Team:LMU-Munich/Bacillus BioBricks

From 2012.igem.org

(Difference between revisions)

Latest revision as of 16:41, 26 October 2012

The LMU-Munich team is exuberantly happy about the great success at the World Championship Jamboree in Boston. Our project Beadzillus finished 4th and won the prize for the "Best Wiki" (with Slovenia) and "Best New Application Project".

[ more news ]

Bacillus BioBrick Box banner.resized WORDS.JPG

B⁴ - 22 core parts for Bacillus subtilis

A major goal of our iGEM project is to introduce B. subtilis as a new chassis for BioBrick-based synthetic biology. For that purpose, we created a toolbox of Bacillus BioBricks to contribute to the registry to make it accessible to many more future iGEM-teams and the entire public microbiology domain! This Bacillus BioBrick Box (B⁴) contains the following Bacillus specific parts:

Vectors	Promoters	Reporters	Affinity tags

pSB_Bs1C pSB_Bs4S pSB_Bs2E pSB_Bs1C-lacZ pSB_Bs3C-luxABCDE pSB_Bs4S-P_xyl pSB_Bs0K-P_spac Sporovector	Anderson P_liaG P_veg P_lepA P_liaI xylR-P_xyl	gfp mkate2 lacZ luc+	Flag His cMyc Strep HA

Since Bacillus subtilis is not an organism commonly used in iGEM, please check out our Introduction to learn more about it.

Bacillus Vectors


We have generated a suite of BioBrick-compatible vectors: three empty insertional backbones with different antibiotic resistances and integration loci, two reporter and two expression vectors.

Bacillus Promoters


To provide a set of promoters of different strength we characterized several promoters in Bacillus subtilis. Both constitutive and inducible promoters are covered.

Bacillus Reporters


We designed and codon-optimized a set of reporters that are commonly used in B. subtilis.

Affinity Tags


We synthesized 5 affinity tags for protein purification. They all are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags.

Project Navigation


Bacillus Intro	Bacillus BioBrickBox	Sporobeads	Germination STOP

Retrieved from "http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks"

