCAAtgaGCAATGCCgagCTTGTTaAAGCcgtAAGCAgt
-cGTCAAttAACCTTTTATGGGTTAGAGCacgCTCTGgagCCCGACTACCAGCGCGCTATCGcTgtGCGTCGtgAGGTGgt
-gtCCGACTAtgtgGCATCCTCCCAAAgTGCggaGGTGAAGAGGAAAAGCTTGGAGCGTATACCATTTGAAAACTACGAAT
-GGGATCGAGTGGTTGGTCAGAACTGTGAAAATATTGTGGGTTACGTTCCTATTCCTCTTGGTATGGCTGGGCCAATAATA
-ATGGATGGCTGTGAATACCCCATTCCCATGGCCACGACAGAAGGTGCCCTggtTGCCAGCACACATCGAGGCGCACGAGC
-TATATCCCAAAGTGGGGGCTGTAAGACACTGATCTTGGGCGAGGGCATGTCACGTGCTCCAGTAGTGGAGGTTGAGTCTT
-TGGAAGAGGCGGGAAggcttCATAATTTTTGTGTagaAAAtttcaCTGAAATCAAAGCAGCTTTCGAGagaCGACGCGAT
-TTGGGAattGCAGTCGCTCAAGTGCGTCATCATCGGTCnnnannCCTATATTCggTTCCGCGCGAccaCCGGagatGCga
-tg
-</p>
    </div>
-  <div class="modal-footer">
+</div>
-    <a href="#" class="btn" data-dismiss="modal">Close</a>
-    </div>
-</div></ul>
-</ul></p></dd>
-<BR>&nbsp;</BR>
-<dt>16/7/12 Δ6</dt>
+    <li class="span4">
-        <dd><p><ul><a data-toggle="modal" href="#modal8" class="btn btn-primary btn-mini"><font color="white">Sequence</font></a>
+    <a href="#lipid-extraction" data-toggle="modal" class="thumbnail">
-<div class="modal hide" id="modal8">
+    <img src="https://static.igem.org/mediawiki/2012/c/c6/Slide2.tiff" alt="">
+    <p><h5>Chart 3: <em>"Lipid extraction analysis"</em></h5></p>
+    <p>All of the cellular lipids were extracted and their fatty acid methyl esters produced. These were analysed by mass spec. In the control cells no C18:2 is present. When Δ6 is expressed, a peak indicative of C18:2 is present. However, the primary fatty acid is still C18:1 - with the bouble bond present at position 9. With the expression of Δ12 and the addition of exogenous C18:1(Δ9) we get great abundance of C18:2 and negligible abundance of C18:1 indicating that the C18:1 is being processed successfully. The lowest graph shows that Δ12 expressed with Δ15 acts in a complementary fashion and the expected C18:3 - an Omega 3 - is produced. </p>
+    </a>
+    </li>
+<div class="modal large hide" id="lipid-extraction">
    <div class="modal-header">
      <button type="button" class="close" data-dismiss="modal">×</button>
-     <h3>Δ6 Syn. in pET-15b</h3>
+     <h3>Chart zoom: <em>Fatty acid methyl ester analysis</em></h3>
    </div>
    <div class="modal-body">
-     <p>AnTTCCCCcTctaGaaTaTTTTTGTTtACTTtAAGaAGGAGATATACCATGGGCAGCAGCCATcncTcAtcaTCATCACA
+     <img src="https://static.igem.org/mediawiki/2012/c/c6/Slide2.tiff" alt="">
-GCAGCGGCCTGGTGCCGCGCGGCAGCCATATGCTTCGTAGGACTCTCTCATgtGCTTGTGGGACAGGCAAAACGGGTTGG
-GGCGCAATGAGCAATGCCGaGCTtgTTAAAGCCGTAAGCAGTCGTCAATTAACCTTTTATGGGTTAGAGCAGGCTCTGGA
-GCCCGACTACCAGCGCGCTATCGCTGTGCGTCGTGAGGTGGTGTCCGACTATGTGGCATCCTCCCAAAGTGCGGAGGTGA
-AGAGGAAAAGCTTGGAGCGTATACCATTTGAAAACTACGAATGGGATCGAGTGGTTGGTCAGAACTGTGAAAATATTGTG
-GGTTACGTTCCTATTCCTCTTGGTATGGCTGGGCCAATAATAATGGATGGCTGTGAATACCCCATTCCCATGGCCACGAC
-AGAAGGTGCCCTGGTTGCCAGCACACATCGAGGCGCACGAGCTATATCCCAAAGTGGGGGCTGTAAGACACTGATCTTGG
-GCGAGGGCATGTCACGTGCTCCAGTAGTGGAGGTTGAGTCTTTGGAAGAGGCGGGAAGGCTTCATAATTTTTGTGTAGAA
-AATTTCACTGAAATCAAAGCAGCTTTCGAGAGCACGACGCGATTTGGGAAGTTGCAGTCGCTCAAGTGCGTCATCATCGG
-TCGCAnAGCCTATATTCGGTTCCGCGCGACCACCGGAGATGCGATGGGGATGAACATGATAACCAAAGGTGTCGACAAGG
-CATTGGAGTTAAtanAGCAnAACTTTCCGTCGATGAAGGTTATTGCGTTGTCGGGGAACTACTGCACTGanaagAAACcC
-TCCGCAGTGAACTGGATTGaggggaaGAGGAAnAAaCTGTcnnttgCCgaagGCGCTcgtaaaggggCgaAGt
-</p>
    </div>
-  <div class="modal-footer">
+</div>
-    <a href="#" class="btn" data-dismiss="modal">Close</a>
-    </div>
-</div></ul>
-</ul></p></dd>
