|
|
(88 intermediate revisions not shown) |
Line 1: |
Line 1: |
| <!-- Include the next line at the beginning of every page --> | | <!-- Include the next line at the beginning of every page --> |
| {{:Team:LMU-Munich/Templates/Page Header|File:Team-LMU_culture_tubes.resized.jpg|3}} | | {{:Team:LMU-Munich/Templates/Page Header|File:Team-LMU_culture_tubes.resized.jpg|3}} |
- | [[File:BBB_banner.jpg|620px|link=]] | + | [[File:Bacillus BioBrick Box banner.resized WORDS.JPG|620px|link=]] |
| | | |
| | | |
- | [[Image:BacillusBioBrickBox.png|100px|right|link=Team:LMU-Munich/Team:LMU-Munich/Bacillus_BioBricks]] | + | [[Image:BacillusBioBrickBox.png|100px|right|link=]] |
| + | |
| | | |
| | | |
| =='''B<sup>4</sup>''' - 22 core parts for ''Bacillus subtilis''== | | =='''B<sup>4</sup>''' - 22 core parts for ''Bacillus subtilis''== |
- | | + | <br> |
- | | + | <p align="justify">A major goal of our iGEM project is to [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction introduce ''B. subtilis''] as a new chassis for BioBrick-based synthetic biology. For that purpose, we created a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry to make it accessible to many more future iGEM-teams and the entire public microbiology domain! This ''<b>Bacillus'' B</b>io<b>B</b>rick <b>B</b>ox ('''B<sup>4</sup>''') contains the following ''Bacillus'' specific parts:</p> |
- | We will create a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry.
| + | |
- | | + | |
- | This ''<b>Bacillus'' B</b>io<b>B</b>rick<b>B</b>ox ('''B<sup>4</sup>''') contains ''Bacillus'' specific parts: | + | |
| | | |
| | | |
Line 18: |
Line 16: |
| {| width="100%" | | {| width="100%" |
| | | |
- | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]''' | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Vectors|Vectors]]''' |
- | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Promoters|Promoters]]''' | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Promoters|Promoters]]''' |
- | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Reporters|Reporters]]''' | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Reporters|Reporters]]''' |
- | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Affinity_Tags|Affinity tags]] | + | | style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Tags|Affinity tags]] |
| |- | | |- |
| |[[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]] | | |[[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]] |
Line 29: |
Line 27: |
| |- | | |- |
| |valign="top"|<font size="2"> | | |valign="top"|<font size="2"> |
- | pSB<sub>''Bs''</sub>1C<br>pSB<sub>''Bs''</sub>4S<br>pSB<sub>''Bs''</sub>2E<br>pSB<sub>''Bs''</sub>1C-''lac''Z<br>pSB<sub>''Bs''</sub>3C-''lux''ABCDE<br>pSB<sub>''Bs''</sub>4S-P<sub>''xyl''</sub><br>pSB<sub>''Bs''</sub>0K-P<sub>''spac''</sub><br>'''Sporo'''vector</font> | + | pSB<sub>''Bs''</sub>1C<br> |
| + | pSB<sub>''Bs''</sub>4S<br> |
| + | pSB<sub>''Bs''</sub>2E<br> |
| + | pSB<sub>''Bs''</sub>1C-''lac''Z<br> |
| + | pSB<sub>''Bs''</sub>3C-''lux''ABCDE<br> |
| + | pSB<sub>''Bs''</sub>4S-P<sub>''xyl''</sub><br> |
| + | pSB<sub>''Bs''</sub>0K-P<sub>''spac''</sub><br> |
| + | '''Sporo'''vector</font> |
| |valign="top"|<font size="2"> | | |valign="top"|<font size="2"> |
- | Anderson<br>P<sub>''liaG''</sub><br>P<sub>''veg''</sub><br>P<sub>''lepA''</sub><br>P<sub>''liaI''</sub><br>P<sub>''xyl''</sub>-XylR</font> | + | Anderson<br> |
| + | P<sub>''liaG''</sub><br> |
| + | P<sub>''veg''</sub><br> |
| + | P<sub>''lepA''</sub><br> |
| + | P<sub>''liaI''</sub><br> |
| + | ''xylR''-P<sub>''xyl''</sub></font> |
| |valign="top"|<font size="2"> | | |valign="top"|<font size="2"> |
- | ''gfp''<br>''mkate2''<br>''lacZ''<br>''luc''<br></font> | + | ''gfp''<br> |
| + | ''mkate2''<br> |
| + | ''lacZ''<br> |
| + | ''luc+''<br></font> |
| |valign="top"|<font size="2"> | | |valign="top"|<font size="2"> |
| Flag<br>His<br>cMyc<br>Strep<br>HA</font> | | Flag<br>His<br>cMyc<br>Strep<br>HA</font> |
Line 41: |
Line 54: |
| | | |
| | | |
