Team:LMU-Munich/Bacillus BioBricks

From 2012.igem.org

(Difference between revisions)
 
(152 intermediate revisions not shown)
Line 1: Line 1:
<!-- Include the next line at the beginning of every page -->
<!-- Include the next line at the beginning of every page -->
{{:Team:LMU-Munich/Templates/Page Header|File:Team-LMU_culture_tubes.resized.jpg|3}}
{{:Team:LMU-Munich/Templates/Page Header|File:Team-LMU_culture_tubes.resized.jpg|3}}
-
[[File:BBB_banner.jpg|620px|link=]]
+
[[File:Bacillus BioBrick Box banner.resized WORDS.JPG|620px|link=]]
-
[[Image:BacillusBioBrickBox.png|100px|right|link=Team:LMU-Munich/Team:LMU-Munich/Bacillus_BioBricks]]
+
[[Image:BacillusBioBrickBox.png|100px|right|link=]]
-
==''Bacillus''BioBrickBox==
 
-
 
+
=='''B<sup>4</sup>''' - 22 core parts for ''Bacillus subtilis''==
-
We will create a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry.
+
<br>
-
 
+
<p align="justify">A major goal of our iGEM project is to [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction introduce ''B. subtilis''] as a new chassis for BioBrick-based synthetic biology. For that purpose, we created a toolbox of <i>Bacillus</i> BioBricks to contribute to the registry to make it accessible to many more future iGEM-teams and the entire public microbiology domain! This ''<b>Bacillus'' B</b>io<b>B</b>rick <b>B</b>ox ('''B<sup>4</sup>''') contains the following ''Bacillus'' specific parts:</p>
-
This ''<b>Bacillus''B</b>io<b>B</b>rick<b>B</b>ox contains ''Bacillus'' specific parts:
+
Line 18: Line 16:
{| width="100%"
{| width="100%"
-
| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]'''
+
| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Vectors|Vectors]]'''
-
| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Promoters|Promoters]]'''
+
| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Promoters|Promoters]]'''
-
| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Reporters|Reporters]]'''
+
| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Reporters|Reporters]]'''
-
| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks#Affinity_Tags|Affinity tags]]
+
| style="width:20%"|'''[[Team:LMU-Munich/Bacillus_BioBricks/Tags|Affinity tags]]
|-
|-
|[[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]
|[[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]
Line 29: Line 27:
|-
|-
|valign="top"|<font size="2">
|valign="top"|<font size="2">
-
pSB<sub>''Bs''</sub>1C<br>pSB<sub>''Bs''</sub>4S<br>pSB<sub>''Bs''</sub>2E<br>pSB<sub>''Bs''</sub>1C-''lac''Z<br>pSB<sub>''Bs''</sub>3C-''lux''ABCDE<br>pSB<sub>''Bs''</sub>4S-P<sub>''Xyl''</sub><br>pSB<sub>''Bs''</sub>0K-P<sub>''spac''</sub><br>'''Sporo'''vector</font>
+
pSB<sub>''Bs''</sub>1C<br>
 +
pSB<sub>''Bs''</sub>4S<br>
 +
pSB<sub>''Bs''</sub>2E<br>
 +
pSB<sub>''Bs''</sub>1C-''lac''Z<br>
 +
pSB<sub>''Bs''</sub>3C-''lux''ABCDE<br>
 +
pSB<sub>''Bs''</sub>4S-P<sub>''xyl''</sub><br>
 +
pSB<sub>''Bs''</sub>0K-P<sub>''spac''</sub><br>
 +
'''Sporo'''vector</font>
|valign="top"|<font size="2">
|valign="top"|<font size="2">
-
Anderson<br>P<sub>''liaG''</sub><br>P<sub>''veg''</sub><br>P<sub>''lepA''</sub><br>P<sub>''liaI''</sub><br>P<sub>''xyl''</sub>-XylR</font>
+
Anderson<br>
 +
P<sub>''liaG''</sub><br>
 +
P<sub>''veg''</sub><br>
 +
P<sub>''lepA''</sub><br>
 +
P<sub>''liaI''</sub><br>
 +
''xylR''-P<sub>''xyl''</sub></font>
|valign="top"|<font size="2">
|valign="top"|<font size="2">
-
''GFP''<br>''mkate2''<br>''lacZ''<br>''luc''<br></font>
+
''gfp''<br>
 +
''mkate2''<br>
 +
''lacZ''<br>
 +
''luc+''<br></font>
|valign="top"|<font size="2">
|valign="top"|<font size="2">
Flag<br>His<br>cMyc<br>Strep<br>HA</font>
Flag<br>His<br>cMyc<br>Strep<br>HA</font>
Line 41: Line 54:
-
==''Bacillus'' Vectors  [[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]==
+
 