-<BR>&nbsp;</BR>
-<dt>29/6/12 ELO6</dt>
-        <dd><p><ul>After showing successful insertion of <i>L. major</i> Δ6 elongase in pET-15b, the sample was sent off for sequencing. Unfortunately, the gene sequenced was not the Δ6 elongase we were hoping to find, but a <i>T. brucei</i> mevalonate kinase, which was previously inserted in the pET-15b vectors we had been using. Thus, we digested some fresh pET-15b to be used in the future.</ul></p>
-        <p><ul><a data-toggle="modal" href="#modal6" class="btn btn-primary btn-mini"><font color="white">Sequence</font></a>
+    <li class="span4">
-<div class="modal hide" id="modal6">
+    <a href="#membrane-assay" data-toggle="modal" class="thumbnail">
+    <img src="https://static.igem.org/mediawiki/2012/4/40/Membrane_assay.jpg" alt="">
+    <p><h5>Chart 4: <em>"Membrane assay"</em></h5></p>
+    <p>The cellular membranes were extracted and their lipids were analysed by mass spec. As in chart 2 it is confirmed that expression of Δ12 and Δ15 lead to the production of omega 3 fatty acids. This chart shows that these lipids locate to the plasma membrane of the bacteria</p>
+    </a>
+    </li>
+<div class="modal large hide" id="membrane-assay">
    <div class="modal-header">
      <button type="button" class="close" data-dismiss="modal">×</button>
-     <h3>ELO6 in pET-15b</h3>
+     <h3>Chart zoom: <em>Fatty acid methyl ester analysis</em></h3>
    </div>
    <div class="modal-body">
-     <p>GnanTTTGTTtAcTttaagaaggagaTATACCATGGGcAGCAGCCATcatCATcatcaTCACAGCAGCGGCCTggtGCCG
+     <img src="https://static.igem.org/mediawiki/2012/4/40/Membrane_assay.jpg" alt="">
-CGCGGCagCCATATGGTCGTGGCATCGtgTCCGGGAAAAGTGCTGATTCTTGGTGGTTAcCTAATAGttGAGGAGCCAAA
-TGTTGGTATTTCCGTAGGAACAACCGCGCGCTTCGTGACACGTGTGGCGTCgtgGAAAAAATGCTCTGATGGAAAGTGTC
-GAGTGCACATCGTCTCGTCACAGTTCAACAAggaGTTTACGTTTGAATGCGCGGCTGAAGAGGACAGTGATTCCACTATC
-AAGATTGTGCAATTAGAGGGTGCACCATCGCCGTTTCTCTTCTACGGTATTTTGTACTCGGTTGCCGGCGCTCTATTATT
-TGGTGGTGATATTTTTCGTGATGTTACCCTAGAGTTGTTGGCGGATAACGATTTCTACAGCCAAAGGAATTATTTGGAGT
-CCCAAGGCAAGCCGGTGACCGCAGCCAACCTGCGGCTCATCCCCCGTTATACGCCCCTCTTGGGGGAGGTTTCCAAAACT
-GGTCTAGGATCTTCAGCGGCAATGACCACTAGTGTCGTAGCGTGCCTGCTCCAACTTTTTGTTTTTGATTCGAAGAAAAA
-CAATGCCACTGAGTCCGTGGAGAGGGCACCGGAGCTACCTCTACGTTTGGAGGATGTAACAGAGTTCATTCATCGTATTA
-GTCAGGTTGCCCACTGCGTAGCACAGGGAAAAGTGgGGAGCGGGTTTGATGTCTACACGGCCACGTTCGGGACGTGTGTG
-TACCGACGGTTCTCCGCACGCGTGCTGGAnAAGCTCGTAAAGGgtAATGAACCTCCGAAGCGCGTCGCTATTCCTCTTTT
-ACGTGAGTGTGTCGAGACGGATGAAGTGTGgGTTCAGAGGATACcCTtccGGCTTCCTACCGGGTTGCAGCTTCTTTTAG
-GGGATGTACACAAGGGAGgAacaGAAAcACCTGGCATGGTGTcgaAGGTCATGTCatgnnagnggTCGGTGACCacGGAC
-CCcAACAGnttgnggnnnngantTcCCATgnntAAT
-</p>
    </div>
-  <div class="modal-footer">
+</div>
-     <a href="#" class="btn" data-dismiss="modal">Close</a>
+     </ul>
-    </div>
+</div>
-</div></ul>
+</div>
-</ul></p></dd>
-<BR>&nbsp;</BR>
-        <dt>23/7/12 Δ12</dt>
-        <dd><p><ul>15b forward gave 0 nucleotides</ul></p>
-            <p><ul>15b reverse gave 0 nucleotides</ul></p>
-            <p><ul>20b forward gave a 41 nucleotide result.</ul></p>
-            <ul><div class="btn-group">
+<h2>Bradford protein assay</h2>
-            <a class="btn dropdown-toggle" data-toggle="dropdown" href="#">Sequence<span class="caret"></span>
-            </a>
-               <ul class="dropdown-menu">
-                   <div class="span3"><font size="1">gCGnCctGntGCCgCGCGGCnnnnnnnnnnnnnnnnnngac</font></div>
