|
|
(218 intermediate revisions not shown) |
Line 1: |
Line 1: |
| <!-- Include the next line at the beginning of every page --> | | <!-- Include the next line at the beginning of every page --> |
| {{:Team:LMU-Munich/Templates/Page Header|File:Team-LMU_culture_tubes.resized.jpg|3}} | | {{:Team:LMU-Munich/Templates/Page Header|File:Team-LMU_culture_tubes.resized.jpg|3}} |
- | [[Image:BacillusBioBrickBox.png|100px|right]] | + | [[File:Bacillus BioBrick Box banner.resized WORDS.JPG|620px|link=]] |
| | | |
| | | |
| + | [[Image:BacillusBioBrickBox.png|100px|right|link=]] |
| | | |
| | | |
| | | |
| + | =='''B<sup>4</sup>''' - 22 core parts for ''Bacillus subtilis''== |
| + | <br> |
| + | <p align="justify">A major goal of our iGEM project is to [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction introduce ''B. subtilis''] as a new chassis for BioBrick-based synthetic biology. For that purpose, we created a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry to make it accessible to many more future iGEM-teams and the entire public microbiology domain! This ''<b>Bacillus'' B</b>io<b>B</b>rick <b>B</b>ox ('''B<sup>4</sup>''') contains the following ''Bacillus'' specific parts:</p> |
| | | |
- | ==''Bacillus'' BioBricks==
| |
| | | |
| + | <div class="box"> |
| + | {| width="100%" |
| | | |
- | We will create a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry.
| + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Vectors|Vectors]]''' |
- | | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Promoters|Promoters]]''' |
- | This ''<b>Bacillus''B</b>io<b>B</b>rick<b>B</b>ox contains ''Bacillus'' specific:
| + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Reporters|Reporters]]''' |
- | | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Tags|Affinity tags]] |
- | | + | |
- | | + | |
- | {| style="background-color:white" cellpadding="0" width="100%" cellspacing="0" border="0" align="center" style="text-align:center;"
| + | |
- | | + | |
- | | style="width:20%"| | + | |
- | '''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]''' | + | |
- | | style="width:20%"| | + | |
- | '''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Promoters|Promoters]]''' | + | |
- | | style="width:20%"| | + | |
- | '''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Reporters|Reporters]]''' | + | |
- | | style="width:20%"| | + | |
- | '''[[Team:LMU-Munich/Bacillus_BioBricks#Affinity_Tags|Affinity tags]] | + | |
| |- | | |- |
| |[[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]] | | |[[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]] |
Line 32: |
Line 25: |
| |[[File:LMU Reporter.png|60px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Reporters]] | | |[[File:LMU Reporter.png|60px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Reporters]] |
| |[[File:Proteinaffinitytagbutton.png|50px|link=Team:LMU-Munich/Bacillus_BioBricks#Affinity_Tags]] | | |[[File:Proteinaffinitytagbutton.png|50px|link=Team:LMU-Munich/Bacillus_BioBricks#Affinity_Tags]] |
| + | |- |
| + | |valign="top"|<font size="2"> |
| + | pSB<sub>''Bs''</sub>1C<br> |
| + | pSB<sub>''Bs''</sub>4S<br> |
| + | pSB<sub>''Bs''</sub>2E<br> |
| + | pSB<sub>''Bs''</sub>1C-''lac''Z<br> |
| + | pSB<sub>''Bs''</sub>3C-''lux''ABCDE<br> |
| + | pSB<sub>''Bs''</sub>4S-P<sub>''xyl''</sub><br> |
| + | pSB<sub>''Bs''</sub>0K-P<sub>''spac''</sub><br> |
| + | '''Sporo'''vector</font> |
| + | |valign="top"|<font size="2"> |
| + | Anderson<br> |
