|
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
|
|
Did a restriction digest as described in the protocol on the following parts. On the pieces to be used as inserts, the number of base pairs are also listed.
Biobrick/Construct | BioBrick | Enzymes | Buffer | bp insert |
---|---|---|---|---|
LuxI+term | <partinfo>Bba_C0061</partinfo>, <partinfo>BBa_B0015</partinfo> | XbaI+PstI | 3 | 747 |
YFP+term | <partinfo>BBa_E0030</partinfo>, <partinfo>BBa_B0015</partinfo> | XbaI+PstI | 3 | 852 |
Lysis | <partinfo>BBa_K112808</partinfo> | XbaI+PstI | 3 | 1785 |
LuxI | <partinfo>Bba_C0061</partinfo> | XbaI+PstI | 3 | 618 |
RBS* | <partinfo>BBa_B0030</partinfo> | SpeI+PstI | 1 | - |
PluxR+HSL | <partinfo>BBa_R0062</partinfo> | SpeI+PstI | 1 | - |
RBS | <partinfo>BBa_B0034</partinfo> | SpeI+PstI | 1 | - |
pSB1A3 | <partinfo>pSB1A3</partinfo> | EcoRI+PstI+DpnI | 3 | - |
plld | - | EcoRI+SpeI | 4 | 344 |
The parts lysis <partinfo>BBa_K112808</partinfo>, YFP+term (<partinfo>BBa_E0030</partinfo>, <partinfo>BBa_B0015</partinfo>), <partinfo>pSB1A3</partinfo> and plld will be assembled using the 3A assembly, so made double cutting mix with these parts.
Gel electrophoresis was done with luxI+term (<partinfo>Bba_C0061</partinfo>, <partinfo>BBa_B0015</partinfo>), lysis <partinfo>BBa_K112808</partinfo>, YFP+term (<partinfo>BBa_E0030</partinfo>, <partinfo>BBa_B0015</partinfo>), LuxI <partinfo>Bba_C0061</partinfo> and plld.
Tranformed Vgb+RBS+YFP+term (<partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo>, <partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>) and Vhb+RBS+YFP+term (<partinfo>BBa_K258005</partinfo>, <partinfo>BBa_B0034</partinfo>, <partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>) in competent DH5ɑ cells as described in the protocol. The plasmid in both of the constructs is <partinfo>psB1A2</partinfo>. They were left in the incubator over night.
Inspected the petri dishes with plld+RBS (lactate induced promoter and <partinfo>BBa_B0030</partinfo>) and the religation of RBS <partinfo>BBa_B0030</partinfo>, had many more colonies on the plld+RBS than the religation, which is good. Transferred a colony of the plld+RBS (lactate promoter and <partinfo>BBa_B0030</partinfo>) and a colony of RBS <partinfo>BBa_B0030</partinfo> to liquid media, with ampicillin resistance.
Cut LuxI+term (<partinfo>Bba_C0061</partinfo> and <partinfo>BBa_B0015</partinfo>) and LuxR+term (<partinfo>BBa_C0062</partinfo> and <partinfo>BBa_B0015</partinfo>) with XbaI and PstI, so that they can be used as inserts. Used the protocol with NEBuffer 3.
Did a gel electrophoresis with LuxI+term (<partinfo>Bba_C0061</partinfo> and <partinfo>BBa_B0015</partinfo>) and LuxR+term (<partinfo>BBa_C0062</partinfo> and <partinfo>BBa_B0015</partinfo>).
Purified RBS and LuxR+DTT. Resulting concentrations were 4.8 and 11.2 ng/µl, respectively.
Inspected the petri dishes from yesterday, LacI <partinfo>BBa_C0012</partinfo> + terminator <partinfo>BBa_B0015</partinfo> showed colonies, the religation of the terminator <partinfo>BBa_B0015</partinfo> did not. Transferred a LacI <partinfo>BBa_C0012</partinfo> + terminator <partinfo>BBa_B0015</partinfo> colony to LB with ampicillin and inoculated at 37C with shaking.
Did a gel electrophoresis on plld, cut it out and extracted it, according to protocols. The concentration after gel extraction was: cplld = 10,6 ng/µl.
Ligation was performed with plld as insert and RBS <partinfo>BBa_B0034</partinfo> as backbone. That means that the construct has a <partinfo>psB1A2</partinfo> plasmid. Also did a religation of the RBS <partinfo>BBa_B0034</partinfo> without any insert.
Transformed plld and RBS <partinfo>BBa_B0034</partinfo> in competent DH5ɑ cells, as well as the religation of RBS <partinfo>BBa_B0034</partinfo>. They were transferred to petri dishes with ampicillin resistance and left in the incubator over night.