 +
[[File:NEXT.png|right|80px|link=Team:LMU-Munich/Germination_Stop]] [[File:BACK.png|left|80px|link=Team:LMU-Munich/Data/differentiation_tour]]
-
<p align="justify">Here is a list of all the vectors we cloned and used. Please note that pMAD is not in a BioBrick standard, but it is a useful tool to knock out genes in ''Bacillus subtilis''.</p>
 
-
<p align="justify">For the use of our vectors, please see our [[Team:LMU-Munich/Lab_Notebook/Protocols|Protocols]] page. A general introduction to ''Bacillus subtilis'' and its integrative vectors can be found [[Team:LMU-Munich/Bacillus Introduction|here]]. All vectors have ampicillin as <i>Escherichia coli</i> resistance and RFP in the multiple cloning site as selection marker.</p>
 
-
{| class="colored"
 
-
|-
 
-
!Name BioBrick
 
-
!''E. coli'' res.
 
-
!''B. subt.'' res.
 
-
!Insertion locus
 
-
!Description
 
-
!Derived from
 
-
!Reference
 
-
|-
 
-
!pSB<sub>''Bs''</sub>1C [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823023 <font color="#EBFCE4" size="2">(BBa_K823023)</font>]
 
-
|Amp
 
-
|Cm
 
-
|''amyE''
 
-
|empty
 
-
|pDG1662
 
-
|[http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury ''et al.'']
 
-
|-
 
-
!pSB<sub>''Bs''</sub>4S [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823022 <font color="#EBFCE4" size="2">(BBa_K823022)</font>]
 
-
|Amp
 
-
|Spec
 
-
|''thrC''
 
-
|empty
 
-
|pDG1731
 
-
|[http://www.ncbi.nlm.nih.gov/pubmed/8973347 Guérout-Fleury ''et al.'']
 
-
|-
 
-
!pSB<sub>''Bs''</sub>2E [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823027 <font color="#EBFCE4" size="2">(BBa_K823027)</font>]
 
-
|Amp
 
-
|MLS
 
-
|''lacA''
 
-
|empty
 
-
|pAX01
 
-
|[http://www.ncbi.nlm.nih.gov/pubmed/11274134 Härtl ''et al.'']
 
-
|-
 
-
!pSB<sub>''Bs''</sub>1C-<i>lac</i>Z [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823021 <font color="#EBFCE4" size="2">(BBa_K823021) </font>]
 
-
|Amp
 
-
|Cm
 
-
|''amyE''
 
-
|with <i>lacZ</i> reporter gene
 
-
|pAC6
 
-
|[http://www.ncbi.nlm.nih.gov/pubmed/11902727 Stülke ''et al''.]
 
-
|-
 
-
!pSB<sub>''Bs''</sub>3C-<i>lux</i>ABCDE [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823025 <font color="#EBFCE4" size="2">(BBa_K823025)</font>]
 
-
|Amp
 
-
|Cm
 
-
|''sacA''
 
-
|with <i>luxABCDE</i> reporter cassette
 
-
|pAH328
 
-
|[http://www.ncbi.nlm.nih.gov/pubmed/20709900 Schmalisch ''et al''.]
 
-
|-
 
-
!pSB<sub>''Bs''</sub>4S-P<sub><i>Xyl</i></sub> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823024 <font color="#EBFCE4" size="2">(BBa_K823024)</font>]
 
-
|Amp
 
-
|Spec
 
-
|''thrC''
 
-
|with Xylose-inducible promoter
 
-
|pXT
 
-
|[http://www.ncbi.nlm.nih.gov/pubmed/11069659 Derré ''et al.'']
 
