Team:St Andrews/Procedure

From 2012.igem.org

(Difference between revisions)
Line 49: Line 49:
       <p>anyone really keen to write this up, up to protein visualization? Don't forget to mention the differing restriction enzymes and vectors of each team. I can add in links to the protocols page.</p>
       <p>anyone really keen to write this up, up to protein visualization? Don't forget to mention the differing restriction enzymes and vectors of each team. I can add in links to the protocols page.</p>
-
       <p>Please also refer to our <a href="https://2012.igem.org/Team:St_Andrews/Lab-book"><font color="gray">Protocols</font></a> page.</p>
+
       <p>Please also refer to our <a href="https://2012.igem.org/Team:St_Andrews/Lab-book"><strong>Protocols</strong></a> page.</p>
<BR>&nbsp;</BR>
<BR>&nbsp;</BR>
<BR>&nbsp;</BR>
<BR>&nbsp;</BR>
Line 548: Line 548:
<BR>&nbsp;</BR>
<BR>&nbsp;</BR>
-
<p>Lipids were extracted from transformed <i>E. coli</i> using the Blight/Dyer method. (Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book">Lipid extraction lab book entry</a> for further detail.)</p>  
+
<p>Lipids were extracted from transformed <i>E. coli</i> using the Blight/Dyer method. (Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book"><strong>Lipid extraction lab book entry</strong></a> for further detail.)</p>  
<p>We then analyzed the the fatty acid content of the transformed cells to determine whether it differed from the previously analyzed background lipid composition. This was done using mass spectrometry.</p>
<p>We then analyzed the the fatty acid content of the transformed cells to determine whether it differed from the previously analyzed background lipid composition. This was done using mass spectrometry.</p>
Line 568: Line 568:
<p>All primers are notated 5' to 3'.</p>
<p>All primers are notated 5' to 3'.</p>
-
<p>Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book#Primer annealing">Primer annealing lab book entry</a> for further detail.</p>
+
<p>Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book#Primer annealing"><strong>Primer annealing lab book entry</strong></a> for further detail.</p>
<p> </p>
<p> </p>
<div class="btn-toolbar">
<div class="btn-toolbar">
Line 658: Line 658:
<p>For primer annealing in the PCR, the primer sequences were combined in the following way:</p>
<p>For primer annealing in the PCR, the primer sequences were combined in the following way:</p>
-
<p>Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book">Primer annealing lab book entry</a> for further detail.</p>
+
<p>Please refer to the <a href="https://2012.igem.org/Team:St_Andrews/Lab-book"><strong>Primer annealing lab book entry</strong></a> for further detail.</p>
<li><strong>GST Forward</strong> and <strong>Ni Reverse</strong></li>
<li><strong>GST Forward</strong> and <strong>Ni Reverse</strong></li>

Revision as of 11:54, 3 August 2012

St Andrews iGEM '12

Lab Book

Procedure

date
what we did
date
what we did
date
what we did

anyone really keen to write this up, up to protein visualization? Don't forget to mention the differing restriction enzymes and vectors of each team. I can add in links to the protocols page.

Please also refer to our Protocols page.


 

 

 

 

 

 

 

 

 

 

 
Sequences   Primers   Sequencing results   Lipid analysis
 

Start from lipid extraction

primers, sequence results


 
Sequences
 

Δ12 T. Cruzi Δ12 Synechocystis Δ15 Synechocystis Δ6 Synechocystis ELO 6 L. major
 

 
Primers
 

All primers are notated 5' to 3'.
 

Δ12 T. Cruzi forward
    ATATCATATGTGGCGGGTTGACAATTTA
Δ12 T. Cruzi reverse

    ATATCTCGAGTTACCCATGAAAGACAC

Δ12 Synechocystis forward
    ATATCATATGACTGCCACGATTCCC
Δ12 Synechocystis reverse
    ATATCTCGAGTTAAACTTTTTTCAGGGAGC
Δ15 Synechocystis forward
    ATATCATATCGCTCTAGAAATTTCATC

Δ15 Synechocystis reverse
    ATATCACGACTTAAGGTTTCTTTTGATATC
Δ6 Synechocystis forward
    ATATCATATGCAAACAGCGGAAAGAATT
Δ6 Synechocystis reverse
    ATATCTCGAGTAACGATGCTTTGACCATGGCCTCTAG
ELO6 L. major forward
    ATATCATATGTTCTCTCTGGAGCAGGCCGAA
ELO6 L. major reverse
    ATATCTCGAGTCATCGACTGCCTGCCATGGCCTG


 

When using the pET-duet vector, we needed additionally primers for the alternative restriction sites and His-tags.