Miniprepped VHB+RBS+lysis (<partinfo>BBa_K258005</partinfo>, <partinfo>BBa_B0034</partinfo> and <partinfo>BBa_K112808</partinfo>), VGB+RBS+lysis (<partinfo>BBa_K561001</partinfo>, <partinfo>BBa_B0034</partinfo> and <partinfo>BBa_K112808</partinfo>), pllD+lysis (lactate promoter and <partinfo>BBa_K112808</partinfo>) and three parallels of pBad+YFP (<partinfo>Bba_K206000</partinfo> and <partinfo>BBa_E0030</partinfo>)
Sample | Concentration [ng/µl] |
---|---|
VHB+RBS+lysis | 38,2 |
VGB+RBS+lysis | 50,5 |
pllD+lysis | 40,2 |
pBad+YFP #1 | 46,6 |
pBad+YFP #2 | 40,5 |
pBad+YFP #3 | 38,9 |
In order to start making the construct for the biobrick we are going to improve, the parts needed for the construct were cut using the restriction digest protocol [1].
RBS <partinfo>BBa_B0030</partinfo> will be used as a backbone and was cut with EcoRI and XbaI. LacI <partinfo>BBa_C0012</partinfo> will be an insert, and was cut with EcoRI and SpeI. The terminator <partinfo>BBa_B0014</partinfo> will be used as a backbone and was cut with EcoRI and XbaI. In addition we will test the construct using a constitutive promoter <partinfo>BBa_J23119</partinfo> which was cut using EcoRI and SpeI.
The inserts LacI <partinfo>BBa_C0012</partinfo> and constitutive promoter <partinfo>BBa_J23119</partinfo> were run on gel after the restriction digest. The problem with the constitutive promoter is that it is only 35 b.p long, and is therefore difficult to use as an insert. We tried to stop the gel early to see if we could detect the constitutive promoter, but we could not see anything at all. We therefore ran the gel further and cut the LacI <partinfo>BBa_C0012</partinfo> out of the gel.
Used the PCR purification kit and protocol from www.qiagen.com [http://www.google.no/url?sa=t&rct=j&q=&esrc=s&source=web&cd=2&ved=0CFUQFjAB&url=http%3A%2F%2Fwww.qiagen.com%2FHB%2FQIAquickGelExtractionKit_EN&ei=RhYhUPiCA4iL4gS64oD4CA&usg=AFQjCNFwed-RxSRRgTFSJgtn7Fl5qisiWw&sig2=-pxyzkbLpVKt4DLlcSzQcw], on RBS <partinfo>BBa_B0030</partinfo>, pBad <partinfo>Bba_K206000</partinfo> and terminator <partinfo>BBa_B0014</partinfo>. Did a gel extraction using the Gel Extraction kit and Protocol on LacI <partinfo>BBa_C0012</partinfo>.
Did a ligation with LacI <partinfo>BBa_C0012</partinfo> and double terminator <partinfo>BBa_B0015</partinfo>, where the double terminator <partinfo>BBa_B0015</partinfo> was used as a backbone. That means, the construct has a <partinfo>psB1AK3</partinfo> backbone and resistance Ampicillin and Kanamycin. A religation of the backbone <partinfo>BBa_B0015</partinfo> was also performed.
The ligated LacI <partinfo>BBa_C0012</partinfo> and double terminator <partinfo>BBa_B0015</partinfo> was transformed in competent DH5ɑ cells, along with the religation of the backbone <partinfo>BBa_B0015</partinfo>. The petri dishes are left to inoculate through the night.
A new batch of LA-medium was made and used to make ampicillin petri dishes.
A restriction digest was done on the lld promoter, as described in the protocols. It was cut with EcoRI and SpeI, and will be an insert with RBS <partinfo>BBa_B0030</partinfo> as backbone. This will then make the plasmid <partinfo>pSB1A2</partinfo> the backbone.
Plasmid DNA was isolated from pllD-1B and <partinfo>BBa_B0014</partinfo> cultures were isolated by miniprep. DNA concentrations were measured as 41,2/42,5 and 53,3/52,8 ng/uL respectively (two measurements per sample).
Inspected agar plates in incubator inoculated on 3/8: VGB+RBS religation: 1 colony VHB+RBS+lysis: Good growth VHB+RBS religation: ~ 20 colonies VHB+RBS + lysis: Good growth pBAD (w/ backbone), religated: 40+ colonies pBAD +YFP +DTT: 7 colonies
Comments: Judging from the growth on the religation plates, colonies with non-insert plasmids is a possibility on all plates. pBAD is especially worrisome, as the number of colonies is lower on the insert ligation plate than on the backbone religation plate. The lysis part used in the above constructs already has an RBS, so the RBS part is redundant.
Induced one 5 mL culture (induction culture) pllD + lysis (3/8) with 210 uL ~ 1M lactate and addded 210 uL dH2O to another (control culture). Sampled 200 uL from both before induction, for OD measurements.