- | ==''Bacillus'' Vectors [[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]==
| |
| | | |
| + | [[File:NEXT.png|right|80px|link=Team:LMU-Munich/Germination_Stop]] [[File:BACK.png|left|80px|link=Team:LMU-Munich/Data/differentiation_tour]] |
| | | |
- | <p align="justify"> We have generated a suit of BioBrick-compatible vectors, three empty ones with different antibiotic resistances and integration loci, two reporter and two expression vectors.Here is a list of all the vectors we cloned and used.</p>
| |
| | | |
- | <p align="justify">For the use of our vectors, please see our [[Team:LMU-Munich/Lab_Notebook/Protocols|Protocols]] page. A general introduction to [[Team:LMU-Munich/Bacillus Introduction |''Bacillus subtilis'']] and its integrative vectors can be found [[Team:LMU-Munich/Bacillus_BioBricks/integration|here]]. All vectors have ampicillin as <i>Escherichia coli</i> resistance and RFP in the multiple cloning site as selection marker.</p>
| |
| | | |
| | | |
- | {| class="colored"
| |
- | |-
| |
- | !Vector Name
| |
- | !colspan="2"|Resistance
| |
- | !Insertion
| |
- | !Description
| |
- | !colspan="2"|Vector origin
| |
- | |-
| |
- | !<font color="#EBFCE4" size="2">BioBrick</font>
| |
- | !Eco
| |
- | !Bsu
| |
- | !locus
| |
- | !
| |
- | !Name
| |
- | !Reference
| |
- | |-
| |
- | !pSB<sub>''Bs''</sub>1C [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823023 <font color="#EBFCE4" size="2">(BBa_K823023)</font>]
| |
- | |Amp
| |
- | |Cm
| |
- | |''amyE''
| |
- | |empty
| |
- | |pDG1662
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury]
| |
- | |-
| |
- | !pSB<sub>''Bs''</sub>4S [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823022 <font color="#EBFCE4" size="2">(BBa_K823022)</font>]
| |
- | |Amp
| |
- | |Spec
| |
- | |''thrC''
| |
- | |empty
| |
- | |pDG1731
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury]
| |
- | |-
| |
- | !pSB<sub>''Bs''</sub>2E [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823027 <font color="#EBFCE4" size="2">(BBa_K823027)</font>]
| |
- | |Amp
| |
- | |MLS
| |
- | |''lacA''
| |
- | |empty
| |
- | |pAX01
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/11274134 Härtl]
| |
- | |-
| |
- | !pSB<sub>''Bs''</sub>1C-<i>lac</i>Z [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823021 <font color="#EBFCE4" size="2">(BBa_K823021) </font>]
| |
- | |Amp
| |
- | |Cm
| |
- | |''amyE''
| |
- | |<i>lacZ</i> reporter
| |
- | |pAC6
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/11902727 Stülke]
| |
- | |-
| |
- | !pSB<sub>''Bs''</sub>3C-<i>lux</i>ABCDE [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823025 <font color="#EBFCE4" size="2">(BBa_K823025)</font>]
| |
- | |Amp
| |
- | |Cm
| |
- | |''sacA''
| |
- | |<i>luxABCDE</i> reporter
| |
- | |pAH328
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/20709900 Schmalisch]
| |
- | |-
| |
- | !pSB<sub>''Bs''</sub>4S-P<sub><i>Xyl</i></sub> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823024 <font color="#EBFCE4" size="2">(BBa_K823024)</font>]
| |
- | |Amp
| |
- | |Spec
| |
- | |''thrC''
| |
- | |Xylose-promoter
| |
- | |pXT
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/11069659 Derré]
| |
- | |-
| |
- | !pSB<sub>''Bs''</sub>0K-P<sub><i>spac</i></sub> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823026 <font color="#EBFCE4" size="2">(BBa_K823026)</font>]
| |
- | |Amp
| |
- | |Kan
| |
- | |replicative
| |
- | |IPTG-promoter
| |
- | |pDG148
| |
- | |[http://www.ncbi.nlm.nih.gov/pubmed/11728721 Joseph]
| |
- | |-
| |
- | !'''Sporo'''vector [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823054 <font color="#EBFCE4" size="2">(BBa_K823054)</font>]
| |
- | |Amp
| |
- | |Spec
| |
- | |''thrC''
| |
- | |to create [https://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins '''Sporo'''beads]
| |
- | |pSB<sub>Bs</sub>4S
| |
- | |[[Team:LMU-Munich/Bacillus_BioBricks/Sporovector|'''Sporo'''vector]]
| |
- | |-
| |
- | |}
| |
| | | |
| | | |
| | | |
- | Here you can find the respective vector maps:
| |
| | | |
- | {|
| + | |
- | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/e/e0/LMU-Munich-PSBBs1C.png" height=130"/></a></html>
| + | <p align="justify">Since ''Bacillus subtilis'' is not an organism commonly used in iGEM, please check out our [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction Introduction] to learn more about it.</p> |
- | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/2/2a/LMU-Munich-PSBBs4S.png" height=130"/></a></html>
| + | |
- | |-
| + | <div class="box"> |
- | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/4/46/LMU-Munich-PSBBs2E.png" height=130"/></a></html>
| + | ==''Bacillus'' Vectors [[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]== |
- | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/0/04/LMU-Munich-PSBBs1C-lacZ.png" height=130"/></a></html> | + | {| "width=100%" style="text-align:center;" style="align:right"| |
- | |- | + | |<p align="justify">We have generated a suite of BioBrick-compatible vectors: three empty insertional backbones with different antibiotic resistances and integration loci, two reporter and two expression vectors.</p> |
- | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/f/fc/LMU-Munich-PSBBs3C-luxABCDE.png" height=130"/></a></html> | + | |[[File:LMU-Munich-PSBBs1C.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Vectors]] |
- | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/d/de/LMU-Munich-PSBBs4S-Pxyl.png" height=130"/></a></html> | + | |
- | |- | + | |
- | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/0/03/LMU-Munich-PSBBs0K-Pspac.png" height=130"/></a></html>
| + | |
- | |<html> <a> <img src="https://static.igem.org/mediawiki/2012/a/ab/LMU-Munich-Sporovector.png" height=130"/></a></html> | + | |
| |- | | |- |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Vectors]] |
| |} | | |} |
| + | </div> |
| | | |
- | <p align="justify">The number in the vector's name codes for the insertion locus and the following letter for the <i> Bacillus subtilis </i> resistance gene according to the following table:</p> | + | <div class="box"> |
- | | + | ==''Bacillus'' Promoters [[File:LMU PromoterIconBC.png|100px]]== |
- | | + | {| "width=100%" style="align:right"| |
- | {| class="colored" | + | |
- | |- | + | |
- | !Number
| + | |
- | !Insertion locus
| + | |
- | !Letter
| + | |
- | !Resistance
| + | |
- | |-
| + | |
- | !0
| + | |
- | |replicative
| + | |
- | !C
| + | |
- | |Chloramphenicol (Cm)
| + | |
- | |-
| + | |
- | !1
| + | |
- | |''amyE'' (amylase)
| + | |
- | !E
| + | |
- | |MLS (Erythromycin + Lincomycin)
| + | |
- | |-
| + | |
- | !2
| + | |
- | |''lacA'' (β-galactosidase)
| + | |
- | !K
| + | |
- | |Kanamycin (Kan)
| + | |
- | |-
| + | |
- | !3
| + | |
- | |''sacA'' (sucrase)
| + | |
- | !S
| + | |
- | |Spectinomycin (Spec)
| + | |
- | |-
| + | |
- | !4
| + | |
- | |''thrC'' (threonine synthase)
| + | |
| | | | | |
| + | <p align="justify">To provide a set of promoters of different strength we characterized several promoters in ''Bacillus subtilis''. Both constitutive and inducible promoters are covered.</p> |
| | | | | |
| + | [[File:Promoters overview.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Promoters]] |
| |- | | |- |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Promoters]] |
| + | |} |
| + | </div> |
| | | |
| + | <div class="box"> |
| + | ==''Bacillus'' Reporters [[File:LMU Reporter.png|50px]]== |
| + | {| "width=100%" style="align:right"| |
| + | | |
| + | <p align="justify">We designed and codon-optimized a set of reporters that are commonly used in ''B. subtilis''.</p> |
| + | | |
| + | [[File:LMU GFP.jpg|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Reporters]] |
| |- | | |- |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Reporters]] |
| |} | | |} |
| + | </div> |
| | | |
- | | + | <div class="box"> |
- | The concentrations of the antibiotics and the insertion tests can be found in our [https://2012.igem.org/Team:LMU-Munich/Lab_Notebook/Protocols Protocol] section.