| + | P<sub>''liaG''</sub><br> |
| + | P<sub>''veg''</sub><br> |
| + | P<sub>''lepA''</sub><br> |
| + | P<sub>''liaI''</sub><br> |
| + | ''xylR''-P<sub>''xyl''</sub></font> |
| + | |valign="top"|<font size="2"> |
| + | ''gfp''<br> |
| + | ''mkate2''<br> |
| + | ''lacZ''<br> |
| + | ''luc+''<br></font> |
| + | |valign="top"|<font size="2"> |
| + | Flag<br>His<br>cMyc<br>Strep<br>HA</font> |
| + | |- |
| |} | | |} |
| + | </div> |
| | | |
| | | |
| | | |
- | ==''Bacillus'' Vectors [[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]==
| + | [[File:NEXT.png|right|80px|link=Team:LMU-Munich/Germination_Stop]] [[File:BACK.png|left|80px|link=Team:LMU-Munich/Data/differentiation_tour]] |
| + | |
| | | |
| | | |
- | <p align="justify">Here is a list of all the vectors we cloned and used. Please note that pMAD is not in a BioBrick standard, but it is a useful tool to knock out genes in ''Bacillus subtilis''.</p>
| |
| | | |
- | <p align="justify">For the use of our vectors, please see our [[Team:LMU-Munich/Lab_Notebook/Protocols|Protocols]] page. A general introduction to ''Bacillus subtilis'' and its integrative vectors can be found [[Team:LMU-Munich/Bacillus Introduction|here]]. All vectors have ampicillin as <i>E. coli</i> resistance and RFP as selection marker.</p>
| |
| | | |
| | | |
- | {| class="colored"
| |
- | |-
| |
- | !Name BioBrick
| |
- | !''E. coli'' res.
| |
- | !''B. subt.'' res.
| |
- | !Insertion locus
| |
- | !Description
| |
- | !Derived from
| |
- | !Reference
| |
- | |-
| |
- | !pSB<sub>Bs</sub>1C-<i>lacZ</i> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823021 <font color="#EBFCE4" size="2">(BBa_K823021) </font>]
| |
- | |Amp
| |
- | |Cam
| |
- | |amyE
| |
- | |with <i>lacZ</i> reporter gene
| |
- | |pAC6
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/11902727 Stülke ''et al''.]
| |
- | |-
| |
- | !pSB<sub>Bs</sub>4S [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823022 <font color="#EBFCE4" size="2">(BBa_K823022)</font>]
| |
- | |Amp
| |
- | |Spec
| |
- | |thrC
| |
- | |empty
| |
- | |pDG1731
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury ''et al.'']
| |
- | |-
| |
- | !pSB<sub>Bs</sub>1C [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823023 <font color="#EBFCE4" size="2">(BBa_K823023)</font>]
| |
- | |Amp
| |
- | |Cam
| |
- | |amyE
| |
- | |empty
| |
- | |pDG1662
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury ''et al.'']
| |
- | |-
| |
- | !pSB<sub>Bs</sub>4S-P<sub><i>Xyl</i></sub> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823024 <font color="#EBFCE4" size="2">(BBa_K823024)</font>]
| |
- | |Amp
| |
- | |Spec
| |
- | |thrC
| |
- | |with Xylose-inducible promoter
| |
- | |pXT
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/11069659 Derré ''et al.'']
| |
- | |-
| |
- | !pSB<sub>Bs</sub>3C-<i>luxABCDE</i> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823025 <font color="#EBFCE4" size="2">(BBa_K823025)</font>]
| |
- | |Amp
| |
- | |Cam
| |
- | |sacA
| |
- | |with <i>luxABCDE</i> reporter cassette
| |
- | |pAH328
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/20709900 Schmalisch ''et al''.]
| |
- | |-
| |
- | !pSB<sub>Bs</sub>0K-P<sub><i>spac</i></sub> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823026 <font color="#EBFCE4" size="2">(BBa_K823026)</font>]
| |
- | |Amp
| |
- | |Kan
| |
- | |replicative
| |
- | |with IPTG inducible promoter
| |
- | |pDG148
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/11728721 Joseph ''et al.'']