-
|-
 
-
!pSB<sub>''Bs''</sub>0K-P<sub><i>spac</i></sub> [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823026 <font color="#EBFCE4" size="2">(BBa_K823026)</font>]
 
-
|Amp
 
-
|Kan
 
-
|replicative
 
-
|with IPTG inducible promoter
 
-
|pDG148
 
-
|[http://www.ncbi.nlm.nih.gov/pubmed/11728721 Joseph ''et al.'']
 
-
|-
 
-
!'''Sporo'''vector [http://partsregistry.org/wiki/index.php?title=Part:BBa_K823054 <font color="#EBFCE4" size="2">(BBa_K823054)</font>]
 
-
|Amp
 
-
|Spec
 
-
|''thrC''
 
-
|to create [https://2012.igem.org/Team:LMU-Munich/Spore_Coat_Proteins '''Sporo'''beads]
 
-
|pSB<sub>Bs</sub>4S
 
-
|
 
-
|-
 
-
|}
 
-
Here you can find the respective vector maps:
 
-
{|
+
<p align="justify">Since ''Bacillus subtilis'' is not an organism commonly used in iGEM, please check out our [https://2012.igem.org/Team:LMU-Munich/Bacillus_Introduction Introduction] to learn more about it.</p>
-
|<html> <a> <img src="https://static.igem.org/mediawiki/2012/e/e0/LMU-Munich-PSBBs1C.png" height=130"/></a></html>  
+
 
-
|<html> <a> <img src="https://static.igem.org/mediawiki/2012/2/2a/LMU-Munich-PSBBs4S.png" height=130"/></a></html>
+
<div class="box">
 +
==''Bacillus'' Vectors  [[File:LMU Backbone.png|100px|link=Team:LMU-Munich/Bacillus_BioBricks#Bacillus_Vectors|Vectors]]==
 +
{| "width=100%" style="text-align:center;" style="align:right"|
 +
|<p align="justify">We have generated a suite of BioBrick-compatible vectors: three empty insertional backbones with different antibiotic resistances and integration loci, two reporter and two expression vectors.</p>
 +
|[[File:LMU-Munich-PSBBs1C.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Vectors]]
|-
|-
-
|<html> <a> <img src="https://static.igem.org/mediawiki/2012/4/46/LMU-Munich-PSBBs2E.png" height=130"/></a></html>
+
! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Vectors]]
-
|<html> <a> <img src="https://static.igem.org/mediawiki/2012/0/04/LMU-Munich-PSBBs1C-lacZ.png" height=130"/></a></html>
+
|}
-
|-
+
</div>
-
|<html> <a> <img src="https://static.igem.org/mediawiki/2012/f/fc/LMU-Munich-PSBBs3C-luxABCDE.png" height=130"/></a></html>
+
 
-
|<html> <a> <img src="https://static.igem.org/mediawiki/2012/d/de/LMU-Munich-PSBBs4S-Pxyl.png" height=130"/></a></html>
+
<div class="box">
-
|-
+
==''Bacillus'' Promoters  [[File:LMU PromoterIconBC.png|100px]]==  
-
|<html> <a> <img src="https://static.igem.org/mediawiki/2012/0/03/LMU-Munich-PSBBs0K-Pspac.png" height=130"/></a></html>
+
{| "width=100%" style="align:right"|
-
|<html> <a> <img src="https://static.igem.org/mediawiki/2012/a/ab/LMU-Munich-Sporovector.png" height=130"/></a></html>
+
|
 +
<p align="justify">To provide a set of promoters of different strength we characterized several promoters in ''Bacillus subtilis''. Both constitutive and inducible promoters are covered.</p>
 +
|
 +
[[File:Promoters overview.png|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Promoters]]
|-
|-
 +
! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Promoters]]
|}
|}
 +
</div>
-
<p align="justify">The number in the vector's name codes for the insertion locus and the following letter for the <i> Bacillus subtilis </i> resistance gene according to the following table:</p>
+
<div class="box">
-
 