| + | ==Affinity Tags [[File:Proteinaffinitytagbutton.png|50px]]== |
- | | + | {| "width=100%" style="align:right"| |
- | See [[Team:LMU-Munich/Bacillus_BioBricks/vector_use| here]] to find out how to use ''B. subtilis'' vectors. In this [[Team:LMU-Munich/Bacillus_BioBricks/integration|overview]], the mechanism of integration ''B. subtilis'' vectors is described.
| + | | |
- | | + | <p align="justify">We synthesized 5 affinity tags for protein purification. They all are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags.</p> |
- | The design and special use of our Sporovector can be found [[Team:LMU-Munich/Bacillus_BioBricks/Sporovector |here]].
| + | |
- | | + | |
- | For results, check our data page: [[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Data/Vectors]]
| + | |
- | | + | |
- | | + | |
- | ==''Bacillus'' Promoters [[File:LMU PromoterIconBC.png|100px]]== | + | |
- | | + | |
- | <p align="justify">To get a set of promoters with different strength we characterized several promoters in ''Bacillus subtilis''. They can be divided in three different groups: the constitutive promoters from the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] from the Partsregistry, the constitutive promoters P<sub>''liaG''</sub>, P<sub>''veg''</sub> and P<sub>''lepA''</sub> from ''B. subtilis'', and the inducible promoters P<sub>''liaI''</sub> and P<sub>''xyl''</sub>-''XylR'' from ''B. subtilis''. For the characterization of the different promoters we used the ''lux'' operon [[File:Lux operon.png|100px]] where gene expression leads to the production of luminescence. For this promoter evaluation the reporter vector pSB<sub>''Bs''</sub>3C-''luxABCDE'' was used which was not fully in BioBrickStandard in this time because of one last forbidden restriction site. We also used the reporter gene ''lacZ'' [[File:LacZ.png|50px]] for the promoter evaluation where the promoter activity can be measured by doing β-galactosidase assays. Therefore we used the reporter vector pSB<sub>''Bs''</sub>1C-''lacZ''. See this page for an overview and background information of all evaluated promoters and see the [https://2012.igem.org/Team:LMU-Munich/Data Data] page for more details.</p>
| + | |
- | | + | |
- | ====Overview of several evaluated promoters====
| + | |
- | | + | |
- | <p align="justify">Here you can get an overview of all evaluated promoters which cover a large range of activity. For more details and for informations for the experiments see the [https://2012.igem.org/Team:LMU-Munich/Data Data] page of the promoters. Note that P<sub>''veg''</sub> was not evaluated with luminescence measurements and this bar is just projected from the results of the beta-galactosidase assay.</p> | + | |
- | <br>
| + | |
- | | + | |
- | {| style="color:black;" cellpadding="3" width="70%" cellspacing="0" border="0" align="center" style="text-align:left;"
| + | |
- | | style="width: 70%;background-color: #EBFCE4;" |
| + | |
- | {|
| + | |
- | |[[File:Promoters overview.png|thumb|center|600px]]
| + | |
| |- | | |- |
- | | style="width: 70%;background-color: #EBFCE4;" |
| + | ! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Tags]] |
- | {| style="color:black;" cellpadding="0" width="70%" cellspacing="0" border="0" align="center" style="text-align:center;"
| + | |
- | |style="width: 70%;background-color: #EBFCE4;" | | + | |
- | <font color="#000000"; size="2"><p align="justify"> '''Overview of promoter activity measured with luminescence measurements.''' These values derive from the experiments you can find in our Data section. Lumi per OD<sub>''600''</sub> are taken at a OD<sub>600</sub> of 0,1. Curves are the average and the standard deviation of two independent clones. Shown is the activity of the Anderson promoters J23100 (#100), J23101 (#101), J23102 (#102), J23103 (#103), J23106 (#106), J23107 (#107), J23113 (#113), J23114 (#114), J23115 (#115), J23117 (#117), J23118 (#118) as well as the activity of the constitutive promoters P<sub>''liaG''</sub>, and P<sub>''lepA''</sub>. The activity of the inducible promoter P<sub>''liaI''</sub> is shown with (+bac) and without (-bac) induction with bacitracin (10 μg/ml). The promoter activity of P<sub>''veg''</sub> is projected from the results from the beta-galactosidase assay and was not measured with luminescence measurements. </p></font>
| + | |
| |} | | |} |
- | | + | </div> |
- | ====Anderson promoters====
| + | |
- | </p> | + | |
- | <p align="justify">The first group of promoters evaluated are the promoters of the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] (''"Anderson promoters"''). They have already been measured in ''Escherichia coli'' where they all showed a constitutive behavior with a different strength. In this project, eleven Anderson promoters were characterized in ''B. subtilis'' with the ''lux'' operon as a reporter. In this evaluation in ''B. subtilis'' they showed quiet a low activity (see [https://2012.igem.org/Team:LMU-Munich/Data/Anderson Data Anderson promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Anderson]]).