| |
- | |-
| |
- | !pSB<sub>Bs</sub>2E [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823027 <font color="#EBFCE4" size="2">(BBa_K823027)</font>]
| |
- | |Amp
| |
- | |MLS
| |
- | |lacA
| |
- | |empty
| |
- | |pAX01
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/11274134 Härtl ''et al.'']
| |
- | |-
| |
- | |}
| |
| | | |
| | | |
- | <p align="justify">The number in the vector's name codes for the insertion locus and the following letter for the <i> Bacillus subtilis </i> resistance gene according to the following table:</p>
| |
| | | |
| + | <p align="justify">Since ''Bacillus subtilis'' is not an organism commonly used in iGEM, please check out our [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction Introduction] to learn more about it.</p> |
| | | |
- | {| class="colored"
| + | <div class="box"> |
- | |- | + | ==''Bacillus'' Vectors [[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]== |
- | !Number
| + | {| "width=100%" style="text-align:center;" style="align:right"| |
- | !Insertion locus
| + | |<p align="justify">We have generated a suite of BioBrick-compatible vectors: three empty insertional backbones with different antibiotic resistances and integration loci, two reporter and two expression vectors.</p> |
- | !Letter
| + | |[[File:LMU-Munich-PSBBs1C.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Vectors]] |
- | !Resistance
| + | |
| |- | | |- |
- | !0 | + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Vectors]] |
- | |replicative | + | |} |
- | !C
| + | </div> |
- | |Chloramphenicol | + | |
- | |- | + | <div class="box"> |
- | !1
| + | ==''Bacillus'' Promoters [[File:LMU PromoterIconBC.png|100px]]== |
- | |amyE (amylase) | + | {| "width=100%" style="align:right"| |
- | !E
| + | |
- | |MLS (Erythromycin + Lincomycin)
| + | |
- | |-
| + | |
- | !2
| + | |
- | |lacA (laccase) | + | |
- | !K
| + | |
- | |Kanamycin | + | |
- | |-
| + | |
- | !3
| + | |
- | |sacA (sucrase)
| + | |
- | !S
| + | |
- | |Spectinomycin
| + | |
- | |-
| + | |
- | !4
| + | |
- | |thrC (threonine C) | + | |
| | | | | |
| + | <p align="justify">To provide a set of promoters of different strength we characterized several promoters in ''Bacillus subtilis''. Both constitutive and inducible promoters are covered.</p> |
| | | | | |
| + | [[File:Promoters overview.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Promoters]] |
| |- | | |- |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Promoters]] |
| + | |} |
| + | </div> |
| | | |
| + | <div class="box"> |
| + | ==''Bacillus'' Reporters [[File:LMU Reporter.png|50px]]== |
| + | {| "width=100%" style="align:right"| |
| + | | |
| + | <p align="justify">We designed and codon-optimized a set of reporters that are commonly used in ''B. subtilis''.</p> |
| + | | |
| + | [[File:LMU GFP.jpg|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Reporters]] |
| |- | | |- |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Reporters]] |
| |} | | |} |
| + | </div> |
| | | |
- | | + | <div class="box"> |
- | The concentrations of the antibiotics and the insertion tests can be found in our [https://2012.igem.org/Team:LMU-Munich/Lab_Notebook/Protocols Protocol] section.
| + | ==Affinity Tags [[File:Proteinaffinitytagbutton.png|50px]]== |
- | | + | {| "width=100%" style="align:right"| |
- | The promoters we submit are:
| + | | |
- | | + | <p align="justify">We synthesized 5 affinity tags for protein purification. They all are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags.</p> |
- | Pveg, PliaI, PliaG, plepA, Pxyl, Pxyl+XylR
| + | |
- | | + | |
- | <p align="justify">We also tested the [http://partsregistry.org/Promoters/Catalog/Anderson Anderson promoter collection] in ''Bacillus subtilis'' with pSB<sub>Bs</sub>3C-<i>luxABCDE</i>. The data will be online in our [https://2012.igem.org/Team:LMU-Munich/Data Data] section soon.</p> | + | |
- | | + | |
- | <p align="justify">Furthermore we plan to submit reporter genes optimized for ''Bacillus subtilis'', namely ''GFP'', ''lacZ'', ''luc'' and ''mKate2''. </p>
| + | |
- | | + | |
- | Useful for the registry are also 5 tags in Freiburg Standard (cMyc, 10His, Flag, Strep, HA).