Inoculated 5 5 mL LB + Amp cultures with colonies from the following agar plates: VGB+RBS+Lysis (3/8) VHB+RBS+Lysis (3/8) pBAD + YFP +DTT (3/8) (3 colonies)
Inoculated 3 5 mL LB + Cm cultures from pllD + lysis agar plate.
Isolated plasmid DNA from the cultures of RBS* (<partinfo>BBa_B0030</partinfo>) and LacI (<partinfo>BBa_C0012</partinfo>) inoculated yesterday.
Ligated pBad (<partinfo>Bba_K206000</partinfo>) together with YFP+DTT (<partinfo>BBa_E0030</partinfo> and <partinfo>BBa_B0015</partinfo>), and VGB+RBS (<partinfo>BBa_K561001</partinfo> and <partinfo>BBa_B0034</partinfo>) and VHB+RBS (<partinfo>BBa_K258005</partinfo> and <partinfo>BBa_B0034</partinfo>) with Lysis (<partinfo>BBa_K124017</partinfo>). These were then transformed into competent E. coli DH5α cells and plated out on petri dishes with Ampicillin.
Terminator <partinfo>BBa_B0014</partinfo> and re-transformed pllD in <partinfo>pSB1C3</partinfo> ("pllD 1-B") were transferred to liquid culture.
Ran gel on the PCR-products from yesterday.
Inoculated 2 x 5 mL, 1 x 10 mL and 1 x 25 mL LB + Cm with plld + lysis.
5 µl of the PCR product from yesterday was run on gel, but it did not give any results. We looked at the primers and thought we had done something wrong, but we did not. Will try to do the PCR one more time, but with a lower annealing temperature (55°C).
The constructs containing plld ligated with the lysis device(<partinfo>BBa_K112808</partinfo>), and plld in plasmid <partinfo>PSB1C3</partinfo> were miniprepped. The concentration were measured using nano drop.
Sample | Concentration [ng/µl] |
---|---|
pllD + lysis | 45,5 |
pllD in PSB1C3 | 42,3 |
Inoculated 1 colony from each of three plates containing LacI (<partinfo>BBa_C0012</partinfo>), RBS* <partinfo>BBa_B0030</partinfo> and pllD + lysis (all inoculated 1/8), into 5 mL LB + Amp (BBa_B0030, LacI)/ LB + Cm (pllD + lysis).
Transformed the part <partinfo>BBa_B0014</partinfo> from the distribution kit, and re-transformed pllD in pSB1C3 with DNA taken from the sample shipped to the RHIT team yesterday.
Reviewed the data from the oxygen-promoter experiment on monday. In conclusion, it appears that oxygen levels in the induced (anaerobic) cultures were not as low as desired, as growth rates were very similar between the aerobic and anaerobic cultures, while one would expect anaerobic cultures to grow slower. After correcting for OD, the fluorescence in the cultures at the end of the experiment was lower than the fluorescence measured from a control culture with no expected production of fluorescent protein. For this reason, a full analysis of the rest of the data was not performed.
Gel purification was performed on the gel piece from yesterday, the lysis device cut with X+P. The concentration is 10,1 ng/µl. The lysis device and plld were ligated together, plld (with <partinfo>pSB1C3</partinfo>) as backbone.
The ligated lysis and plld were transformed into competent E.coli DH5α cells. This was also done for the biobricks lacI repressor from E. coli (<partinfo>BBa_C0012</partinfo>) and RBS (<partinfo>BBa_B0030</partinfo>).
The petri dishes from yesterday showed colonies on the dishes with the pSB1C3+Colisin construct (<partinfo>pSB1C3</partinfo> and <partinfo>BBa_K150009</partinfo>) and the K+RBS+Colisin construct (<partinfo>BBa_K081005</partinfo> and <partinfo>BBa_K150009</partinfo>). One colony from each petri dish were transferred to liquid medium.
Sent a sample of the E. coli pllD promoter in <partinfo>pSB1C3</partinfo> backbone to the iGEM team at RHIT.
PCR was performed on pBad (<partinfo>Bba_K206000</partinfo>) and DTT (<partinfo>BBa_B0015</partinfo>), the primers used, PCR-mix and programmed times are listed below.
Primer | Type | Sequence | Tm [°C] |
---|---|---|---|
DTT fwd | Forward | CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAG | 72 |
DTT rev | Reverse | CTCTAGAAGCGGCCGCGAATTCCAGAAATC | 72 |
pBad scar fwd | Forward | TACTAGAGTACTAGTAGCGGCCGCTGCAGT | 72 |
pBad fwd | Forward | TACTAGTAGCGGCCGCTGCAGTC | 70 |
pBad rev | Reverse | GCTAGCCCAAAAAAACGGTATGGAGAAACAGTAGAGAG | 72 |
Mix 1:
Mix 2:
This PCR mix was found here: http://francois.schweisguth.free.fr/protocols/High_fildelity_roche.pdf
Thermal timetables:
|
|
</div>