-               </ul>
-            </div></ul>
-            <p><ul>A BLAST search showed this to be compatible with <i>Crocosphaera watsonii</i> (genome shotgun sequence, 21%), a diazotrophic cyanobacteria.</ul></p>
-            <p><ul>20b reverse gave 0 nucleotides</ul></p>
+<div class="row-fluid">
-            </dd>
+<div class="span6 well">
-      </dl>
+    <ul class="thumbnails">
+    <img src="https://static.igem.org/mediawiki/2012/b/bd/Bradford_samples.png" alt="">
+<p><h5>Chart 5: <em>"Bradford protein assay"</em></h5></p>
+<p>This chart shows the standard results of a Bradford protein assay.  Measuring the absorbance at 595nm for set samples, a standard curve was calculated with the equation of y = 0.0006x + 0.0426.</p>
+   </ul>
 </div>
-<BR>&nbsp;</BR>
-<BR>&nbsp;</BR>
-<a name="Lipid"><span class="label label-info">Lipid analysis</span></a>
+<div class="span4 well">
+<ul class="thumbnails">
+    <img src="https://static.igem.org/mediawiki/2012/1/18/Protein_conc._table.png" alt="">
+<p><h5>Table 1: <em>"Bradford protein assay"</em></h5></p>
+<p>Using the standard curve shown in chart 5, the protein concentrations of a number of transformed plasmids was calculated.</p>
+   </ul>
-<BR>&nbsp;</BR>
+</div>
+</div>
-<p>Lipids were extracted from transformed <i>E. coli</i> using the Blight/Dyer method. (Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book"><strong>Lipid extraction lab book entry</strong></a> for further detail.)</p>
-<p>We then analyzed the the fatty acid content of the transformed cells to determine whether it differed from the previously analyzed background lipid composition. This was done using mass spectrometry.</p>
+</section>
-<a name="massspec"><span class="label label-info">Mass Spectrometry</span></a>
 <section id="biobricks">
-	<br>
+<div class="page-header">
-<h2>Biobricks</h2>
+<h1>Biobricks</h1>
+</div>
+<p>We have submitted 3 BioBricks involved in the ω-3 biosynthetic pathway to the Registry of Standard Parts:</p>
+<table class="table table-striped">
+    <thead>
+        <tr>
+            <th>Biobrick</th>
+            <th>Short name</th>
+            <th>Description</th>
+            <th>Length</th>
+        </tr>
+    </thead>
+    <tbody>
+        <tr>
+            <td><a href="http://partsregistry.org/Part:BBa_K925000">BBa_K925000</a></td>
+            <td>Delta-12 desaturase</td>
+            <td>Desaturase introducing a double bond at the Δ-12 site in the hydrocarbon chain of oleic acid (18:1, Δ9) to give linoleic acid (18:2 Δ9,12)</td>
+            <td>1056</td>
+        </tr>
+        <tr>
+            <td><a href="http://partsregistry.org/Part:BBa_K925001">BBa_K925001</a></td>
+            <td>Delta-15 desaturase</td>
+            <td>Desaturase introducing a double bond at the Δ-15 site in the hydrocarbon chain of linoleic acid (18:2 ; Δ9,12) for its convertion into alpha-linoleic acid (18:3 ; Δ9,12,15), an ω -3 PUFA</td>
+            <td>1080</td>
+        </tr>
+        <tr>
+            <td><a href="http://partsregistry.org/Part:BBa_K925003">BBa_K925003</a></td>
+            <td>Delta-6 desaturase</td>
+            <td>Desaturase introducing a double bond at the Δ-12 site in the hydrocarbon chain of oleic acid (18:1, Δ9) to give linoleic acid (18:2 Δ9,12)</td>
+            <td>1080</td>
+        </tr>
+    </tbody>
+</table>
 </section>
 <section id="references">
-	<br>
+<div class="page-header">