| + | |
- | | + | |
- | More details to come soon.
| + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | ==''Bacillus'' Promoters [[File:LMU PromoterIconBC.png|100px]]== | + | |
- | | + | |
- | <p align="justify">To get a set of promoters with different strength we characterized several promoters in ''B. subtilis''. They can be divided in three different groups: the constitutive promoters from the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] from the Partsregistry, the constitutive promoters P<sub>''liaG''</sub>, P<sub>''veg''</sub> and P<sub>''lepA''</sub> from ''B. subtilis'', and the inducible promoters P<sub>''liaI''</sub> and P<sub>''xyl''</sub>-''XylR'' from ''B. subtilis''. For the characterization of the different promoters we used the two reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' as well as the reporters ''lacZ'', ''luc'' and ''mKate2'' in BioBrick standard.</p>
| + | |
- | | + | |
- | | + | |
- | ====Anderson promoters====
| + | |
- | | + | |
- | <p align="justify">The first group of promoters evaluated are the promoters of the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] which we call ''Anderson promoters''. They have already been measured in ''Escherichia coli'' where they all showed a constitutive behavior with a different strength. In this project, eleven Anderson promoters were characterized in ''B. subtilis''. Therefore we used the reporter vector pSB<sub>Bs</sub>3C-<i>luxABCDE</i> from the BioBrickBox were they showed quiet a low activity in ''B. subtilis'' (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). To confirm this result some Anderson promoters were also evaluated in the reporter vector pSB<sub>Bs</sub>1C-''lacZ''(see [https://2012.igem.org/Team:LMU-Munich/Data Data]).</p>
| + | |
- | | + | |
- | | + | |
- | *'''J23100''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823004 BioBrick:BBa_K823004])
| + | |
- | *'''J23101''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823005 BioBrick:BBa_K823005])
| + | |
- | *'''J23102''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823006 BioBrick:BBa_K823006])
| + | |
- | *'''J23103''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823007 BioBrick:BBa_K823007])
| + | |
- | *'''J23106''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823008 BioBrick:BBa_K823008])
| + | |
- | *'''J23107''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823009 BioBrick:BBa_K823009])
| + | |
- | *'''J23113''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823010 BioBrick:BBa_K823010])
| + | |
- | *'''J23114''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823011 BioBrick:BBa_K823011])
| + | |
- | *'''J23115''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823012 BioBrick:BBa_K823012])
| + | |
- | *'''J23117''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823013 BioBrick:BBa_K823013])
| + | |
- | *'''J23118''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823014 BioBrick:BBa_K823014])
| + | |
- | <p align="justify"></p>
| + | |
- | | + | |
- | | + | |
- | ====Constitutive promoters from ''B. subtilis''====
| + | |
- | | + | |
- | <p align="justify">The second group of promoters charaterized are constitutive promoters from ''B. subtilis''. We evaluated the promoters P<sub>''liaG''</sub>, P<sub>''veg''</sub> and P<sub>''lepA''</sub>. Therefore we used the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' as well as the BioBrick reporters ''lacZ'', ''luc'' and ''mKate2''.</p>
| + | |
- | | + | |
- | | + | |
- | *'''P<sub>''liaG''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823000 BioBrick:BBa_K823000])
| + | |