+
==''Bacillus'' Reporters  [[File:LMU Reporter.png|50px]]==
-
 
+
{| "width=100%" style="align:right"|
-
{| class="colored"
+
-
|-
+
-
!Number
+
-
!Insertion locus
+
-
!Letter
+
-
!Resistance
+
-
|-
+
-
!0
+
-
|replicative
+
-
!C
+
-
|Chloramphenicol (Cm)
+
-
|-
+
-
!1
+
-
|''amyE'' (amylase)
+
-
!E
+
-
|MLS (Erythromycin + Lincomycin)
+
-
|-
+
-
!2
+
-
|''lacA'' (β-galactosidase)
+
-
!K
+
-
|Kanamycin (Kan)
+
-
|-
+
-
!3
+
-
|''sacA'' (sucrase)
+
-
!S
+
-
|Spectinomycin (Spec)
+
-
|-
+
-
!4
+
-
|''thrC'' (threonine C)
+
|
|
 +
<p align="justify">We designed and codon-optimized a set of reporters that are commonly used in ''B. subtilis''.</p>
|
|
 +
[[File:LMU GFP.jpg|200px|right|link=Team:LMU-Munich/Bacillus BioBricks/Reporters]]
|-
|-
 +
! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Reporters]]
 +
|}
 +
</div>
 +
<div class="box">
 +
==Affinity Tags  [[File:Proteinaffinitytagbutton.png|50px]]==
 +
{| "width=100%" style="align:right"|
 +
|
 +
<p align="justify">We synthesized 5 affinity tags for protein purification. They all are designed in Freiburg standard with an optimized ribosome binding site upstream. We have not yet tested our tags.</p>
|-
|-
 +
! colspan="2" |[[File:LMU Arrow purple.png|40px|link=Team:LMU-Munich/Bacillus BioBricks/Tags]]
|}
|}
-
 
+
</div>
-
 
+
<br>
-
The concentrations of the antibiotics and the insertion tests can be found in our [https://2012.igem.org/Team:LMU-Munich/Lab_Notebook/Protocols Protocol] section.
+
<br>
-
 
+
<br>
-
See [https://static.igem.org/mediawiki/2012/c/c4/LMU-Munich_2012_Bacillus_subtilis_vectors.pdf| here] to find out how to use ''B. subtilis'' vectors.
+
<br>
-
 
+
-
The design and special use of our Sporovector can be found [[Team:LMU-Munich/Bacillus_BioBricks/Sporovector |here]].
+
-
 
+
-
 
+
-
==''Bacillus'' Promoters  [[File:LMU PromoterIconBC.png|100px]]==
+
-
 
+
-
<p align="justify">To get a set of promoters with different strength we characterized several promoters in ''Bacillus subtilis''. They can be divided in three different groups: the constitutive promoters from the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] from the Partsregistry, the constitutive promoters P<sub>''liaG''</sub>, P<sub>''veg''</sub> and P<sub>''lepA''</sub> from ''B. subtilis'', and the inducible promoters P<sub>''liaI''</sub> and P<sub>''xyl''</sub>-''XylR'' from ''B. subtilis''. For the characterization of the different promoters we used the ''lux'' operon where gene expression leads to the production of luminescence. For this promoter evaluation the reporter vector pSB<sub>''Bs''</sub>3C-''luxABCDE'' was used which was not fully in BioBrickStandard in this time because of one last forbidden restriction site. We also used the reporter gene ''lacZ'' for the promoter evaluation where the promoter activity can be measured by doing β-galactosidase assays. Therefore we used the reporter vector pSB<sub>''Bs''</sub>1C-''lacZ''.</p>
+
-
 
+
-
 
+
-
====Anderson promoters====
+
-
 
+
-
<p align="justify">The first group of promoters evaluated are the promoters of the [http://partsregistry.org/Part:BBa_J23100 Anderson collection] which we call ''Anderson promoters''. They have already been measured in ''Escherichia coli'' where they all showed a constitutive behavior with a different strength. In this project, eleven Anderson promoters were characterized in ''B. subtilis'' with the ''lux'' operon as a reporter. In this evaluation in ''B. subtilis'' they showed quiet a low activity (see [https://2012.igem.org/Team:LMU-Munich/Data/Anderson Data Anderson promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Anderson]]). To confirm this result some Anderson promoters were also evaluated with the reporter gene ''lacZ'' by doing β-galactosidase assays (see [https://2012.igem.org/Team:LMU-Munich/Data/Anderson Data Anderson promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Anderson]]).</p>
+
-
 