@@ Line 3: / Line 3: @@
 [[File:Bacillus BioBrick Box banner.resized WORDS.JPG|620px|link=]]
-[[Image:BacillusBioBrickBox.png|100px|right|link=Team:LMU-Munich/Team:LMU-Munich/Bacillus_BioBricks]]
+[[Image:BacillusBioBrickBox.png|100px|right|link=]]
-=='''B<sup>4</sup>''' - 22 core parts for ''Bacillus subtilis''==
-<p align="justify">A major goal of our iGEM project is to [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction introduce ''B. subtilis''] as a new chassis for BioBrick-based Synthetic Biology. For that purpose, we created a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry to make it accessible to many more future iGEM-Teams! This ''<b>Bacillus'' B</b>io<b>B</b>rick <b>B</b>ox ('''B<sup>4</sup>''') contains the following ''Bacillus'' specific parts:</p>
+=='''B<sup>4</sup>''' - 22 core parts for ''Bacillus subtilis''==
+<br>
+<p align="justify">A major goal of our iGEM project is to [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction introduce ''B. subtilis''] as a new chassis for BioBrick-based synthetic biology. For that purpose, we created a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry to make it accessible to many more future iGEM-teams and the entire public microbiology domain! This ''<b>Bacillus'' B</b>io<b>B</b>rick <b>B</b>ox ('''B<sup>4</sup>''') contains the following ''Bacillus'' specific parts:</p>
@@ Line 14: / Line 16: @@
 {| width="100%"
-| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]'''
+| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Vectors|Vectors]]'''
-| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Promoters|Promoters]]'''
+| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Promoters|Promoters]]'''
-| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Reporters|Reporters]]'''
+| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Reporters|Reporters]]'''
-| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Affinity_Tags|Affinity tags]]
+| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Tags|Affinity tags]]
 |-
 |[[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]
@@ Line 51: / Line 53: @@
 </div>
-<p align="justify">Since ''Bacillus subtilis'' is not an organism commonly used in iGEM, please check out our [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction Introduction].</p>
+[[File:NEXT.png|right|80px|link=Team:LMU-Munich/Germination_Stop]]  [[File:BACK.png|left|80px|link=Team:LMU-Munich/Data/differentiation_tour]]
+<p align="justify">Since ''Bacillus subtilis'' is not an organism commonly used in iGEM, please check out our [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction Introduction] to learn more about it.</p>
 <div class="box">
 ==''Bacillus'' Vectors   [[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]==
 {| "width=100%" style="text-align:center;" style="align:right"|
-|<p align="justify">We have generated a suit of BioBrick-compatible vectors: three empty insertional backbones with different antibiotic resistances and integration loci, two reporter and two expression vectors. Here is a list of all the vectors we cloned and used.</p>
+|<p align="justify">We have generated a suite of BioBrick-compatible vectors: three empty insertional backbones with different antibiotic resistances and integration loci, two reporter and two expression vectors.</p>
 |[[File:LMU-Munich-PSBBs1C.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Vectors]]
 |-
@@ Line 87: / Line 101: @@
 </div>
+<div class="box">
 ==Affinity Tags  [[File:Proteinaffinitytagbutton.png|50px]]==
+{| "width=100%" style="align:right"|
+|
-<p align="justify">
+<p align="justify">We synthesized 5 affinity tags for protein purification. They all are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags.</p>
-All our tags have been synthesized by [http://de-de.invitrogen.com/site/de/de/home/Products-and-Services/Applications/Cloning/gene-synthesis.html GeneArt]. They are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags. </p>
+|-
+! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Tags]]
-Find out more about the design of our [https://static.igem.org/mediawiki/2012/b/b9/LMU-Munich_2012_Our_Freiburg_standard_FusionPrefix.pdf prefix with ribosome binding site].
+|}
+</div>
-prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
+<br>
+<br>
-suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
+<br>
+<br>
-*'''3x Flag-tag''' [http://partsregistry.org/Part:BBa_K823034 (BioBrick:BBa_K823034)]
-<p align="justify">
-The Flag-tag was the first epitope tag to be published ([http://www.nature.com/nbt/journal/v6/n10/full/nbt1088-1204.html Hopp, Prickett et al. (1988)]). It consists of eight hydrophobic amino acids: DYKDDDDK. To enhence senstitivity in Western blots, it is routinely used as a 3x Flag tag in ''B. subtilis'' [http://www.ncbi.nlm.nih.gov/pubmed?term=wiegert%20flag (Kaltwasser ''et al.'', 2002)]. Its sequence is: <b>DYKDHDGDYKDHDIDYKDDDDK</b>. There are a variety of monoclonal antibodies against this tag, N-terminal as well as position insensitive.</p>
-*'''HA - tag''' [http://partsregistry.org/Part:BBa_K823035 (BioBrick:BBa_K823035)]
-<p align="justify">
-The HA-tag is an epitope derived from the HA-virus. There was first an antibody against it and then the epitope was characterized ([http://www.ncbi.nlm.nih.gov/pubmed/6204768 Wilson, I.A. et al. (1984)]). It was then furthermore used as a tag for protein purification and recognition ([http://www.ncbi.nlm.nih.gov/pubmed/2455217 Field et al. (1988)]). The amino acid sequence is: <b>YPYDVPDYA</b>.</p>
-*'''cMyc - tag''' [http://partsregistry.org/Part:BBa_K823036 (BioBrick:BBa_K823036)]
-<p align="justify">
-The cMyc-tag is derived from the cMyc gene product. Antibodies were generated from the immunization with synthetic peptides from the cMyc sequence ([http://mcb.asm.org/content/5/12/3610.short Evan, Bishop et al.(1985)]). The amino acid sequence is <b>EQKLISEEDL</b>.</p>
-*'''His - tag''' [http://partsregistry.org/Part:BBa_K823037 (BioBrick:BBa_K823037)]
-<p align="justify">
-The His-tag is a metal chelating peptide ([http://www.nature.com/nbt/journal/v6/n11/full/nbt1188-1321.html Hochul,Stüber et al. (1988)]) consisting of at least 6 histidin residues. It can be used for protein purification by metal<sup>2+</sup>ion-containing columns (nickel). There are also antibodies against this tag, or nickel/cobalt containing fluorescent probes can be used for detection. Moreover, an immobilization is possible in nickel/cobalt coated plastikware.
-The aminoacid sequence is:<b>HHHHHHHHHH</b></p>
-*'''Strep - tag''' [http://partsregistry.org/Part:BBa_K823038  (BioBrick:BBa_K823038)]
-<p align="justify">
-The Strep-tag is a mimicry peptide of biotin which binds to Streptavidin ([http://www.sciencedirect.com/science/article/pii/S1050386299000339 Skerra, Schmidt (1999)]). Its sequence is <b>WSHPQFEK</b>. It can be used for protein purification, immobilization with streptavidin or strep-tactin ([http://www.ncbi.nlm.nih.gov/pubmed/9415448 Voss, Skerra (1997)]) or detection with Strep-tactin or antibodies.</p>
-[[File:NEXT.png|right|80px|link=Team:LMU-Munich/Spore_Coat_Proteins]]
 <div class="box">
 ====Project Navigation====