- | <p align="justify">P<sub>''liaG''</sub> is a weak, constitutive promoter from B. subtilis. It is responsible for the transcription of the last four genes of the liaIHGFSR locus and therefore for the production of the components of the LiaRS system, which is important for the detection of cell wall antibiotics [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan ''et al.'', 2006)]. P<sub>''liaG''</sub> was evaluated with the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' as well as the reporter BioBrick ''lacZ''. This promoter showed a much higher activity than the Anderson promoters which was still weak in comparison to the other evaluated ''Bacillus'' promoters (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). </p>
| + | |
- | | + | |
- | | + | |
- | *'''P<sub>''veg''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823003 BioBrick:BBa_K823003])
| + | |
- | <p align="justify">P<sub>''veg''</sub> is known to show a strong constitutive activity during the vegetative growth phase and sporulation phase. This promoter is important for the transcription of the veg gene, which plays an important role during sporulation [http://www.ncbi.nlm.nih.gov/pubmed?term=J.%20Biochem.%2C%20133%20%284%29%3A%20475%E2%80%93483: (Fukushima ''et al.'', 2003)]. P<sub>''veg''</sub> was measured by using the reporter vector pSB<sub>Bs</sub>1C-''lacZ'' as well as the reporter BioBrick ''lacZ''. This promoter was the strongest of our evaluated promoters (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). </p> | + | |
- |
| + | |
- | | + | |
- | *'''P<sub>''lepA''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823002 BioBrick:BBa_K823002])
| + | |
- | <p align="justify"> P<sub>''lepA''</sub> is constitutive promoter which is important for the transcription of a bicistronic operon. One of the expressed proteins is the protein PlepA [http://www.ncbi.nlm.nih.gov/pubmed?term=Microbiology%2C%20142%3A%201641%E2%80%931649: (Homuth ''et al.'', 1996)]. This protein plays an important role during the translation as it can move the mRNA-tRNA complex one step back in the ribosome which is expected to improve the fidelity of translation [http://www.ncbi.nlm.nih.gov/pubmed?term=Cell%2C%20127%20%284%29%3A%20721%E2%80%93733: (Qin ''et al.'', 2006)]. This promoter was evaluated with the reporter vector pSB<sub>Bs</sub>3C-<i>luxABCDE</i> as well as the reporter BioBricks ''luc'' and ''mKate2''. The activity of this promoter is between the activity of the strongest promoter P<sub>''veg''</sub> and the weak ''Bacillus'' promoter P<sub>''liaG''</sub> (see [https://2012.igem.org/Team:LMU-Munich/Data Data]). </p>
| + | |
- | | + | |
- | | + | |
- | ====Inducible promoters from ''B. subtilis''====
| + | |
- | | + | |
- | <p align="justify">The last group of promoters consists of two inducible promoters of ''B. subtilis'' , P''<sub>liaI</sub>'' and P''<sub>xyl</sub>''-''XylR''. They are useful to decide when to turn on gene expression because these promoters need an inducer to start transcription. They are evaluated with the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' and the BioBrick reporters ''lacZ'', ''luc'' and ''mKate2''.</p>
| + | |
- | | + | |
- | | + | |
- | *'''P<sub>''liaI''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823001 BioBrick:BBa_K823001])
| + | |