-<b><u>References</u></b>
+<h1>References</h1>
+</div>
+<p>Arts, <i>et al.</i>, 2009. Lipids in Aquatic Ecosystems. New York. Springer.</p>
-<p>ARTS, <i>et al</i>, 2009. Lipids in Aquatic Ecosystems. New York. Springer.</p>
+<p>Bender D. A. and Bender, A. E, 1999. Benders' dictionary of nutrition and food technology. Cambridge: CRC Press.</p>
-<p>BENDER D. A. and BENDER, A. E, 1999. Benders' dictionary of nutrition and food technology. Cambridge: CRC Press.</p>
+<p>Bradford, M., 1976. <a href="http://www.ncbi.nlm.nih.gov/pubmed/942051">A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.</a> Anal Biochem, 7;72:248-54.</p>
-<p>COHEN, J., 2003. Human Population: The Next Half Century. Science, New Series, Vol. 302, No. 5648. Pp. 1172-1175.</p>
+<p>Cohen, J., 2003. <a href="http://www.sciencemag.org/content/302/5648/1172.abstract">Human Population: The Next Half Century.</a> Science, New Series, Vol. 302, No. 5648. Pp. 1172-1175.</p>
-<p>GARWIN J. L. and CRONAN J. E. Jr, 1980. Thermal modulation of fatty acid synthesis in <i>Escherichia coli</i> does not involve de novo enzyme synthesis. J Bacteriol, 141(3): 1457–1459.</p>
+<p>Garwin J. L. and Cronan J. E. Jr, 1980. <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC293857/">Thermal modulation of fatty acid synthesis in <i>Escherichia coli</i> does not involve de novo enzyme synthesis.</a> J Bacteriol, 141(3): 1457–1459.</p>
-<p>LIVORE V., TRIPODI K., UTARRO A., 2007. Elongation of polyunsaturated fatty acids in trypanosomatids. FEBS Journal, 274: 264–274.</p>
+<p>Livore V., Tripodi K., Utarro A., 2007. <a href="http://www.ncbi.nlm.nih.gov/pubmed/17222186">Elongation of polyunsaturated fatty acids in trypanosomatids.</a> FEBS Journal, 274: 264–274.</p>
-<p>MARR A., INGRAHAM J., 1969.  Effect of temperature on the composition of fatty acids in <i>Escherichia coli</i>. J. Bactiol. 84(6). Pp.  1260–1267.</p>
+<p>Marr A., Ingraham J., 1969.  <a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC278056/">Effect of temperature on the composition of fatty acids in <i>Escherichia coli</i>.</a> J. Bactiol. 84(6). Pp.  1260–1267.</p>
-<p>TONON T., <i>et al</i>, 2002. Long chain polyunsaturated fatty acid production and partitioning to triacylglycerols in four microalgae. Phytochemistry, Vol 61 Iss 1. Pgs 15-24.</p>
+<p>Tonon T., <i>et al.</i>, 2002. <a href="http://www.sciencedirect.com/science/article/pii/S0031942202002017">Long chain polyunsaturated fatty acid production and partitioning to triacylglycerols in four microalgae.</a> Phytochemistry, Vol 61 Iss 1. Pgs 15-24.</p>
 </section>

Team:St Andrews/Omega-3-synthesis

From 2012.igem.org

Latest revision as of 23:15, 26 September 2012

Introduction

Project description

Figure 1: "Synechocystis sp."

Figure 2: "Trypanosome cruzi"

Figure 3: "Leishmania major"

Recreating the pathway

Figure 4: "The metabolic pathway to ω-3 fatty acids"

Methods

Δ6 Synechocystis

Δ12 Synechocystis

Δ15 Synechocystis

ELO 6 L. major

Δ12 T. Cruzi

Fig. 5: "UV photograph of PCR results"

Primers

Analysis

Results

Mass Spectrometry

Chart 2: "Fatty acid methyl ester analysis"

Chart zoom: Fatty acid methyl ester analysis

Chart 3: "Lipid extraction analysis"

Chart zoom: Fatty acid methyl ester analysis

Chart 4: "Membrane assay"

Chart zoom: Fatty acid methyl ester analysis

Bradford protein assay

Chart 5: "Bradford protein assay"

Table 1: "Bradford protein assay"

Biobricks

References