| + | |
- | To confirm this result some Anderson promoters were also evaluated with the reporter gene ''lacZ'' by doing β-galactosidase assays (see [https://2012.igem.org/Team:LMU-Munich/Data/Anderson Data Anderson promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Anderson]]).</p>
| + | |
- | | + | |
- | | + | |
- | *'''J23100''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823004 BioBrick:BBa_K823004])
| + | |
- | *'''J23101''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823005 BioBrick:BBa_K823005])
| + | |
- | *'''J23102''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823006 BioBrick:BBa_K823006])
| + | |
- | *'''J23103''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823007 BioBrick:BBa_K823007])
| + | |
- | *'''J23106''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823008 BioBrick:BBa_K823008])
| + | |
- | *'''J23107''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823009 BioBrick:BBa_K823009])
| + | |
- | *'''J23113''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823010 BioBrick:BBa_K823010])
| + | |
- | *'''J23114''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823011 BioBrick:BBa_K823011])
| + | |
- | *'''J23115''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823012 BioBrick:BBa_K823012])
| + | |
- | *'''J23117''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823013 BioBrick:BBa_K823013])
| + | |
- | *'''J23118''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823014 BioBrick:BBa_K823014])
| + | |
- | <p align="justify"></p>
| + | |
- | | + | |
- | | + | |
- | ====Constitutive promoters from ''B. subtilis''====
| + | |
- | | + | |
- | <p align="justify">The second group of promoters charaterized are the constitutive promoters from ''B. subtilis''. We evaluated the promoters P<sub>''liaG''</sub>, P<sub>''veg''</sub> and P<sub>''lepA''</sub>. Therefore we used the ''lux'' operon as reporter as well as the ''lacZ'' gene.</p>
| + | |
- | | + | |
- | | + | |
- | *'''P<sub>''liaG''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823000 BioBrick:BBa_K823000])
| + | |
- | <p align="justify">P<sub>''liaG''</sub> is a weak, constitutive promoter from ''B. subtilis''. It is responsible for the transcription of the last four genes of the ''liaIHGFSR'' locus and therefore for the production of the components of the LiaRS system, which is important for the detection of cell wall antibiotics [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan ''et al.'', 2006)]. P<sub>''liaG''</sub> was evaluated with the ''lux'' operon as reporter (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive Data constitutive promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive]]) and the reporter ''lacZ'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive Data constitutive promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive]]). This promoter showed a much higher activity than the Anderson promoters which was still weak in comparison to the other evaluated ''Bacillus'' promoters. </p>
| + | |
- | | + | |
- | | + | |
- | *'''P<sub>''veg''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823003 BioBrick:BBa_K823003])
| + | |
- | <p align="justify">P<sub>''veg''</sub> is known to show a strong constitutive activity during the vegetative growth phase and sporulation phase. This promoter is important for the transcription of the veg gene, which plays an important role during sporulation [http://www.ncbi.nlm.nih.gov/pubmed?term=J.%20Biochem.%2C%20133%20%284%29%3A%20475%E2%80%93483: (Fukushima ''et al.'', 2003)]. P<sub>''veg''</sub> was measured by using reporter gene ''lacZ'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive Data constitutive promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive]]). This promoter was the strongest of our evaluated promoters. </p>
| + | |
- |
| + | |
- | | + | |
- | *'''P<sub>''lepA''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823002 BioBrick:BBa_K823002])
| + | |