- | <p align="justify">P''<sub>liaI</sub>'' is an inducible promoter from ''B. subtilis'' which is induced by antibiotics that interact with the lipidII cycle, e.g. bacitracin. If the cell senses stress there is a phosphorylation of the two proteins LiaS and LiaR. LiaR binds to the operator of the promoter and induces the transcription. When the promoter is turned on the two proteins LiaI and LiaH are expressed which play an important role in the stress response [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan ''et al.'', 2006)]. This promoter is evaluated with the reporter vectors pSB<sub>Bs</sub>3C-<i>luxABCDE</i> and pSB<sub>Bs</sub>1C-''lacZ'' as well as the reporter genes ''lacZ'', ''luc'' and ''mKate2''. The induction was measured with different concentrations of bacitracin (see [https://2012.igem.org/Team:LMU-Munich/Data Data]).</p>
| + | |
- | | + | |
- | | + | |
- | *'''P<sub>''Xyl''</sub>-''XylR''''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K8230015 BioBrick:BBa_K823015])
| + | |
- | <p align="justify">P<sub>''Xyl''</sub>-''XylR'' is a inducible promoter from ''B. subtilis'' which is induced by xylose. XylR is constitutively expressed, and is the repressor of P<sub>''Xyl''</sub> in absence of the sugar Xylose. In presence of Xylose, XylR leaves the operator and the P<sub>''Xyl''</sub> is active [see e.g. [http://www.ncbi.nlm.nih.gov/pubmed/2544559 Kreuzer et al.]. This promoter was evaluated with the BioBrick reporter lacZ (see [https://2012.igem.org/Team:LMU-Munich/Data Data]).</p>
| + | |
- | | + | |
- | | + | |
- | ==''Bacillus'' Reporters [[File:LMU Reporter.png|50px]]==
| + | |
- | | + | |
- | <p align="justify">We designed some reporters that are commonly used in ''B. subtilis'' or are codon optimized versions of popular reporter genes. All reporters have a modified iGEM Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RCF 25]) pre- and suffix for assembly of in-frame fusion proteins. Our prefix also includes the ''B. subitlis'' optimized RBS.</p>
| + | |
- | | + | |
- | prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
| + | |
- | | + | |
- | suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
| + | |
- | | + | |
- | | + | |
- | *'''GFP''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823039 BioBrick:BBa_K823039])
| + | |
- | <p align="justify">We took a ''gfp'' derivate of the ''Bacillus subtilis'' plasmids pGFPamy and added the BioBrick compatiple pre- and suffix of the Freiburg standard (Assembly 25).</p>
| + | |
- | | + | |
- | | + | |
- | | + | |
- | *'''mKate''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029])
| + | |
- | <p align="justify">We synthesized this ''rfp'' derivate with a codon-optimized version for the use in ''B. subtilis'' with pre- and suffix of the Freiburg standard</p>
| + | |
- | | + | |
- | | + | |
- | | + | |
- | *'''LacZ''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823019 BioBrick:BBa_K823019])
| + | |
- | [[File:LacZ plate.png|''lacZ'' under the control of Pspac in pSBC3. Plate induced with Xylose (ng/µl)|thumb|300px|left]]
| + | |
- | | + | |
- | <p align="justify">This lacZ gene is derived from the ''Bacillus'' reporter vector pAC6. It is constructed in the Freiburg Standard (Assembly 25) for in-frame fusion proteins. It also includes a Shine-Dalgarno Sequence optimized for ''Bacillus subtilis'' translation.</p>
| + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | *'''luc''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823028 BioBrick:BBa_K823028])
| + | |
- | | + | |
- | <p align="justify">We synthesized this luciferase for luminescence assays with luciferin as substrate.</p>
| + | |
- | [[File:Luciferin reaction mod.png|thumb|center|400px]]
| + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | ==Affinity Tags [[File:Proteinaffinitytagbutton.png|50px]]==
| + | |
- | <p></p>
| + | |
- | | + | |
- | *3x Flag - tag [http://partsregistry.org/Part:BBa_K823034 BBa_K823034]
| + | |
- | | + | |
- | *HA - tag [http://partsregistry.org/Part:BBa_K823035 BBa_K823035]
| + | |
- | | + | |
- | *cMyc - tag
| + | |