+
-
 
+
-
*'''J23100'''  ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823004 BioBrick:BBa_K823004])
+
-
*'''J23101'''  ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823005 BioBrick:BBa_K823005])
+
-
*'''J23102'''  ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823006 BioBrick:BBa_K823006])
+
-
*'''J23103'''  ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823007 BioBrick:BBa_K823007])
+
-
*'''J23106'''  ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823008 BioBrick:BBa_K823008])
+
-
*'''J23107'''  ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823009 BioBrick:BBa_K823009])
+
-
*'''J23113'''  ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823010 BioBrick:BBa_K823010])
+
-
*'''J23114'''  ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823011 BioBrick:BBa_K823011])
+
-
*'''J23115'''  ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823012 BioBrick:BBa_K823012])
+
-
*'''J23117'''  ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823013 BioBrick:BBa_K823013])
+
-
*'''J23118'''  ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823014 BioBrick:BBa_K823014])
+
-
<p align="justify"></p>
+
-
 
+
-
 
+
-
====Constitutive promoters from ''B. subtilis''====
+
-
 
+
-
<p align="justify">The second group of promoters charaterized are the constitutive promoters from ''B. subtilis''. We evaluated the promoters P<sub>''liaG''</sub>, P<sub>''veg''</sub> and P<sub>''lepA''</sub>. Therefore we used the ''lux'' operon as reporter as well as the ''lacZ'' gene.</p>
+
-
 
+
-
 
+
-
*'''P<sub>''liaG''</sub>'''    ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823000 BioBrick:BBa_K823000])
+
-
<p align="justify">P<sub>''liaG''</sub> is a weak, constitutive promoter from ''B. subtilis''. It is responsible for the transcription of the last four genes of the ''liaIHGFSR'' locus and therefore for the production of the components of the LiaRS system, which is important for the detection of cell wall antibiotics [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan ''et al.'', 2006)]. P<sub>''liaG''</sub> was evaluated with the ''lux'' operon as reporter (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive Data constitutive promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive]]) and the reporter ''lacZ'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive Data constitutive promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive]]). This promoter showed a much higher activity than the Anderson promoters which was still weak in comparison to the other evaluated ''Bacillus'' promoters. </p>
+
-
 
+
-
 
+
-
*'''P<sub>''veg''</sub>'''    ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823003 BioBrick:BBa_K823003])
+
-
<p align="justify">P<sub>''veg''</sub> is known to show a strong constitutive activity during the vegetative growth phase and sporulation phase. This promoter is important for the transcription of the veg gene, which plays an important role during sporulation [http://www.ncbi.nlm.nih.gov/pubmed?term=J.%20Biochem.%2C%20133%20%284%29%3A%20475%E2%80%93483: (Fukushima ''et al.'', 2003)]. P<sub>''veg''</sub> was measured by using reporter gene ''lacZ'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive Data constitutive promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive]]). This promoter was the strongest of our evaluated promoters. </p>
+
-
+
-
 
+
-
*'''P<sub>''lepA''</sub>'''    ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823002 BioBrick:BBa_K823002])
+
-
<p align="justify"> P<sub>''lepA''</sub> is constitutive promoter which is important for the transcription of a bicistronic operon. One of the expressed proteins is the protein PlepA [http://www.ncbi.nlm.nih.gov/pubmed?term=Microbiology%2C%20142%3A%201641%E2%80%931649: (Homuth ''et al.'', 1996)]. This protein plays an important role during the translation as it can move the mRNA-tRNA complex one step back in the ribosome which is expected to improve the fidelity of translation [http://www.ncbi.nlm.nih.gov/pubmed?term=Cell%2C%20127%20%284%29%3A%20721%E2%80%93733: (Qin ''et al.'', 2006)]. This promoter was evaluated with the ''lux operon'' as a reporter (see [https://2012.igem.org/Team:LMU-Munich/Data/Constitutive Data constitutive promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Constitutive]]). The activity of this promoter is between the activity of the strongest promoter P<sub>''veg''</sub> and the weak ''Bacillus'' promoter P<sub>''liaG''</sub>. </p>
+
-
 