- | <p align="justify"> P<sub>''lepA''</sub> is constitutive promoter which is important for the transcription of a bicistronic operon. One of the expressed proteins is the protein PlepA [http://www.ncbi.nlm.nih.gov/pubmed?term=Microbiology%2C%20142%3A%201641%E2%80%931649: (Homuth ''et al.'', 1996)]. This protein plays an important role during the translation as it can move the mRNA-tRNA complex one step back in the ribosome which is expected to improve the fidelity of translation [http://www.ncbi.nlm.nih.gov/pubmed?term=Cell%2C%20127%20%284%29%3A%20721%E2%80%93733: (Qin ''et al.'', 2006)]. This promoter was evaluated with the ''lux operon'' as a reporter (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive Data constitutive promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive]]). The activity of this promoter is between the activity of the strongest promoter P<sub>''veg''</sub> and the weak ''Bacillus'' promoter P<sub>''liaG''</sub>. </p>
| + | |
- | | + | |
- | | + | |
- | ====Inducible promoters from ''B. subtilis''====
| + | |
- | | + | |
- | <p align="justify">The last group of promoters consists of two inducible promoters of ''B. subtilis'' , P''<sub>liaI</sub>'' and P''<sub>xyl</sub>''-''XylR''. They are useful to decide when to turn on gene expression because these promoters need an inducer to start transcription. They are evaluated with the reporters ''lux'' and ''lacZ''.</p>
| + | |
- | | + | |
- | | + | |
- | *'''P<sub>''liaI''</sub>''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823001 BioBrick:BBa_K823001])
| + | |
- | <p align="justify">P''<sub>liaI</sub>'' is an inducible promoter from ''B. subtilis'' which is induced by antibiotics that interact with the lipidII cycle, e.g. bacitracin. If the cell senses stress there is a phosphorylation of the two proteins LiaS and LiaR. LiaR binds to the operator of the promoter and induces the transcription. When the promoter is turned on the two proteins LiaI and LiaH are expressed which play an important role in the stress response [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan ''et al.'', 2006)]. This promoter is evaluated with the reporter ''lux'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Inducible Data inducible promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Inducible]]) as well as ''lacZ'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Inducible Data inducible promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Inducible]]). The induction was measured with different concentrations of bacitracin. With induction with different concentrations of bacitracin this promoter covers a large range of activity.</p>
| + | |
- | | + | |
- | | + | |
- | *'''P<sub>''Xyl''</sub>-''XylR''''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K8230015 BioBrick:BBa_K823015])
| + | |
- | <p align="justify">P<sub>''Xyl''</sub>-''XylR'' is a inducible promoter from ''B. subtilis'' which is induced by xylose. XylR is constitutively expressed, and is the repressor of P<sub>''Xyl''</sub> in absence of the sugar Xylose. In presence of Xylose, XylR leaves the operator and the P<sub>''Xyl''</sub> is active (see e.g. [http://www.ncbi.nlm.nih.gov/pubmed/2544559 Kreuzer et al.]). For this promoter we have not yet suceeded cloning it in the reporter vector to evaluate the activity. So there is not any data for this promoter yet.</p>
| + | |
| <br> | | <br> |
- |
| |
- | ==''Bacillus'' Reporters [[File:LMU Reporter.png|50px]]==
| |
- |
| |
- | <p align="justify">
| |
- | We designed some reporters that are commonly used in ''B. subtilis'' or are codon optimized versions of popular reporter genes. All reporters have a modified iGEM Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RCF 25]) pre- and suffix for assembly of in-frame fusion proteins. Our prefix also includes the ''B. subitlis'' optimized RBS. </p>
| |
- |
| |
- | prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
| |
- |
| |
- | suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
| |
- |
| |
- |
| |
- | *'''GFP''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823039 BioBrick:BBa_K823039])
| |
- | <p align="justify">[[Image:LMU Firstspore.jpg|200px|left]]We took a ''gfp'' derivate of the ''Bacillus subtilis'' plasmids pGFPamy and added the BioBrick compatiple pre- and suffix of the Freiburg standard (Assembly 25). This BioBrick was used to create our [https://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins '''Sporo'''beads].</p>
| |