- | [http://partsregistry.org/Part:BBa_K823036 BBa_K823036]
| + | |
- | | + | |
- | *His - tag
| + | |
- | [http://partsregistry.org/Part:BBa_K823037 BBa_K823037]
| + | |
- | | + | |
- | *Strep - tag
| + | |
- | [http://partsregistry.org/Part:BBa_K823038 BBa_K823038]
| + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | | + | |
- | '''Project Navigation'''
| + | |
- | | + | |
- | {|
| + | |
- | |<font color="#FFFFFF">+--+--+--+--+--+--+--</font>
| + | |
- | |<font color="#FFFFFF">+--+--+--+--+--</font>
| + | |
- | |<font color="#FFFFFF">+--+--+--+--+--+--</font>
| + | |
- | |<font color="#FFFFFF">+--+--+--+--+--+--</font>
| + | |
| |- | | |- |
- | |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Tags]] |
- | <html>
| + | |} |
- | <a href="https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction">
| + | </div> |
- | <img src="https://static.igem.org/mediawiki/2012/8/8d/Bacilluss_Intro.png" height=70"/> | + | <br> |
- | </a>
| + | <br> |
- | <font size="1">
| + | <br> |
- | </font>
| + | <br> |
- | <br /> | + | <div class="box"> |
- | <a href="https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction"><font size="1" face="verdana">Bacillus<BR>Intro</font></a>
| + | ====Project Navigation==== |
- | </html>
| + | {| width="100%" align="center" style="text-align:center;" |
- | | + | |[[File:Bacilluss_Intro.png|100px|link=Team:LMU-Munich/Bacillus_Introduction]] |
- | |<html>
| + | |[[File:BacillusBioBrickBox.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks]] |
- | <a href="https://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks">
| + | |[[File:SporeCoat.png|100px|link=Team:LMU-Munich/Spore_Coat_Proteins]] |
- | <img src="https://static.igem.org/mediawiki/2012/7/78/BacillusBioBrickBox.png" height=70"/>
| + | |[[File:GerminationSTOP.png|100px|link=Team:LMU-Munich/Germination_Stop]] |
- | </a>
| + | |- |
- | <font size="1">
| + | |[[Team:LMU-Munich/Bacillus_Introduction|<font size="2">'''''Bacillus'''''<BR>Intro</font>]] |
- | </font>
| + | |[[Team:LMU-Munich/Bacillus_BioBricks|<font size="2" face="verdana">'''''Bacillus'''''<BR>'''B'''io'''B'''rick'''B'''ox</font>]] |
- | <br />
| + | |[[Team:LMU-Munich/Spore_Coat_Proteins|<font size="2" face="verdana">'''Sporo'''beads</font>]] |
- | <a href="https://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks"><font size="1" face="verdana">Bacillus<BR>BioBrickBOX</font></a>
| + | |[[Team:LMU-Munich/Germination_Stop|<font size="2" face="verdana">'''Germination'''<BR>STOP</font>]] |
- | </html>
| + | |
- | | + | |
- | |<html> | + | |
- | <a href="https://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins">
| + | |
- | <img src="https://static.igem.org/mediawiki/2012/c/c1/SporeCoat.png" height=70"/>
| + | |
- | </a>
| + | |
- | <font size="1">
| + | |
- | </font>
| + | |
- | <br /> | + | |
- | <a href="https://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins"><font size="1" face="verdana">SporeCoat<BR>FusionProteins</font></a>
| + | |
- | </html>
| + | |
- | | + | |
- | |<html> | + | |
- | <a href="https://2012.igem.org/Team:LMU-Munich/Germination_Stop">
| + | |
- | <img src="https://static.igem.org/mediawiki/2012/f/f6/GerminationSTOP.png" height=70"/> | + | |
- | </a>
| + | |
- | <font size="1">
| + | |
- | </font>
| + | |
- | <br />
| + | |
- | <a href="https://2012.igem.org/Team:LMU-Munich/Germination_Stop"><font size="1" face="verdana">Germination<BR>STOP</font></a>
| + | |
- | </html>
| + | |
| |} | | |} |
| + | </div> |
| | | |
| | | |
| <!-- Include the next line at the end of every page --> | | <!-- Include the next line at the end of every page --> |
| {{:Team:LMU-Munich/Templates/Page Footer}} | | {{:Team:LMU-Munich/Templates/Page Footer}} |