+
-
 
+
-
====Inducible promoters from ''B. subtilis''====
+
-
 
+
-
<p align="justify">The last group of promoters consists of two inducible promoters of ''B. subtilis'' , P''<sub>liaI</sub>'' and P''<sub>xyl</sub>''-''XylR''. They are useful to decide when to turn on gene expression because these promoters need an inducer to start transcription. They are evaluated with the reporters ''lux'' and ''lacZ''.</p>
+
-
 
+
-
 
+
-
*'''P<sub>''liaI''</sub>'''    ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823001 BioBrick:BBa_K823001])
+
-
<p align="justify">P''<sub>liaI</sub>'' is an inducible promoter from ''B. subtilis'' which is induced by antibiotics that interact with the lipidII cycle, e.g. bacitracin. If the cell senses stress there is a phosphorylation of the two proteins LiaS and LiaR. LiaR binds to the operator of the promoter and induces the transcription. When the promoter is turned on the two proteins LiaI and LiaH are expressed which play an important role in the stress response [http://www.ncbi.nlm.nih.gov/pubmed?term=Journal%20of%20Bacteriology%2C%20188%20%2814%29%3A%205153%E2%80%935166: (Jordan ''et al.'', 2006)]. This promoter is evaluated with the reporter ''lux'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Inducible Data inducible promoters] [[File:Lux operon.png|100px|link=https://2012.igem.org/Team:LMU-Munich/Data/Inducible]]) as well as ''lacZ'' (see [https://2012.igem.org/Team:LMU-Munich/Data/Inducible Data inducible promoters] [[File:LacZ.png|50px|link=https://2012.igem.org/Team:LMU-Munich/Data/Inducible]]). The induction was measured with different concentrations of bacitracin. With induction with different concentrations of bacitracin this promoter covers a large range of activity.</p>
+
-
 
+
-
 
+
-
*'''P<sub>''Xyl''</sub>-''XylR''''' ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K8230015 BioBrick:BBa_K823015])
+
-
<p align="justify">P<sub>''Xyl''</sub>-''XylR'' is a inducible promoter from ''B. subtilis'' which is induced by xylose. XylR is constitutively expressed, and is the repressor of P<sub>''Xyl''</sub> in absence of the sugar Xylose. In presence of Xylose, XylR leaves the operator and the P<sub>''Xyl''</sub> is active [see e.g. [http://www.ncbi.nlm.nih.gov/pubmed/2544559 Kreuzer et al.]. For this promoter we have not yet suceeded cloning it in the reporter vector to evaluate the activity. So there is not any data for this promoter yet.</p>
+
-
 
+
-
Here you can get an overview of the evaluated promoters which cover a large range of activity:
+
-
 
+
-
[[File:File:Promoter overview.png|thumb|right|400px| <p align="justify"> '''Overview of promoter activity measured with luminescence measurements.''' These values derive from the experiments you can find in our Data section. LUMI per OD<sub>''600''</sub> are taken at a OD600 of 0,1. Curves are the average and the standard deviation of two independent clones. Shown is the activity of the Anderson promoters J23115 (#115), J23106 (#106), J23100 (#100) and J23101 (#101) as well as the activity of the constitutive promoters PliaG and PlepA. The activity of the inducible promoter PliaI is shown with (+bac) and without (-bac) induction with bacitracin (10 μg/ml).]]
+
-
 
+
-
 
+
-
 
+
-
==''Bacillus'' Reporters  [[File:LMU Reporter.png|50px]]==
+
-
 
+
-
<p align="justify">We designed some reporters that are commonly used in ''B. subtilis'' or are codon optimized versions of popular reporter genes. All reporters have a modified iGEM Freiburg standard ([http://partsregistry.org/Help:Assembly_standard_25 RCF 25]) pre- and suffix for assembly of in-frame fusion proteins. Our prefix also includes the ''B. subitlis'' optimized RBS.</p>
+
-
 