| <br> | | <br> |
| <br> | | <br> |
| <br> | | <br> |
- |
| |
- |
| |
- | *'''mKate2''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029])
| |
- | [[File:MKate Pellet.JPG|<p align="justify">'''''mKate2'' fused to the terminator B0014 under the control of the Anderson promoter J23101 (up), P<sub>''liaI''</sub> (middle) and P<sub>''lepA''</sub> (down) in pSB<sub>''Bs''</sub>1C.''' Pellets are ''Escherichia coli'' cells which contain the plasmid with the right insert.</p>|thumb|300px|left]]
| |
- | <p align="justify">We synthesized this monomeric far-red fluorescence protein with a codon-optimized version for the use in ''B. subtilis'' with pre- and suffix of the Freiburg standard. We cloned this reporter in front of the terminator B0014. For the evaluation this reporter was successfully combined with the promoters P<sub>''liaI''</sub>, P<sub>''lepA''</sub> and the Anderson promoter J23101 in the empty ''Bacillus'' vector pSB<sub>''Bs''</sub>1C from our '''''Bacillus''B'''io'''B'''rick'''B'''ox. At the moment we have the right clones of ''B. subtilis'' with the integrated construct. Unfortunately we have no equipment to measure this reporter. Neither our plate reader nor the fluorescent microscope have the required filters.</p>
| |
- |
| |
- |
| |
- |
| |
- | *'''LacZ''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823019 BioBrick:BBa_K823019])
| |
- | [[File:LacZ plate.png|<p align="justify">''lacZ'' under the control of P<sub>''spac''</sub> in pSB<sub>Bs</sub>0K-P<sub>''spac''</sub>. Plate induced with IPTG</p>|thumb|300px|left]]
| |
- |
| |
- | <p align="justify">This ''lacZ'' gene is derived from the ''Bacillus'' reporter vector pAC6. It is constructed in the Freiburg Standard (Assembly 25) for in-frame fusion proteins. It also includes a Shine-Dalgarno Sequence optimized for ''Bacillus subtilis'' translation. This ''lacZ'' BioBrick was tested in the expression vector pSB<sub>Bs</sub>0K-P<sub>''spac''</sub>. This construct showed a high activity, so this BioBrick should work. See [https://2012.igem.org/Team:LMU-Munich/Data/Vectors Data] in the vector evaluation section of pSB<sub>Bs</sub>0K-P<sub>''spac''</sub>.</p>
| |
- |
| |
- |
| |
- |
| |
- | *'''luc''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823028 BioBrick:BBa_K823028])
| |
- | <p align="justify">
| |
- | This is the <i>luc</i> monomeric firefly luciferase which needs a special substrate to produce luminescence. With Ribosome binding site included, codon optimized for <i>Bacillus subtilis</i> and synthesized by gene art. It was used in <i>B. subtilis</i> before ([http://www.ncbi.nlm.nih.gov/pubmed/21552330 Mirouze et al. 2011]).
| |
- | </p>
| |
- | <p align="justify">
| |
- | Firefly luciferase is by far the most commonly used bioluminescent reporter. This monomeric enzyme of 61kDa catalyzes a two-step oxidation reaction to yield light, usually in the green to yellow region, typically 550–570nm . The first step is activation of the luciferyl carboxylate by ATP to yield a reactive mixed anhydride. In the second step, this activated intermediate reacts with oxygen to create a transient dioxetane that breaks down to the oxidized products, oxyluciferin and CO<sub>2</sub>. Upon mixing with substrates, firefly luciferase produces an initial burst of light that decays over about 15 seconds to a low level of sustained luminescence. This kinetic profile reflects the slow release of the enzymatic product, thus limiting catalytic turnover after the initial reaction.
| |
- | </p>
| |
- | <p align="justify">
| |
- | The popularity of native firefly luciferase as a genetic reporter is due to the sensitivity and convenience of the enzyme assay and tight coupling of protein synthesis with enzyme activity. Firefly luciferase, which is encoded by the luc gene, is a monomer that does not require any post-translational modifications; it is available as a mature enzyme directly upon translation of its mRNA. Catalytic competence is attained immediately after release from the ribosome. Also, luciferase has a very short half-life in cells (approximately 3 hours). Combined, these properties make luciferase an extremely responsive reporter, far more so than other commonly used reporters.
