Team:St Andrews/Procedure
From 2012.igem.org
(Difference between revisions)
Line 222: | Line 222: | ||
</a> | </a> | ||
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
- | + | ATATCATATGTGGCGGGTTGACAATTTA | |
</ul> | </ul> | ||
</div> | </div> | ||
Line 232: | Line 232: | ||
</a> | </a> | ||
<ul class="dropdown-menu"> | <ul class="dropdown-menu"> | ||
- | + | <p>ATATCTCGAGTTACCCATGAAAGACAC</p> | |
</ul> | </ul> | ||
</div> | </div> |
Revision as of 18:15, 26 July 2012
Lab Book
Procedure
- date
- what we did
- date
- what we did
- date
- what we did
anyone really keen to write this up, up to protein visualization? Don't forget to mention the differing restriction enzymes and vectors of each team. I can add in links to the protocols page.
Please also refer to our Protocols page.
Sequences Primers Sequencing results Lipid analysis
Start from lipid extraction
primers, sequence results
Sequences
Lipid analysis
who knows what those Metal Mickies are up to. Eating nachos in the Whey Pat most likely.