ELO6 L. major forward
    TATCATATGGGAAGCAGCCATCATCATCATCATCACAGCATGGTCTCTCTGGAGCAGGCC
Δ15 T. Cruzi forward
    TATCATATGGGCAGCCATCATCATCATCATCACAGCATGCGTCTAGAAATTTCATCG
Δ6 T. Cruzi forward
    GGATCCGAATTCATCTAACAGCGGAAAGAATT
Δ6 T. Cruzi reverse
    GACAAGCTTTCACGATGCTTTGCCCATGGCCTCTAC
Δ12 T. Cruzi forward
    GGATCCGAATTCATGACTGCCACGATTCCC
Δ12 T. Cruzi reverse
    GACAAGCTTTTAAACTTTTTTCAGGGAGC

 
Sequencing results
 
16/7/12 Δ15

    Δ15 and Δ6 desaturases from Synechocystis in pET-15b were sent off for sequencing. Once again, the results were discouraging even though protein and lipid analysis showed the opposite. BLAST showed that the gene found in both samples corresponded to a T. brucei HMG-CoA reductase which we thought we had cut out from the plasmid. We thus performed a PCR, using the vectors sent off for sequencing as a template.

    Sequence


 
16/7/12 Δ6

    Sequence


 
29/6/12 ELO6

    After showing successful insertion of L. major Δ6 elongase in pET-15b, the sample was sent off for sequencing. Unfortunately, the gene sequenced was not the Δ6 elongase we were hoping to find, but a T. brucei mevalonate kinase, which was previously inserted in the pET-15b vectors we had been using. Thus, we digested some fresh pET-15b to be used in the future.

    Sequence


 
23/7/12 Δ12

    15b forward gave 0 nucleotides

    15b reverse gave 0 nucleotides

    20b forward gave a 41 nucleotide result.

    Sequence
      gCGnCctGntGCCgCGCGGCnnnnnnnnnnnnnnnnnngac

    A BLAST search showed this to be compatible with Crocosphaera watsonii (genome shotgun sequence, 21%), a diazotrophic cyanobacteria.

    20b reverse gave 0 nucleotides


 

 
Lipid analysis
 

Lipids were extracted from transformed E. coli using the Blight/Dyer method. (Please refer to the Lipid extraction lab book entry for further detail.)

We then analyzed the the fatty acid content of the transformed cells to determine whether it differed from the previously analyzed background lipid composition. This was done using mass spectrometry.


 

 

 

 

 

who knows what those Metal Mickies are up to. Eating nachos in the Whey Pat most likely. MEGA LOLS (all caps, with a Z).


 

Primers Digestion Transformation


 
Primers
 

All primers are notated 5' to 3'.

Please refer to the Primer annealing lab book entry for further detail.

Ni forward
    AATTCCATCATCACCATCACCACC
Ni reverse

    TCGAGGTGGTGATCGTGATGATGG

Ni2 forward
    AATTCATGTGTACAACATGCGGTTGCGGTGAAGGCC
Ni2 reverse
    TCGAGGCCTTCACCGCAACCGCATGTTGTACACATG
.

Pd forward
    AGCGTGACCCAGAACAAATAT
Pd reverse
    ATATTTGTTCTGGGTCACGCT
Pt forward
    GATCGCACCAGCACCTGGCGC
Pt reverse
    GCGCCAGGTGCTGGTGCGATC


 

For primer annealing in the PCR, the primer sequences were combined in the following way:

Please refer to the Primer annealing lab book entry for further detail.

  • GST Forward and Ni Reverse
  • GST Forward and Ni2 Reverse
  • GST Forward and Pd Reverse
  • GST Forward and Pt Reverse

    •  
    Digestion
     

    pGEX-6P-1 was cut using EcoR1(954) and Xho1 (975)


     
    Transformation
     

    pGEX vector with insert transformed into DH5α E. coli cells to replicate.

    pGEX vector with G-Block insert transformed into DH5α E. coli cells to replicate.


     

    pGEX vector with insert transformed into BL21 E. coli cells for protein expression.

    pGEX vector with G-Block insert transformed into BL21 E. coli cells for protein expression.


     

     

     

     

     

     

     

    Back to top

    University of St Andrews, 2012.

    Contact us: igem2012@st-andrews.ac.uk, Twitter, Facebook

    This iGEM team has been funded by the MSD Scottish Life Sciences Fund. The opinions expressed by this iGEM team are those of the team members and do not necessarily represent those of Merck Sharp & Dohme Limited, nor its Affiliates.

    Retrieved from "http://2012.igem.org/Team:St_Andrews/Procedure"