+
-
prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
+
-
 
+
-
suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
+
-
 
+
-
 
+
-
*'''GFP'''        ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823039 BioBrick:BBa_K823039])
+
-
<p align="justify">We took a ''gfp'' derivate of the ''Bacillus subtilis'' plasmids pGFPamy and added the BioBrick compatiple pre- and suffix of the Freiburg standard (Assembly 25).</p>
+
-
 
+
-
 
+
-
 
+
-
*'''mKate2'''      ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823029 BioBrick:BBa_K823029])
+
-
<p align="justify">We synthesized this monomeric far-red fluorescence protein with a codon-optimized version for the use in ''B. subtilis'' with pre- and suffix of the Freiburg standard. We cloned this reporter in front of the terminator B0014. For the evaluation this reporter was successfully combined with the promoters PlepA, PliaI and J23101 in the empty ''Bacillus'' vector pSB<sub>''Bs''</sub>1C from our '''''Bacillus''B'''io'''B'''rick'''B'''ox. </p>
+
-
 
+
-
 
+
-
 
+
-
*'''LacZ'''      ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823019 BioBrick:BBa_K823019])
+
-
[[File:LacZ plate.png|''lacZ'' under the control of P<sub>''spac''</sub> in pSB<sub>Bs</sub>0K-P<sub>''spac''</sub>. Plate induced with IPTG|thumb|300px|left]]
+
-
 
+
-
<p align="justify">This ''lacZ'' gene is derived from the ''Bacillus'' reporter vector pAC6. It is constructed in the Freiburg Standard (Assembly 25) for in-frame fusion proteins. It also includes a Shine-Dalgarno Sequence optimized for ''Bacillus subtilis'' translation. This ''lacZ'' BioBrick was tested with the promoters P<sub>''liaG''</sub> and P<sub>''veg''</sub> and the results were directly compared to the ''lacZ'' from our reporter vector pSB<sub>''Bs''</sub>1C-''lacZ''. </p>
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
*'''luc'''    ([http://partsregistry.org/wiki/index.php?title=Part:BBa_K823028 BioBrick:BBa_K823028])
+
-
 
+
-
<p align="justify">We synthesized this luciferase for luminescence assays with luciferin as substrate.</p>
+
-
[[File:Luciferin reaction mod.png|thumb|center|400px]]
+
-
 
+
-
 
+
-
 
+
-
 
+
-
==Affinity Tags  [[File:Proteinaffinitytagbutton.png|50px]]==
+
-
<p></p>
+
-
 
+
-
All our tags have been synthesized by gene art. They are designed in Freiburg standard with an included optimized ribosome binding site. We have not tested our tags, yet.
+
-
 
+
-
prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
+
-
 
+
-
suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
+
-
 
+
-
*'''3x Flag - tag''' [http://partsregistry.org/Part:BBa_K823034 (BioBrick:BBa_K823034)]
+
-
 
+
-
 
+
-
*'''HA - tag''' [http://partsregistry.org/Part:BBa_K823035 (BioBrick:BBa_K823035)]
+
-
 
+
-
 
+
-
*'''cMyc - tag''' [http://partsregistry.org/Part:BBa_K823036 (BioBrick:BBa_K823036)]
+
-
 
+
-
 
+
-
*'''His - tag''' [http://partsregistry.org/Part:BBa_K823037 (BioBrick:BBa_K823037)]
+
-
 
+
-
 
+
-
*'''Strep - tag''' [http://partsregistry.org/Part:BBa_K823038  (BioBrick:BBa_K823038)]
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
-
 
+
<div class="box">
<div class="box">
====Project Navigation====
====Project Navigation====

Latest revision as of 16:41, 26 October 2012

iGEM Ludwig-Maximilians-Universität München Beadzillus

Team-LMU culture tubes.resized.jpg

The LMU-Munich team is exuberantly happy about the great success at the World Championship Jamboree in Boston. Our project Beadzillus finished 4th and won the prize for the "Best Wiki" (with Slovenia) and "Best New Application Project".

IGEM HQ LMU prize.jpg

[ more news ]

Sporenfreunde