| |
- | </p>
| |
- | [[File:Luciferin reaction mod.png|thumb|center|500px]]
| |
- |
| |
- | Reference:[http://www.promega.com/resources/product-guides-and-selectors/protocols-and-applications-guide/bioluminescent-reporters/ Promega]
| |
- |
| |
- |
| |
- |
| |
- |
| |
- | ==Affinity Tags [[File:Proteinaffinitytagbutton.png|50px]]==
| |
- |
| |
- |
| |
- | <p align="justify">
| |
- | All our tags have been synthesized by gene art. They are designed in Freiburg standard with an included optimized ribosome binding site. We have not tested our tags, yet. </p>
| |
- |
| |
- | prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
| |
- |
| |
- | suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
| |
- |
| |
- |
| |
- | *'''3x Flag - tag''' [http://partsregistry.org/Part:BBa_K823034 (BioBrick:BBa_K823034)]
| |
- |
| |
- | <p align="justify">
| |
- | The Flag-tag was the first epitope tag to be published ([http://www.nature.com/nbt/journal/v6/n10/full/nbt1088-1204.html T.P. Hopp, K.S. Prickett et al. (1988)]). It consists of eight hydrophobic aminoacids: DYKDDDDK and the 3x Flag tag is: <b>DYKDHDGDYKDHDIDYKDDDDK</b>. There are a variety of monoclonal antibodies against this tag, N-terminal as well as position insensitive.</p>
| |
- |
| |
- |
| |
- | *'''HA - tag''' [http://partsregistry.org/Part:BBa_K823035 (BioBrick:BBa_K823035)]
| |
- |
| |
- | <p align="justify">
| |
- | The HA-tag is an epitope derived from the HA-virus. There was first an antibody against it and then the epitope was characterized ([http://www.ncbi.nlm.nih.gov/pubmed/6204768 Wilson, I.A. et al. (1984)]). It was then furthermore used as a tag for protein purification and recognition ([http://www.ncbi.nlm.nih.gov/pubmed/2455217 Field, J. et al. (1988)]). The aminoacid sequence is: <b>YPYDVPDYA</b>.</p>
| |
- |
| |
- |
| |
- | *'''cMyc - tag''' [http://partsregistry.org/Part:BBa_K823036 (BioBrick:BBa_K823036)]
| |
- |
| |
- | <p align="justify">
| |
- | The cMyc-tag is a tag derived from the cMyc gene product. Antibodies were derived from the immunisation with synthetic peptides from the cMyc sequence [http://mcb.asm.org/content/5/12/3610.short Mol. Cell. Biol. 5,3610-3616]). The aminoacid sequence is <b>EQKLISEEDL</b>.</p>
| |
- |
| |
- |
| |
- | *'''His - tag''' [http://partsregistry.org/Part:BBa_K823037 (BioBrick:BBa_K823037)]
| |
- |
| |
- | <p align="justify">
| |
- | The His-tag is a metal chelating peptide ([http://www.nature.com/nbt/journal/v6/n11/full/nbt1188-1321.html Hochuli, E.; Bannwarth, W.; Döbeli, H.; Gentz, R.; Stüber, D. (1988)]) consisting of at least 6 histidins. It can therefore be used for protein purification by metal 2+ (mostly nickel or cobalt) containing columns. There are also antibodies against this tag, or nickel/cobalt containing fluorescent probes can be used for detection. Also a immobilization is possible in nickel/cobalt coated plastikware.
| |
- | The aminoacid sequence is:<b>HHHHHHHHHH</b></p>
| |
- |
| |
- |
| |
- | *'''Strep - tag''' [http://partsregistry.org/Part:BBa_K823038 (BioBrick:BBa_K823038)]
| |
- |
| |
- | <p align="justify">
| |
- | The Strep-tag is a mimicry peptide of biotin which binds to Streptavidin ([http://www.sciencedirect.com/science/article/pii/S1050386299000339 Skerra, A. and Schmidt, T.G.M. (1999)]). Its sequence is <b>WSHPQFEK</b>. It can be used for protein purification, immobilisation with Streptavidin or Strep-tactin ([http://www.ncbi.nlm.nih.gov/pubmed/9415448 Voss, S. and Skerra, A. (1997)]) or detection with Strep-tactin or antibodies.</p>
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
- |
| |
| <div class="box"> | | <div class="box"> |
| ====Project Navigation==== | | ====Project Navigation==== |